CN110499361A - A kind of preparation method and application of terminal bases streaming fluorescence sequencing microballoon - Google Patents
A kind of preparation method and application of terminal bases streaming fluorescence sequencing microballoon Download PDFInfo
- Publication number
- CN110499361A CN110499361A CN201910700888.2A CN201910700888A CN110499361A CN 110499361 A CN110499361 A CN 110499361A CN 201910700888 A CN201910700888 A CN 201910700888A CN 110499361 A CN110499361 A CN 110499361A
- Authority
- CN
- China
- Prior art keywords
- ribose
- protected
- microballoon
- fluorescent marker
- dntp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention discloses a kind of preparation method and applications of terminal bases streaming fluorescence sequencing microballoon, this method utilizes determined nucleic acid fragment complementation sequence, primer, microballoon, nucleic acid polymerase, fluorescent marker ddNTP, the protected fluorescent marker dNTP of ribose 3'-OH, the protected dNTP of ribose 3'-OH, ribose 3'-OH deprotects agent etc., extended by the single base that microballoon is coated with primer, it has obtained a series of terminal bases streaming fluorescence suitable for flow cytomery nucleic acid base sequence and microballoon is sequenced, these sequencing microballoons are further detected through flow cytometer, the base sequence of available determined nucleic acid segment.Compared with existing PCR sequencing PCR, there are the present invention succinct, accurate and data the remarkable advantages such as easily to interpret.Gained sequencing microballoon of the invention can be widely used in the nucleic acid sequencings fields such as genetic test, microorganism checking, science of heredity, exon, single nucleotide polymorphism (SNP), genomics and proteomics, especially have good application with diagnostic field in tumour.
Description
Technical field
The present invention relates to a kind of preparation methods of terminal bases streaming fluorescence sequencing microballoon, more particularly to one kind to be suitable for stream
Formula cell instrument detects the preparation method of the terminal bases streaming fluorescence sequencing microballoon of nucleic acid base sequence and uses the end alkali
The method that microballoon detection nucleic acid base sequence is sequenced in base flow formula fluorescence, belongs to gene sequencing technology field.
Background technique
Genome carries whole hereditary information of living individual, and gene sequencing is not only able to deepen especially to dislike disease
Property tumour molecular mechanism understand, and also played an important role in terms of instructing target administration.Human activities environment plan
After the completion, the development of gene sequencing technology is swifter and more violent, being more widely applied in clinical practice and basic research.Currently,
Nucleic acid sequencing method has been developed to three generations, from the initial first generation using Sanger sequencing as the Direct Inspection Technology of representative and with chain point
Analysis was the indirect sequencing technologies of representative, to the SOLiD technology with the Solexa technology of illumina company and ABI company in 2005
(next-generation sequencing, NGS) is sequenced for the second generation of mark, to using SMRT, Nanopore method as representative
The third generation sequencing, although these PCR sequencing PCRs constantly improve gene sequencing efficiency and accuracy, but still exist operation
Complexity, resolution ratio are low and data are not easy the problems such as interpreting (such as: gene structure is reset and repeat region), constrain it and answer on a large scale
With.
Flow Cytometry is to carry out multi-parameter, quick quantitative analysis to individual cells or particle using flow cytometer
Technology, have the advantages that speed is fast, precision is high, accuracy is good, be one of advanced biosensor technique.Have common be applicable in
It is only used for the identification of known base mutation target spot in the coating primer of flow cytometer or the microballoon of probe, and cannot be used for alkali
Based sequencing.Therefore develop a kind of terminal bases streaming fluorescence sequencing microballoon suitable for flow cytomery nucleic acid base sequence
With substantial worth.
Summary of the invention
The object of the present invention is to provide a kind of terminal bases streamings suitable for flow cytomery nucleic acid base sequence
The preparation method of microballoon is sequenced in fluorescence, and this method for determined nucleic acid sequence can obtain that microballoon suitably is sequenced, and the sequencing is micro-
Ball can be detected by flow cytometer, and then accurately identify the base sequence of determined nucleic acid segment.
Currently, genetic test has important application in the medical domains such as science of heredity, pre-natal diagnosis and adjoint diagnosis.Example
Such as: determining whether patient specific gene's segment has mutation and mutational site by genetic test, target administration can be instructed, mentioned
The therapeutic effect of high tumour.And existing Flow Cytometry is only capable of identifying known gene mutation target spot, and cannot use
It is sequenced in base.The present invention provides the preparation methods for being suitable for the sequencing microballoon that flow cytometer is sequenced, and utilize the spy
Fixed method sequencing microballoon obtained can use flow cytomery, and then obtain specific nucleic acid base sequence, by with open country
The comparison of raw type base sequence, can interpret the information of gene mutation, have to pathogenesis elaboration, diseased individuals diagnosis and treatment important
Meaning.
Technical scheme is as follows:
A kind of preparation method of terminal bases streaming fluorescence sequencing microballoon, the preparation method the following steps are included:
(1) the unidirectional primer of determined nucleic acid fragment complementation sequence is coated on microsphere surface, forms the coated microballoon of primer；
(2) the coated microballoon of primer, nucleic acid polymerase, determined nucleic acid fragment complementation sequence and buffer are mixed, obtain mixture,
The mixture is divided into two parts, the ddNTP(dideoxynucleoside of fluorescent marker is added in a copy of it mixture
Triphosphate, dideoxyribonucleoside triphosphate) or/and the protected fluorescent marker of ribose 3'-OH dNTP
(deoxynucleoside triphosphate, deoxynucleoside triphosphate), is incubated for, and core is added in another mixture
The sugared protected dNTP of 3'-OH, is incubated for；
(3) it takes previous step that the microballoon that the protected dNTP of ribose 3'-OH is incubated for is added, ribose 3'-OH is added after washing and goes
Protective agent is uniformly mixed；
(4) microballoon of previous step is washed, is divided into two parts, a copy of it microballoon is mixed with nucleic acid polymerase and buffer, gained
The dNTP that the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker is added in mixture, is incubated for；Separately
A microballoon is mixed with nucleic acid polymerase and buffer, and the protected dNTP of ribose 3'-OH is added in gained mixture, is carried out
It is incubated for；
(5) the step of constantly repeating above-mentioned (3) and (4), sequencing n base of determined nucleic acid segment need continuously to prepare n groups of microballoons altogether,
Be obtained be added the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker the n group that is incubated for of dNTP it is micro-
Ball, this n groups of microballoons are that microballoon is sequenced in the so-called terminal bases streaming fluorescence of the present invention；
(6) if n group's microballoon using above-mentioned steps (5) can not detect all bases, need replacement step (2) and
(4) dNTP of the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker repeats step (2)-(5) and continues
Microballoon is prepared, 4 × n or 3 × n or 2 × n groups of microballoons, 4 × n, 3 × n, 2 × n or n crowd obtained in step (5) and (6) is obtained
Microballoon is sequenced in so-called terminal bases streaming fluorescence as of the invention, can be realized the survey of determined nucleic acid segment using these microballoons
Sequence.
Further, in the above method, the n is the base number of determined nucleic acid segment.
Further, in the above method, the ddNTP or/and ribose 3'-OH of the fluorescent marker being added in step (2) and (4)
When the type of the dNTP of protected fluorescent marker is 3 kinds or 4 kinds, core to be measured theoretically could be obtained using gained sequencing microballoon
All base sequences of acid fragment, when being added 3 kinds, corresponding 3 kinds of bases will appear testing result, if it is aobvious to come to nothing
Show, that is, indicates that the base is the base other than this 3 kinds.According to the ddNTP of the fluorescent marker being added in step (2) and (4) or/and
The difference of the type of the dNTP of the protected fluorescent marker of ribose 3'-OH, final resulting terminal bases streaming fluorescence sequencing are micro-
Group's number of ball is also different, and the group means that each resulting microballoon is not one, but multiple, therefore referred to as group.Root
According to the difference of the adding manner of the dNTP of the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker, final institute
Group's number of the terminal bases streaming fluorescence sequencing microballoon obtained can be n groups, 2n groups, 3n groups or 4n groups.
Further, the present invention is using determined nucleic acid fragment complementation sequence as template, under nucleic acid polymerization enzymatic, Yi Fenwei
Ball makes microballoon be coated with primer by the way that the dNTP of the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker is added
The single fluorescent marker base of terminal extension, this part of microballoon are preserved for base sequencing, another microballoon is by being added ribose 3'-OH
Protected dNTP and so that microballoon coating prime end is extended single non-fluorescent label base.Microballoon is coated with prime end and extends list
After a non-fluorescent label base, microballoon is set to be coated with primer extension chain end nucleic acid core by the way that ribose 3'-OH deprotection agent is added
This part of microballoon, is then divided into two parts, portion continuously adds the ddNTP or/and ribose 3'- of fluorescent marker by sugared 3'-OH deprotection
The dNTP of the protected fluorescent marker of OH, another continuously adds the protected dNTP of ribose 3'-OH, fluorescent marker is added
After the dNTP of ddNTP or/and the protected fluorescent marker of ribose 3'-OH, microballoon is coated with prime end and extends single fluorescent marker
Base, thus obtained microsphere are preserved for being sequenced, and after the protected dNTP of ribose 3'-OH is added, microballoon coating prime end prolongs again
Long single non-fluorescent label base.The microballoon that the protected dNTP of ribose 3'-OH is incubated for will be added, ribose 3'-OH is added again
Protective agent deprotection, be then again split into two parts, according to above-mentioned identical step be separately added into fluorescent marker ddNTP or/and
The protected dNTP of dNTP and ribose 3'-OH of the protected fluorescent marker of ribose 3'-OH, and so on, it constantly repeats above-mentioned
Operation, until all sequencing microballoons needed for obtaining n base of sequencing.The present invention select be added fluorescent marker ddNTP or/and
N group's microballoon that the dNTP of the protected fluorescent marker of ribose 3'-OH is incubated for is that the sequencing of terminal bases streaming fluorescence is micro-
Ball, these sequencing microballoons can by flow cytomery and for identification determined nucleic acid segment base sequences.
Further, in above-mentioned preparation method, the microballoon is microballoon used in Flow Cytometry, such as polystyrene
Microballoon, the microballoon can be commercially available by market.Microballoon used in the present invention can be size uniformity or scale coding it is micro-
Ball is also possible to without fluorescence or fluorescence-encoded microballoon.The diameter of microballoon can select in 0.5-50 μ m, preferably
It is 1-10 μm.
Further, microballoon of the present invention is the microballoon modified by following one or more modes: through carboxyl, ammonia
Base, hydroxyl, hydrazide group, aldehyde radical, chloromethyl, ethylene oxide, antibody, aptamer, Streptavidin, polythymidylic acid
(polythymidylic acid, poly T), polyadenylic acid (polyadenylic acid, poly A), poly-guanosine monophosphate
(polyguanylic acid, poly G), poly (polycytidylic acid, poly C), polyuridylic acid
At least one of (polyuridylic acid, poly U) and methylated CpG binding structural domain (MBD) albumen are modified.
Microballoon modification purpose be microsphere surface introduce can with the group in conjunction with unidirectional primer, so that unidirectional primer is coated on microballoon
Surface.Generally most popular is the microballoon modified by carboxyl, i.e. carboxylated micro-spheres.The modification of microballoon can pass through
The method reported in the prior art carries out, and can also directly buy the microballoon of modification.
Further, in above-mentioned preparation method, the determined nucleic acid segment is a) single stranded deoxyribonucleic acid
It (deoxyribonucleic acid, DNA) segment, b) double chain DNA fragment of denaturation and c) single-stranded is mixed with double chain DNA fragment
At least one of object, the signified determined nucleic acid segment of the present invention refer to specific required a certain segment, such as the full base of the mankind
Because a group sequence has disclosed, the whole genome sequence of other animals or microorganism also has relevant report, if it is desired to which detection is
Know the mankind, the animal, the specific a certain section of sequence of microorganism of whole genome sequence, this section of sequence for wanting detection is as to be measured
Nucleic acid fragment.For the complementary series of the nucleic acid fragment to be detected, unidirectional primer is designed.
Further, in above-mentioned preparation method, the unidirectional primer refer to using determined nucleic acid fragment complementation sequence as template,
It, can be in the primer of terminal extension base under polymerase catalysed.Unidirectional primer is right because to be coated with microsphere surface
It is modified, to form the group that can be combined with the modification group on microballoon on unidirectional primer.Therefore, of the invention
Unidirectional primer used is by amino, carboxyl, digoxin, biotin, poly A, poly G, poly C, poly T, poly
The unidirectional primer that at least one of U and methyl are modified.Between the unidirectional primer after microballoon and modification after modification
Guarantee to be combined, so that unidirectional primer can be coated with microsphere surface, what the coating referred to is exactly repairing on microballoon
The process that modification group on decorations group and unidirectional primer is combined, such as carboxyl has been modified on microballoon, it is repaired on unidirectional primer
Amino is adornd.The design and modification of unidirectional primer, which can be sent to corresponding design of primers company, to be completed, such as Shanghai Sangon Biotech Company.
Further, in above-mentioned preparation method, the nucleic acid polymerase is the archaeal dna polymerase that DNA is relied on, including Taq
Archaeal dna polymerase, Klenow segment, Sequenase (Sequenase).
Further, in above-mentioned preparation method, the ddNTP is dideoxyadenosine triphosphate
(dideoxyadenosine triphosphate, ddATP), dideoxyguanosine triphosphate (dideoxyguanosine
Triphosphate, ddGTP), it is dideoxycytidine triphosphate (dideoxycytidine triphosphate, ddCTP), double de-
Oxygen uridine triphosphate (dideoxyuridine triphosphate ddUTP), dideoxythymidine triphosphate
One of (dideoxythymidine triphosphate, ddTTP) or their two or more combinations, it is double de-
Oxygen uridine triphosphate (dideoxyuridine triphosphate, ddUTP) and dideoxythymidine triphosphate
(dideoxythymidine triphosphate, ddTTP) does not occur simultaneously.
Further, in above-mentioned preparation method, the dNTP is deoxyadenosine triphosphate (deoxyadenosine
Triphosphate, dATP), deoxyguanosine triphosphate (deoxyguanosine triphosphate, dGTP), deoxycytidine
Triphosphoric acid (deoxycytidine triphosphate, dCTP), deoxyuridine triphosphate (deoxyuridine
Triphosphate, dUTP), one of deoxythymidine triphosphate (deoxythymidine triphosphate, dTTP) or it
Two or more combination, deoxyuridine triphosphate (deoxyuridine triphosphate, dUTP) and deoxidation chest
Guanosine triphosphate (deoxythymidine triphosphate, dTTP) does not occur simultaneously.
Further, in above-mentioned preparation method, the protected fluorescence mark of ddNTP and ribose 3'-OH of the fluorescent marker
In the dNTP of note, the protected dNTP of ddNTP and ribose 3'-OH is subjected to fluorescent marker, to make in subsequent sequencing procedure
With in the present invention, ddNTP and the protected dNTP of ribose 3'-OH can be using any one or more following fluorescences
Matter is marked: fluorescein isothiocynate (fluorescein isothiocyanate, FITC), Alexa Fluor 610,
Alexa Fluor 488, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 700, cyanine dyes Cy5
(cyanine 5), texas Red (Texas Red), cyanine dyes Cy3 (cyanine 3), cyanine dyes Cy7 (cyanine 7),
Hydroxyl fluorescein (FAM), lucifer yellow (lucifer yellow), cyanine dyes Cy5.5 (cyanine 5.5), rhodamine 110
(rhodamine 110, R110), ROX, rhodamine 6G (rhodamine 6G, R6G), TAMRA.
Further, in above-mentioned preparation method, ddNTP, the protected fluorescent marker of ribose 3'-OH of the fluorescent marker
DNTP, the protected dNTP of ribose 3'-OH can be commercially available from market, protecting group chemistry (Wu Qin can also be referred to
Wear, Li Shanmao write, Chemical Industry Press, Beijing, 2007), Bioconjugate Techniques (second
Edition, Greg T.Hermanson, Elsevier press, 2008) method recorded in is voluntarily prepared.
Further, in above-mentioned preparation method, the buffer ultimate constituent be Tris-HCl (pH7-7.5),
MgCl2、NaCl。
Further, above-mentioned steps (2), (4), in (5), be added different at incubation system is distributed into, then control is closed
Suitable condition is incubated for.Be incubated for can 24 orifice bores, 24 hole filter board holes, 96 orifice bores, 96 hole filter board holes, 384 orifice bores,
It is carried out in the containers such as 384 hole filter board holes, centrifuge tube, EP pipe, being incubated for container used every time may be the same or different.Often
When secondary incubation, the total volume of incubation system is 10 μ l-10ml, preferably 10 μ l-50 μ l.Incubation system refers to being incubated for every time
When the mixture that is mixed to form required various composition.When being incubated for every time, in incubation system the final concentration of microballoon be 5 ×
102A/ml to 2.5 × 108A/ml, the final concentration of nucleic acid polymerase are 0.2-240 units/ml, every kind of fluorescent marker
The final concentration of ddNTP is 0.02-200 μm of ol/L, and the final concentration of the dNTP of every kind of protected fluorescent marker of ribose 3'-OH is equal
For 0.02-200 μm of ol/L, the final concentration of every kind of protected dNTP of ribose 3'-OH is 0.02-200 μm of ol/L.Fluorescence mark
The ddNTP of note is the ddATP of fluorescent marker, the ddTTP/ddUTP of fluorescent marker (ddTTP/dUTP mean ddTTP or
DdUTP, similarly hereinafter), any one or a few in the ddCTP of the ddGTP of fluorescent marker and fluorescent marker, fluorescent marker
DdATP, the ddTTP/ddUTP of fluorescent marker, the ddGTP of fluorescent marker and fluorescent marker ddCTP in any one (if
If addition) final concentration be 0.02-200 μm of ol/L.The dNTP of the protected fluorescent marker of ribose 3'-OH is ribose 3'-
The dATP of the protected fluorescent marker of OH, the dTTP/dUTP of the protected fluorescent marker of ribose 3'-OH, ribose 3'-OH are protected
Fluorescent marker the protected fluorescent marker of dGTP and ribose 3'-OH dCTP in any one or a few, ribose 3'-OH
The dATP of protected fluorescent marker, the dTTP/dUTP of the protected fluorescent marker of ribose 3'-OH, ribose 3'-OH are protected
The end of any one (if being added) in the dCTP of the protected fluorescent marker of dGTP and ribose 3'-OH of fluorescent marker
Concentration is 0.02-200 μm of ol/L.The protected dNTP of ribose 3'-OH are as follows: the protected dATP of ribose 3'-OH, ribose 3'-
The protected dTTP/dUTP(dTTP/dUTP of OH means dTTP or dUTP, similarly hereinafter), the protected dGTP of ribose 3'-OH and
The mixture of the protected dCTP of ribose 3'-OH, the protected dATP of ribose 3'-OH, the protected dTTP/ of ribose 3'-OH
The final concentration of any one in dUTP, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH is
0.02-200μmol/L。
Further, above-mentioned steps (2), (4), in (5), the temperature being incubated for every time is 0-100 DEG C, preferably 37-45
DEG C, the time being incubated for every time is 10s-60min, preferably 50-100s.
Further, in above-mentioned steps (3), ribose 3'-OH is added in the microballoon after incubation and deprotects agent, to ribose 3'-
OH is deprotected.The ribose 3'-OH deprotection agent can be bought from market.The final concentration of ribose 3'-OH deprotection agent
For 0.1-10mol/L.
Further, in above-mentioned steps (2) and (4), microballoon is divided into two parts, fluorescent marker is added in a copy of it microballoon
DdNTP or/and the protected fluorescent marker of ribose 3'-OH dNTP, it is protected that ribose 3'-OH is added in another microballoon
dNTP.The above method of the present invention is according to the base number of determined nucleic acid segment, and constantly repeatedly step (3) and (4) are available
The sequencing microballoon of group's number identical with the base number of determined nucleic acid segment, such as the base number of determined nucleic acid segment is n
When, it repeats step (3) and (4) and obtains n groups of sequencing microballoons, this n groups of sequencing microballoons are detected with flow cytometer, population of microspheres
Sequence correspond to base and put in order, it is hereby achieved that the base sequence of determined nucleic acid segment.When in step (2) and (4) plus
Enter ddATP, ddTTP/ddUTP, ddGTP, ddCTP that 3-4 kind fluorescence marks respectively or/and the protected dATP of ribose 3'-OH,
When dTTP/dUTP, dGTP, dCTP, only prepares n groups of sequencing microballoons and it is sequenced, so that it may obtain the alkali of segment to be measured
Basic sequence, such as when sequence to be measured is single stranded DNA, when ddATP, ddTTP/ that 3-4 kind fluorescence marks respectively are added simultaneously
When ddUTP, ddGTP, ddCTP, the base sequence of the nucleic acid fragment can be obtained by preparing n groups of microballoons after testing, and 4 kinds of addition is glimmering
When the ddNTP of signal, 4 kinds of bases can be detected simultaneously, when the ddNTP of three kinds of fluorescent markers is added, be only capable of detecting simultaneously
3 kinds of bases out, but display of coming to nothing is the 4th kind of base, therefore the ddNTP that 3 kinds of fluorescent markers are added can also pass through n groups
Microballoon disposably detects the base sequence of nucleic acid fragment.And it is added what 1-2 kind fluorescence marked respectively when step (2) and (4) are middle
DdATP, ddTTP/ddUTP, ddGTP, ddCTP or/and ribose 3'-OH protected dATP, dTTP/dUTP, dGTP, dCTP
When, only n groups of sequencing microballoons cannot obtain the base sequence of entire determined nucleic acid segment for that, need to carry out step (6) again, that is, replace
It changes the dNTP of the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker, repeats step (2)-(5), obtain 4 ×
N, 3 × n or 2 × n groups of sequencing microballoon, to guarantee that all possible base of all sites can detected.In the present invention
In a certain specific embodiment, the ddNTP that 2 kinds of fluorescence mark respectively or the ribose 3'-OH quilt that 2 kinds of fluorescence mark respectively is only added
When the dNTP of protection, obtained n group's sequencing microballoon can only detect both specific bases, therefore bases whole in order to obtain
Sequence needs to replace the protected dNTP of the ddNTP or ribose 3'-OH of fluorescent marker, repeats experiment, obtain detecting another two
N group's sequencing microballoon of kind base, these microballoons, which combine, can just obtain whole base sequences.
Further, in above-mentioned steps (6), the ddNTP that duplicate number depends on the fluorescent marker being added every time is sequenced
Or/and the number of the dNTP type of the protected fluorescent marker of ribose 3'-OH, the type being added every time is more, and duplicate number is just
Few, what is be added every time lacks, and duplicate number is with regard to more.When only preparing n groups of sequencing microballoons, all possibility are disposably detected
Base when, the configuration requirement of flow cytometer is higher, in order to reduce cost, the method for the present invention is made to be suitable for existing streaming
Cell instrument preferably prepares 2n groups of sequencing microballoons.When preparing 2n groups of microballoons using the above method, first add in step (2) and (4)
The dNTP for entering the protected fluorescent marker of ddNTP or ribose 3'-OH of any two kinds of fluorescent markers, obtains n groups of microballoons, then will
The dNTP of the protected fluorescent marker of ddNTP or ribose 3'-OH of two kinds of fluorescent markers in step (2) and (4) is replaced with separately
The dNTP of the protected fluorescent marker of ddNTP or ribose 3'-OH of two kinds of fluorescent markers repeats step (2)-(5), obtains n groups
Microballoon there are 2n groups of microballoons.2n groups of microballoons are easy to operate compared with 3n, 4n groups of microballoons, thin for streaming compared with n groups of microballoons
The configuration requirement of born of the same parents' instrument is low, and sequencing cost is low.The ddNTP or ribose 3'-OH for two kinds of fluorescent markers being added every time are protected
The dNTP of fluorescent marker can be optionally combined, such as the ddTTP/ddUTP and ddATP of fluorescent marker can first be added and obtain n groups
Microballoon, then ddGTP and ddCTP that they are substituted for fluorescent marker are obtained into n groups of microballoons；Fluorescent marker can also first be added
DdTTP/ddUTP and ddGTP obtains n groups of microballoons, then by ddATP and ddCTP that they are substituted for fluorescent marker obtain n groups it is micro-
Ball；The ddTTP/ddUTP and ddCTP that fluorescent marker can also first be added obtain n groups of microballoons, then they are substituted for fluorescent marker
DdATP and ddGTP obtain n groups of microballoons etc..
Further, the present invention provides a kind of specific preparation methods of terminal bases streaming fluorescence sequencing microballoon, including
Following steps:
(1) the unidirectional primer of determined nucleic acid fragment complementation sequence is coated on microsphere surface, obtains primer coating microballoon；
(2) primer coating microballoon, nucleic acid polymerase, determined nucleic acid fragment complementation sequence and buffer are added in container I, II,
One of the ddNTP of fluorescent marker, dNTP of the protected fluorescent marker of ribose 3'-OH or their group are continuously added in container I
It closes, continuously adds the protected dNTP of ribose 3'-OH in container II, be incubated for that (preferred, every liquid in containers final volume is
10 μ l to 10ml are mixed, and 0 DEG C to 100 DEG C is incubated for 10 seconds to 60 minutes)；
(3) microballoon in container II is washed, ribose 3'-OH deprotection agent is added, mixes；
(4) in container II, remaining microballoon moves in container III remaining portions microballoon from container II；
(5) microballoon is washed, container II and container III add nucleic acid polymerase, buffer, continuously add fluorescence in container II
The ddNTP of label, one of the dNTP of the protected fluorescent marker of ribose 3'-OH or combination continuously add ribose 3'- in container III
The protected dNTP of OH, is incubated for that (preferred every liquid in containers final volume is 10 μ l to 10ml, is mixed, 0 DEG C to 100 DEG C
It is incubated for 10 seconds to 60 minutes)；
(6) it constantly repeats similar (3) to (5) to operate, n base of sequencing nucleic acid segment needs the microballoon for continuously preparing n container altogether；
(7) if the microballoon using the n container can not detect all bases, the glimmering of replacement step (2) and (5) is needed
The dNTP of the protected fluorescent marker of ddNTP or/and ribose 3'-OH of signal repeats step (2)-(6), 4 × n is obtained
Or the microballoon of 3 × n or 2 × n container, the microballoon in all these containers are the so-called terminal bases streaming fluorescence of the present invention
Microballoon is sequenced.
Further, the present invention also provides a kind of specific preparation sides of preferred terminal bases streaming fluorescence sequencing microballoon
Method, comprising the following steps:
(1) the unidirectional primer of determined nucleic acid fragment complementation sequence is coated on microsphere surface, forms the coated microballoon of primer；
(2) primer coating microballoon, nucleic acid polymerase, determined nucleic acid fragment complementation that step (1) obtains are added in container I, II
Sequence and buffer continuously add the dNTP of the protected fluorescent marker of ddNTP or ribose 3'-OH of fluorescent marker in container I,
It is incubated for, gained sequencing microballoon is denoted as A1；The protected dNTP of ribose 3'-OH is continuously added in container II, is incubated for；Institute
State fluorescent marker ddNTP be fluorescent marker ddATP and fluorescent marker ddTTP/ddUTP (ddTTP or ddUTP, similarly hereinafter),
The dNTP of the protected fluorescent marker of ribose 3'-OH is the dATP and ribose 3'- of the protected fluorescent marker of ribose 3'-OH
The dTTP/dUTP of the protected fluorescent marker of OH, the protected dNTP of ribose 3'-OH are that ribose 3'-OH is protected
DATP, the protected dTTP/dUTP of ribose 3'-OH, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH；
Preferably, it is 10 μ l to 10ml that final volume is reacted in every container, is mixed, and 0 DEG C to 100 DEG C is incubated for 10 seconds to 60 minutes；
(3) in washing container II after microballoon, ribose 3'-OH deprotection agent is added, is mixed；
(4) in container II, remaining microballoon moves in container III remaining portions microballoon from container II；Wash microballoon, container II
Nucleic acid polymerase, buffer are added with container III, the ddNTP or ribose 3'-OH of fluorescent marker are continuously added in container II
The dNTP of protected fluorescent marker, gained sequencing microballoon are denoted as A2；It is protected that ribose 3'-OH is continuously added in container III
DNTP is incubated for；The ddNTP of the fluorescent marker is the ddATP of fluorescent marker and the ddTTP/ddUTP of fluorescent marker, institute
The dNTP for stating the protected fluorescent marker of ribose 3'-OH is the dATP and ribose 3'-OH of the protected fluorescent marker of ribose 3'-OH
The dTTP/dUTP of protected fluorescent marker, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH,
The protected dTTP/dUTP of ribose 3'-OH, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH；It is preferred that
, it is 10 μ l to 10ml that final volume is reacted in every container, is mixed, and 0 DEG C to 100 DEG C is incubated for 10 seconds to 60 minutes；
(5) the step of constantly repeating similar (3) and (4), the ddNTP or ribose 3'-OH that n groups of addition fluorescent markers are obtained are protected
The sequencing microballoon that the dNTP of the fluorescent marker of shield is incubated for, last a group sequencing microballoon are denoted as An, and wherein n is determined nucleic acid piece
The base number of section；
(6) container 1., 2. in primer the coating microballoon, nucleic acid polymerase, determined nucleic acid fragment complementation that step (1) obtains is added
Sequence and buffer, container 1. in continuously add the ddNTP or ribose 3'-OH protected fluorescent marker of fluorescent marker
DNTP is incubated for, and gained sequencing microballoon is denoted as B1；Container 2. in continuously add the protected dNTP of ribose 3'-OH, incubated
It educates；The ddNTP of the fluorescent marker is the ddGTP of fluorescent marker and the ddCTP of fluorescent marker, and the ribose 3'-OH is protected
Fluorescent marker dNTP be the protected fluorescent marker of ribose 3'-OH the protected fluorescent marker of dGTP and ribose 3'-OH
DCTP, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH, ribose 3'-OH it is protected
DTTP/dUTP, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH；Preferably, it is reacted eventually in every container
Volume is 10 μ l to 10ml, is mixed, and 0 DEG C to 100 DEG C is incubated for 10 seconds to 60 minutes；
(7) washing container 2. in after microballoon, add ribose 3'-OH deprotection agent, mix；
(8) remaining portions microballoon container 2. in, remaining microballoon from container 2. in move to container 3. in；Microballoon is washed, container is 2.
With container 3. in add nucleic acid polymerase, buffer, container 2. in continuously add the ddNTP or ribose 3'- of fluorescent marker
The dNTP of the protected fluorescent marker of OH, gained sequencing microballoon are denoted as B2；Container 3. in continuously add ribose 3'-OH protected
DNTP is incubated for；The ddNTP of the fluorescent marker is the ddGTP of fluorescent marker and the ddCTP of fluorescent marker, the ribose
The dNTP of the protected fluorescent marker of 3'-OH is that the dGTP and ribose 3'-OH of the protected fluorescent marker of ribose 3'-OH are protected
Fluorescent marker dCTP, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH, ribose 3'-OH quilt
DTTP/dUTP, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH of protection；Preferably, in every container
Reaction final volume is 10 μ l to 10ml, is mixed, and 0 DEG C to 100 DEG C is incubated for 10 seconds to 60 minutes；
(9) the step of constantly repeating similar (7) and (8), the ddNTP or ribose 3'-OH that n groups of addition fluorescent markers are obtained are protected
The sequencing microballoon that the dNTP of the fluorescent marker of shield is incubated for, last a group sequencing microballoon are denoted as Bn, and wherein n is determined nucleic acid piece
The base number of section, A1-An and B1-Bn these microballoons are referred to as sequencing microballoon.
Further, the present invention also provides a kind of specific systems of more preferably terminal bases streaming fluorescence sequencing microballoon
Preparation Method, comprising the following steps:
(1) the amido modified unidirectional primer of determined nucleic acid fragment complementation sequence is coated on to 1 μm to 10 μm of diameter of carboxylated
Surfaces of Polystyrene Microparticles；
(2) full-automatic liquor removing workstation is utilized, primer coating microballoon, nucleic acid are added in 96 hole filter board holes I (H1), hole II (H2)
Polymerase, determined nucleic acid fragment complementation sequence and buffer continuously add ddATP, the fluorescent marker of fluorescent marker in hole I (H1)
DdUTP/ddTTP, the protected dATP of ribose 3'-OH, the protected dUTP/ of ribose 3'-OH are continuously added in hole II (H2)
DTTP, the protected dGTP of ribose 3'-OH, the protected dCTP of ribose 3'-OH, hole I (H1), hole II (H2) are middle to react total volume
For 10 μ l-50 μ l, two holes mix, 37 DEG C be incubated for 60 seconds, gained sequencing microballoon is denoted as A1 (figure after being incubated in mesoporous I (H1)
1A)；
(3) microballoon in filtering and washing hole II (H2) adds ribose 3'-OH deprotection agent, mixes (Figure 1B)；
(4) remaining portions microballoon is in hole II (H2), remaining microballoon is from moving in hole III (H3) (Fig. 1 C) in hole II；
(5) filtering and washing microballoon, hole II (H2) and hole III (H3) add nucleic acid polymerase, buffer, hole II (H2) relaying
The ddUTP/ddTTP of the continuous ddATP that fluorescent marker is added, fluorescent marker, continuously add ribose 3'-OH in hole III (H3) and are protected
DATP, the protected dUTP/ddTTP of ribose 3'-OH, the protected dGTP of ribose 3'-OH, ribose 3'-OH it is protected
DCTP, it is 10 μ l-50 μ l that hole II (H2), hole III (H3), which react total volume, two holes mix, 37 DEG C incubation 60 seconds, mesoporous II
(H2) gained sequencing microballoon is denoted as A2 (Fig. 1 D) after being incubated in；
(6) similar (3) to (5) are constantly repeated to operate, the ddATP of n groups of addition fluorescent markers, the ddUTP/ of fluorescent marker is obtained
The sequencing microballoon that ddTTP is incubated for, last a group sequencing microballoon are denoted as An, and wherein n is the base number of determined nucleic acid segment；
(7) by " ddUTP/ddTTP of the ddATP of fluorescent marker, fluorescent marker " in above-mentioned (2), (5), it is changed to " fluorescent marker
DdGTP, fluorescent marker ddCTP ", repeat the operation of similar (2) to (6), be obtained the n group ddGTP that fluorescent marker is added,
The sequencing microballoon that the ddCTP of fluorescent marker is incubated for, first group of sequencing microballoon are denoted as B1, and last a group sequencing microballoon is denoted as
Bn, wherein n is the base number of determined nucleic acid segment；A1-An groups of microballoons obtained are for being sequenced core to be measured in above-mentioned steps (6)
Thymidine (T) and adenine (A) in acid fragment, B1-Bn groups of microballoons obtained are for being sequenced determined nucleic acid in step (7)
Cytimidine (C) or guanine (G) in segment.
Further, the present invention also provides a kind of sequencing approach of nucleic acid fragment, this method is: first according to above-mentioned end
The preparation method that microballoon is sequenced in base streaming fluorescence is made terminal bases streaming fluorescence and microballoon is sequenced, and sequencing microballoon is used streaming
Cell instrument is detected, and the base sequence of determined nucleic acid segment is obtained.Gained be sequenced microballoon be n groups or 2n groups or 3n groups or
4n groups, guarantee the correct base for detecting each site of the nucleic acid fragment, when detecting, the preparation sequence that microballoon is sequenced is corresponding
Base puts in order, and will test result and is integrated, and the entire base sequence of the nucleic acid fragment can be obtained.
Further, in above-mentioned sequencing approach, the nucleic acid fragment can be above-mentioned Single-stranded DNA fragments or change
Property double chain DNA fragment or single-stranded at least one of with double chain DNA fragment mixture.The nucleic acid fragment can be any life
The nucleic acid fragment of object, can be human body, it is being also possible to animal body, be also possible to microorganism.As long as being aware of its open country
Raw base sequence, so that it may be sequenced using the method for the present invention.The method of the present invention is succinct, result is accurate, data legibility
It reads, by can quickly judge whether there is base mutation with the comparison of wildtype nucleic acid segment, in genetic test, disorder in screening, base
Because instructing the fields such as target administration, single nucleotide polymorphism to have good application prospect.
It further, can be with by the preparation process of selection coding microball and control sequencing microballoon in above-mentioned sequencing approach
Parallel detection obtains multiple nucleic acid fragment sequences.
The present invention is extended by the single base that microballoon is coated with primer, establishes a kind of terminal bases streaming fluorescence sequencing microballoon
Preparation method, the sequencing base of the microballoon through the available determined nucleic acid segment of flow cytomery obtained with this method
Sequence.Compared with existing PCR sequencing PCR, nucleic acid targeting sequencing tool is carried out using terminal bases streaming fluorescence sequencing microballoon of the invention
There are the remarkable advantages such as succinct, accurate and easy interpretation.Gained sequencing microballoon of the invention is suitable for flow cytomery nucleic acid base
Sequence can be widely used in genetic test, microorganism checking, science of heredity, exon, single nucleotide polymorphism (SNP), genomics
With the nucleic acid sequencings field such as proteomics, target administration is instructed in disorder in screening, gene, especially in tumour with diagnosis neck
There is good application prospect in domain.
Detailed description of the invention
Fig. 1 is the terminal bases streaming fluorescence sequencing microballoon preparation flow figure based on 96 hole filter plates.A. in hole I (H1), with
Determined nucleic acid fragment complementation sequence is template, and under nucleic acid polymerization enzymatic, microballoon is coated with prime end and extends single fluorescence mark
Remember base；In hole II (H2), using determined nucleic acid fragment complementation sequence as template, under nucleic acid polymerization enzymatic, microballoon coating is drawn
The single base of object terminal extension;B. ribose 3'-OH is added in hole II (H2) and deprotects agent, microballoon is coated with primer extension chain end
Nucleic acid ribose 3'-OH deprotection；C. for remaining portions microballoon in hole II (H2), remaining microballoon moves to hole III (H3) from hole II
In；D. in hole II (H2), using determined nucleic acid fragment complementation sequence as template, under nucleic acid polymerization enzymatic, microballoon is coated with primer
The single fluorescent marker base of terminal extension；In hole III (H3), using determined nucleic acid fragment complementation sequence as template, in nucleic acid polymerase
Under catalysis, microballoon is coated with prime end and extends single base.
Fig. 2 is targeting sequencing EGF-R ELISA (epithelial growth factor receptor, EGFR)
The streaming histogram of gene T790M nucleic acid fragment (mixture of wild type and mutant plasmids DNA fragmentation) the 67th, sample are surveyed
The equal bit bases that sequence originates the 67th are thymidine (T) (Fig. 2A), cytimidine (C) (Fig. 2 B).
Fig. 3 is the Sanger sequencer map of EGFR gene T790M nucleic acid fragment, and wherein Fig. 3 A is wild type T790M nucleic acid piece
Section Sanger sequencer map；Fig. 3 B is saltant type T790M nucleic acid fragment Sanger sequencer map.
Fig. 4 be parallel targeting sequencing 21 L858R nucleic acid fragment of EGFR gene exon (wild plasmid DNA fragmentation),
The mixing sample of 18 G719X nucleic acid fragment of exon (mixture of wild type and mutant plasmids DNA fragmentation) originates the 1st alkali
The streaming point diagram of based sequencing, wherein Fig. 4 (i) is the testing result of thymidine (T), and Fig. 4 (ii) is the detection of adenine (A)
As a result, Fig. 4 (iii) is the testing result of cytimidine (C), Fig. 4 (iv) is the testing result of guanine (G)；In terms of result,
The base that 21 L858R of exon originates the 1st is thymidine (T), and the equal bit bases that 18 G719X of exon originates the 1st are
Adenine (A) and guanine (G).
Specific embodiment
Specific embodiments of the present invention are shown below, this is rather than to limit this hair to further explanation of the invention
Bright range.
Functional polystyrene microballoon used in embodiment is purchased from U.S. Spherotech, Inc., cyanine dyes Cy3 mark
Note ddATP, cyanine dyes Cy3 label ddGTP, cyanine dyes Cy5 label ddGTP, FITC label ddUTP, FITC label ddCTP are purchased from
PE company, the U.S., it is limited purchased from Shandong Xin Li section biotechnology that the protected dNTP of ribose 3'-OH, ribose 3'-OH deprotect agent
Company, archaeal dna polymerase Sequenase, archaeal dna polymerase klenow segment are ThermoFisher Scientific Products.
Unless otherwise instructed, following asymmetric PCR products, unidirectional primer are according to the PCR amplification side reported in the prior art
Method obtains or entrusts corresponding Chevron Research Company (CRC) to complete.
The preparation of the terminal bases streaming fluorescence sequencing microballoon of EGFR gene T790M nucleic acid fragment is sequenced in embodiment 1, targeting
(1) base sequence that EGFR gene T790M segment is found from NCBI Genebank, according to the complementary series of the sequence
Design unidirectional primer, and carry out it is amido modified, through amido modified unidirectional primer are as follows: 5 ' GGAAGCCTACGTGATGG CCA3 ',
The amido modified unidirectional primer is coated on to 7 μm of diameter of carboxylic polystyrene microsphere surface；
Archaeal dna polymerase Sequenase, T790M segment (wild type/mutant plasmids DNA is added in (2) 96 hole filter board holes I, II
The mixture of segment) asymmetric PCR product, buffer, 4000 primers coating microballoons, 0.5 μM of cyanine dyes are continuously added in hole I
Cy3 marks ddATP, 0.5 μM of FITC to mark ddUTP, continuously adds 4 × 10 in hole II5A primer is coated with microballoon, 10 μM of ribose
The protected dATP of 3'-OH, the protected dUTP of 10 μM of ribose 3'-OH, the protected dGTP of 10 μM of ribose 3'-OH, 10 μM of cores
The sugared protected dCTP of 3'-OH, every 10 μ l-50 μ l of hole final volume are mixed, and 37 DEG C are incubated for 60 seconds；
(3) microballoon in filtering and washing hole II adds ribose 3'-OH deprotection agent, mixes；
(4) the microballoon liquid for containing 4000 microballoons is retained in hole II, remaining microballoon liquid moves in hole III；
(5) microballoon in filtering and washing hole II and hole III, hole II and hole III add archaeal dna polymerase Sequenase, buffer,
0.5 μM of cyanine dyes Cy3 label ddATP, 0.5 μM of FITC label ddUTP are continuously added in hole II, continuously add 10 μM in hole III
The protected dATP of ribose 3'-OH, the protected dUTP of 10 μM of ribose 3'-OH, the protected dGTP of 10 μM of ribose 3'-OH, 10 μ
M ribose 3'-OH protected dCTP, every 10 μ l-50 μ l of hole final volume are mixed, and 37 DEG C are incubated for 60 seconds；
(6) according to the operation of step (3) to (5), by microballoon washing in hole III plus the agent of ribose 3'-OH deprotection, it is divided into two again
Hole, hole III plus 0.5 μM of cyanine dyes Cy3 label ddATP, 0.5 μM of FITC mark ddUTP, and hole IV plus 10 μM of ribose 3'-OH are protected
The dATP of shield, the protected dUTP of 10 μM of ribose 3'-OH, the protected dGTP of 10 μM of ribose 3'-OH, 10 μM of ribose 3'-OH quilts
The dCTP of protection presses the step repetitive operation of (3)-(5), continuous to prepare 76 hole microballoons；
(7) by " 0.5 μM of cyanine dyes Cy3 label ddATP, 0.5 μM of FITC mark ddUTP " in above-mentioned (2), (5), (6), more
It is changed to " 0.5 μM of cyanine dyes Cy3 label ddGTP, 0.5 μM of FITC label ddCTP ", repeats class according to step (2)-(6) process
It is continuous to prepare 76 hole microballoons like operation.
Because not containing uracil (U) in DNA fragmentation, when testing result is shown as uracil, the base is chest
Gland pyrimidine (T).76 hole microballoons made from above-mentioned (6) are used for thymidine (T), the adenine (A) being sequenced in T790M segment,
Cytimidine (C), guanine (G) that 76 hole microballoons are used to be sequenced in T790M segment are made in above-mentioned (7).
By the 76 hole microballoons washing of the 76 hole microballoons of step (6) preparation and step (7) preparation, difference loading flow cytometer
It is detected, all inspection results is integrated, obtain the sequencing result of T790M nucleic acid fragment are as follows: GCGTG GACAA
CCCCC ACGTG TGCCG CCTGC TGGGC ATCTG CCTCA CCTCC ACCGT GCAGC TCATC AC(C→T,
T790M)GCA GCTCA T.67th testing result is as shown in Fig. 2, it can be seen from the figure that the 67th base goes out simultaneously
Existing C and T's as a result, illustrating to exist simultaneously wild type and saltant type in the nucleic acid fragment.The testing result and sample Sanger are surveyed
Sequence method is consistent, as can be seen that the target bases of wild type T790M Plasmid DNA segment are C from Fig. 3 A (in bar-shaped frame)；From figure
As can be seen that the target bases of saltant type T790M Plasmid DNA segment are T in 3B (in bar-shaped frame).
The preparation of the terminal bases streaming fluorescence sequencing microballoon of EGFR gene T790M nucleic acid fragment is sequenced in embodiment 2, targeting
(1) base sequence that EGFR gene T790M is found from NCBI Genebank is designed according to the complementary series of the sequence
Unidirectional primer, and digoxin modification is carried out, the unidirectional primer modified through digoxin are as follows: 5 ' GGAAGCCTACGTGATGG CCA3 ',
The unidirectional primer that the digoxin is modified is coated on the Surfaces of Polystyrene Microparticles of 5 μm of diameter of DigiTAb modification；
Archaeal dna polymerase Sequenase, T790M segment (wild type and mutant plasmids DNA is added in (2) 96 hole filter board holes I, II
The mixture of segment) asymmetric PCR product, buffer, 4000 primers coating microballoons, 2 μM of cyanine dyes are continuously added in hole I
Cy3 marks ddATP, 2 μM of FITC label ddUTP, 2 μM of cyanine dyes Cy5 to mark ddGTP, continuously adds 4 × 10 in hole II5It is a to draw
Object is coated with microballoon, the protected dATP of 20 μM of ribose 3'-OH, the protected dUTP of 20 μM of ribose 3'-OH, 20 μM of ribose 3'-OH
Protected dGTP, 20 μM of ribose 3'-OH protected dCTP, every 10 μ l-50 μ l of hole final volume are mixed, and 37 DEG C are incubated for 60 seconds；
(3) microballoon in filtering and washing hole II adds ribose 3'-OH deprotection agent, mixes；
(4) the microballoon liquid for containing 4000 microballoons is retained in hole II, remaining microballoon liquid moves in hole III；
(5) microballoon in filtering and washing hole II and hole III, hole II and hole III add archaeal dna polymerase Sequenase, buffer,
2 μM of cyanine dyes Cy3 label ddATP, 2 μM of FITC label ddUTP, 2 μM of cyanine dyes Cy5 label ddGTP are continuously added in hole II,
The protected dATP of 20 μM of ribose 3'-OH, the protected dUTP of 20 μM of ribose 3'-OH, 20 μM of ribose 3'- are continuously added in hole III
The protected dGTP of OH, 20 μM of ribose 3'-OH protected dCTP, every 10 μ l-50 μ l of hole final volume are mixed, and 37 DEG C are incubated for 60
Second；
(6) according to the operation of step (3) to (5), by microballoon washing in hole III plus the agent of ribose 3'-OH deprotection, it is divided into two again
Hole, in hole III plus 2 μM of cyanine dyes Cy3 label ddATP, 2 μM of FITC label ddUTP, 2 μM of cyanine dyes Cy5 mark ddGTP, hole IV
In plus the protected dATP of 20 μM of ribose 3'-OH, the protected dUTP of 20 μM of ribose 3'-OH, 20 μM of ribose 3'-OH it is protected
DGTP, 20 μM of protected dCTP of ribose 3'-OH, by this step (3)-(5) step repetitive operation, 76 holes of continuous preparation are micro-
Ball；
By the 76 hole microballoons washing of step (6) preparation, loading flow cytometer, which carries out detection, can disposably obtain testing result,
When base is thymidine (T), guanine (G), adenine (A), fluorescence signal appearance is had, when unstressed configuration signal, that is, table
Show that the base is cytimidine (C).It is analyzed through data, obtains the sequencing result of T790M nucleic acid fragment are as follows: GCGTG GACAA
CCCCC ACGTG TGCCG CCTGC TGGGC ATCTG CCTCA CCTCC ACCGT GCAGC TCATC AC(C→T,
T790M there is C and T's as a result, illustrating to exist simultaneously in the nucleic acid fragment wild simultaneously in) GCA GCTCA T, the 67th base
Type and saltant type.
EGFR gene T790M nucleic acid fragment sample Sanger method sequencing result is consistent with sequencing result of the present invention.
Embodiment 3, parallel detection EGFR gene exon 21 L858R, exon 18 G719X point mutation terminal bases stream
The preparation of formula fluorescence sequencing microballoon
(1) found from NCBI Genebank EGFR gene include exon 21 L858R, exon 18 G719X target spot base
Sequence separately designs unidirectional primer according to the complementary series of sequence, and carries out biotin modification in unidirectional prime end, through biology
The unidirectional primer of 21 L858R of exon of element modification are as follows: 5 ' TGTCAAGATCACAGATTTTGGGC3 '；Through biotin modification
The unidirectional primer of 18 G719X of exon are as follows: 5 ' CTGAATTCAAAAAGATCAAAGTGCTG3 ', by the unidirectional primer of biotin modification
It is coated on two groups of Surfaces of Polystyrene Microparticles of the Streptavidin modification of about 3 μm of diameter of PE-Cy5 coding respectively；
Archaeal dna polymerase klenow segment, 21 L858R segment (wild plasmid of exon is added in (2) 96 hole filter board holes I, II
DNA fragmentation) it is multiple with the mixing sample of 18 G719X segment of exon (wild type/mutant plasmids DNA fragmentation mixture)
Asymmetric PCR product, buffer continuously add 2000 exon, 21 L858R primer coating microballoon, 2000 exon in hole I
18 G719X primers are coated with microballoon, 5 μM of cyanine dyes Cy3 label ddATP, 5 μM of FITC mark ddUTP, continuously add in hole II
20000 21 L858R primer of exon coating microballoons, 20000 18 G719X primers of exon are coated with microballoon, 5 μM of ribose 3'-
The protected dATP of OH, the protected dUTP of 5 μM of ribose 3'-OH, the protected dGTP of 5 μM of ribose 3'-OH, 5 μM of ribose 3'-OH
Protected dCTP, every 10 μ l-50 μ l of hole final volume are mixed, and 37 DEG C are incubated for 15 minutes；
(3) microballoon in filtering and washing hole II adds ribose 3'-OH deprotection agent, mixes；
(4) the microballoon liquid for containing 2000 microballoons is retained in hole II, remaining microballoon liquid moves in hole III；
(5) microballoon in filtering and washing hole II and hole III, hole II and hole III add archaeal dna polymerase klenow segment, buffer,
5 μM of cyanine dyes Cy3 label ddATP, 5 μM of FITC label ddUTP are continuously added in hole II, continuously add 5 μM of ribose in hole III
The protected dATP of 3'-OH, the protected dUTP of 5 μM of ribose 3'-OH, the protected dGTP of 5 μM of ribose 3'-OH, 5 μM of ribose
3'-OH protected dCTP, every 10 μ l-50 μ l of hole final volume are mixed, and 37 DEG C are incubated for 15 minutes；
(6) according to the operation of step (3) to (5), by microballoon washing in hole III plus the agent of ribose 3'-OH deprotection, it is divided into two again
Hole, hole III plus 5 μM of cyanine dyes Cy3 label ddATP, 5 μM of FITC mark ddUTP, and hole IV plus 5 μM of ribose 3'-OH are protected
DATP, the protected dUTP of 5 μM of ribose 3'-OH, the protected dGTP of 5 μM of ribose 3'-OH, 5 μM of ribose 3'-OH are protected
DCTP, it is continuous to prepare 10 hole microballoons by this step (3)-(5) step repetitive operation；
(7) it by " 5 μM of cyanine dyes Cy3 label ddATP, 5 μM of FITC mark ddUTP " in above-mentioned (2), (5), (6), is changed to
" 5 μM of cyanine dyes Cy3 label ddGTP, 5 μM of FITC mark ddCTP ", repeats similar operations according to step (2)-(6) process,
10 hole microballoons of continuous preparation.
Obtained 10 hole microballoons for being sequenced 21 L858R, exon 18 of exon in G719X segment parallel in above-mentioned (6)
Thymidine (T), adenine (A), in above-mentioned (7) be made 10 hole microballoons for parallel be sequenced exon 21 L858R, exon
Cytimidine (C), guanine (G) in 18 G719X mutant fragments.
By the 10 hole microballoons washing of the 10 hole microballoons of step (6) preparation and step (7) preparation, difference loading flow cytometer
It is detected, all inspection results is integrated, obtain the sequencing result of 21 L858R nucleic acid fragment of exon are as follows:
TGGCCAAACT；The sequencing result of 18 G719X nucleic acid fragment of exon are as follows: G (G → A, G719X) GCTC CGGTG.First alkali
The testing result of base is as shown in figure 4, the first bit base of starting of 21 L858R nucleic acid fragment of exon is T, and there is no mutation；And
There is G and A simultaneously in the first bit base of starting of 18 G719X segment of exon, illustrates to exist simultaneously wild type in the nucleic acid fragment
And saltant type.
The EGFR gene nucleic acid fragment sample Sanger PCR sequencing PCR result is consistent with sequencing result of the present invention.
Claims (10)
1. a kind of preparation method of terminal bases streaming fluorescence sequencing microballoon, it is characterized in that the following steps are included:
(1) the unidirectional primer of determined nucleic acid fragment complementation sequence is coated on microsphere surface, forms the coated microballoon of primer；
(2) the coated microballoon of primer, nucleic acid polymerase, determined nucleic acid fragment complementation sequence and buffer are mixed, obtain mixture,
The mixture is divided into two parts, the ddNTP or/and ribose 3'-OH that fluorescent marker is added in a copy of it mixture are protected
The dNTP of fluorescent marker, is incubated for, and the protected dNTP of ribose 3'-OH is added in another mixture, is incubated for；
(3) it takes previous step that the microballoon that the protected dNTP of ribose 3'-OH is incubated for is added, ribose 3'-OH is added after washing and goes
Protective agent is uniformly mixed；
(4) microballoon of previous step is washed, is divided into two parts, a copy of it microballoon is mixed with nucleic acid polymerase and buffer, gained
The dNTP that the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker is added in mixture, is incubated for；Separately
A microballoon is mixed with nucleic acid polymerase and buffer, and the protected dNTP of ribose 3'-OH is added in gained mixture, is carried out
It is incubated for；
(5) the step of repeating above-mentioned (3) and (4), sequencing n base of determined nucleic acid segment are needed continuously to prepare n groups of microballoons altogether, be there are
The n group's microballoon being incubated for the dNTP for the protected fluorescent marker of ddNTP or/and ribose 3'-OH that fluorescent marker is added；
(6) if can not detect all bases using n group's microballoon of above-mentioned steps (5), replacement step (2) and (4)
The dNTP of the protected fluorescent marker of ddNTP or/and ribose 3'-OH of fluorescent marker, repetition step (2)-(5) are continued to prepare micro-
4 × n or 3 × n or 2 × n groups of microballoons are obtained in ball, and 4 × n, 3 × n, 2 × n or n group microballoon obtained in step (5) and (6) are
Microballoon is sequenced to can be realized the terminal bases streaming fluorescence of determined nucleic acid sequencing fragment.
2. preparation method according to claim 1, it is characterized in that: the ddNTP of the fluorescent marker is fluorescent marker
At least one of ddATP, ddGTP, ddCTP and ddUTP/ddTTP；
Preferably, the dNTP of the protected fluorescent marker of ribose 3'-OH is the protected fluorescent marker of ribose 3'-OH
At least one of dATP, dGTP, dCTP and dUTP/dTTP；
Preferably, the protected dNTP of ribose 3'-OH be ribose 3'-OH protected dATP, dTTP/dUTP, dGTP and
The mixture of dCTP.
3. preparation method according to claim 1 or 2, it is characterized in that: the ddNTP of the fluorescent marker or ribose 3'-OH
The dNTP of protected fluorescent marker is marked by any one or more following fluorescent materials: fluorescein isothiocynate,
Alexa Fluor 610、Alexa Fluor 488、Alexa Fluor 633、Alexa Fluor 647、Alexa Fluor
700, cyanine dyes Cy5, texas Red, cyanine dyes Cy3, cyanine dyes Cy7, hydroxyl fluorescein, lucifer yellow, cyanine dyes Cy5.5, sieve
Red bright 110, ROX, rhodamine 6G, TAMRA.
4. preparation method according to claim 1 or 2, it is characterized in that: any two kinds of fluorescence is added in step (2) and (4)
The dNTP of the protected fluorescent marker of ddNTP or ribose 3'-OH of label, obtains n groups of microballoons, then will be in step (2) and (4)
The dNTP of the protected fluorescent marker of ddNTP or ribose 3'-OH of two kinds of fluorescent markers replace with other two fluorescent marker
The dNTP of ddNTP or the protected fluorescent marker of ribose 3'-OH, repeat step (2)-(5), obtain n groups of microballoons, there are 2n groups it is micro-
Ball.
5. preparation method according to claim 1 or 4, it is characterized in that the following steps are included:
(1) the unidirectional primer of determined nucleic acid fragment complementation sequence is coated on microsphere surface, forms the coated microballoon of primer；
(2) primer coating microballoon, nucleic acid polymerase, determined nucleic acid fragment complementation that step (1) obtains are added in container I, II
Sequence and buffer continuously add the dNTP of the protected fluorescent marker of ddNTP or ribose 3'-OH of fluorescent marker in container I,
It is incubated for, gained sequencing microballoon is denoted as A1；The protected dNTP of ribose 3'-OH is continuously added in container II, is incubated for；Institute
The ddNTP for stating fluorescent marker is the ddATP of fluorescent marker and the ddTTP/ddUTP of fluorescent marker, and the ribose 3'-OH is protected
Fluorescent marker dNTP be the protected fluorescent marker of ribose 3'-OH the protected fluorescent marker of dATP and ribose 3'-OH
DTTP/dUTP, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH, ribose 3'-OH protected
DTTP/dUTP, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH；
(3) in washing container II after microballoon, ribose 3'-OH deprotection agent is added, is uniformly mixed；
(4) in container II, remaining microballoon moves in container III remaining portions microballoon from container II；Wash microballoon, container II
Nucleic acid polymerase, buffer are added with container III, the ddNTP or ribose 3'-OH of fluorescent marker are continuously added in container II
The dNTP of protected fluorescent marker, gained sequencing microballoon are denoted as A2；It is protected that ribose 3'-OH is continuously added in container III
DNTP is incubated for；The ddNTP of the fluorescent marker is the ddATP of fluorescent marker and the ddTTP/ddUTP of fluorescent marker, institute
The dNTP for stating the protected fluorescent marker of ribose 3'-OH is the dATP and ribose 3'-OH of the protected fluorescent marker of ribose 3'-OH
The dTTP/dUTP of protected fluorescent marker, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH,
The protected dTTP/dUTP of ribose 3'-OH, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH；
(5) the step of constantly repeating similar (3) and (4), the ddNTP or ribose 3'-OH that n groups of addition fluorescent markers are obtained are protected
The sequencing microballoon that the dNTP of the fluorescent marker of shield is incubated for, last a group sequencing microballoon are denoted as An, and wherein n is determined nucleic acid piece
The base number of section；
(6) container 1., 2. in primer the coating microballoon, nucleic acid polymerase, determined nucleic acid fragment complementation that step (1) obtains is added
Sequence and buffer, container 1. in continuously add the ddNTP or ribose 3'-OH protected fluorescent marker of fluorescent marker
DNTP is incubated for, and gained sequencing microballoon is denoted as B1；Container 2. in continuously add the protected dNTP of ribose 3'-OH, incubated
It educates；The ddNTP of the fluorescent marker is the ddGTP of fluorescent marker and the ddCTP of fluorescent marker, and the ribose 3'-OH is protected
Fluorescent marker dNTP be the protected fluorescent marker of ribose 3'-OH the protected fluorescent marker of dGTP and ribose 3'-OH
DCTP, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH, ribose 3'-OH it is protected
DTTP/dUTP, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH；
(7) washing container 2. in after microballoon, add ribose 3'-OH deprotection agent, be uniformly mixed；
(8) remaining portions microballoon container 2. in, remaining microballoon from container 2. in move to container 3. in；Microballoon is washed, container is 2.
With container 3. in add nucleic acid polymerase, buffer, container 2. in continuously add the ddNTP or ribose 3'- of fluorescent marker
The dNTP of the protected fluorescent marker of OH, gained sequencing microballoon are denoted as B2；Container 3. in continuously add ribose 3'-OH protected
DNTP is incubated for；The ddNTP of the fluorescent marker is the ddGTP of fluorescent marker and the ddCTP of fluorescent marker, the ribose
The dNTP of the protected fluorescent marker of 3'-OH is that the dGTP and ribose 3'-OH of the protected fluorescent marker of ribose 3'-OH are protected
Fluorescent marker dCTP, the protected dNTP of ribose 3'-OH be the protected dATP of ribose 3'-OH, ribose 3'-OH quilt
DTTP/dUTP, the protected dCTP of ribose 3'-OH protected dGTP and ribose 3'-OH of protection；
(9) the step of constantly repeating similar (7) and (8), the ddNTP or ribose 3'-OH that n groups of addition fluorescent markers are obtained are protected
The sequencing microballoon that the dNTP of the fluorescent marker of shield is incubated for, last a group sequencing microballoon are denoted as Bn, and wherein n is determined nucleic acid piece
The base number of section, A1-An and B1-Bn these microballoons are terminal bases streaming fluorescence sequencing microballoon.
6. preparation method according to any one of claims 1-5, it is characterized in that: the microballoon is the micro- of size uniformity
Microballoon, the microballoon without fluorescence or the fluorescence-encoded microballoon of ball, scale coding；
Preferably, the diameter of microballoon is 0.5-50 μm, more preferably 1-10 μm；
Preferably, the microballoon is suitable through carboxyl, amino, hydroxyl, hydrazide group, aldehyde radical, chloromethyl, ethylene oxide, antibody, nucleic acid
In ligand, Streptavidin, poly T, poly A, poly G, poly C, poly U and methylated CpG binding structural domain albumen
At least one microballoon modified, more preferably carboxylated micro-spheres.
7. preparation method according to any one of claims 1-5, it is characterized in that: the determined nucleic acid segment is single-stranded
At least one of DNA fragmentation, the double chain DNA fragment of denaturation and single-stranded and double chain DNA fragment mixture；
Preferably, the nucleic acid polymerase is the archaeal dna polymerase that DNA is relied on；
Preferably, the unidirectional primer is through amino, carboxyl, digoxin, biotin, poly A, poly G, poly C, poly
T, the unidirectional primer that at least one of poly U and methyl are modified, more preferably through amido modified unidirectional primer.
8. according to claim 1, preparation method described in 2 or 5, it is characterized in that: when being incubated for every time, the end of microballoon in incubation system
Concentration is 5 × 102A/ml-2.5 × 108A/ml, the final concentration of nucleic acid polymerase are 0.2-240 units/ml, and every kind
The final concentration of the ddNTP of fluorescent marker is 0.02-200 μm of ol/L, the dNTP of every kind of protected fluorescent marker of ribose 3'-OH
Final concentration be 0.02-200 μm of ol/L, the final concentration of every kind of protected dNTP of ribose 3'-OH is 0.02-200 μm of ol/
L。
9. preparation method according to claim 1 or 8 carries out it is characterized in that: being incubated in following containers: 24 orifice bores,
24 hole filter board holes, 96 orifice bores, 96 hole filter board holes, 384 orifice bores, 384 hole filter board holes, centrifuge tube or EP pipe, are incubated for institute every time
Container is same or different；
Preferably, the temperature being incubated for every time is 0-100 DEG C, and more preferably 37-45 DEG C；
Preferably, the time being incubated for every time is 10s-60min, more preferably 50-100s；
Preferably, when being incubated for every time, the total volume of incubation system is 10 μ l-10ml, more preferably 10 μ l-50 μ l.
10. a kind of sequencing approach of nucleic acid fragment, it is characterized in that: according to terminal bases of any of claims 1-9
Required sequencing microballoon is made in the preparation method of streaming fluorescence sequencing microballoon, and sequencing microballoon is examined using flow cytometer
It surveys, obtains the base sequence of determined nucleic acid segment.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910700888.2A CN110499361B (en) | 2019-07-31 | 2019-07-31 | Preparation method and application of terminal base flow type fluorescence sequencing microspheres |
| PCT/CN2020/104765 WO2021018080A1 (en) | 2019-07-31 | 2020-07-27 | Method for preparing terminal base flow fluorescent sequencing microspheres and use thereof |
| ZA2021/10573A ZA202110573B (en) | 2019-07-31 | 2021-12-17 | Preparation and application of terminus base cytometric fluorescence sequencing microspheres |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910700888.2A CN110499361B (en) | 2019-07-31 | 2019-07-31 | Preparation method and application of terminal base flow type fluorescence sequencing microspheres |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499361A true CN110499361A (en) | 2019-11-26 |
| CN110499361B CN110499361B (en) | 2022-11-25 |
Family
ID=68586760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910700888.2A Active CN110499361B (en) | 2019-07-31 | 2019-07-31 | Preparation method and application of terminal base flow type fluorescence sequencing microspheres |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN110499361B (en) |
| WO (1) | WO2021018080A1 (en) |
| ZA (1) | ZA202110573B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021018080A1 (en) * | 2019-07-31 | 2021-02-04 | 齐鲁工业大学 | Method for preparing terminal base flow fluorescent sequencing microspheres and use thereof |
| CN117330759A (en) * | 2022-09-14 | 2024-01-02 | 杭州赛基生物科技有限公司 | Kit for detecting tumor-associated diagnosis related factors and detection method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005003375A2 (en) * | 2003-01-29 | 2005-01-13 | 454 Corporation | Methods of amplifying and sequencing nucleic acids |
| CN1932033A (en) * | 2006-09-22 | 2007-03-21 | 东南大学 | Nucleic acid sequencing process based on micro array chip |
| CN1940088A (en) * | 2006-10-10 | 2007-04-04 | 东南大学 | DNA sequence measurement based on primer extension |
| CN102634587A (en) * | 2012-04-27 | 2012-08-15 | 东南大学 | Method for combined and extended detection of continuous mutation of base by deoxyribonucleic acid (DNA) chips |
| CN103667469A (en) * | 2013-11-29 | 2014-03-26 | 武汉科技大学 | DNA sequencing method based on universal bases |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101713782A (en) * | 2009-10-27 | 2010-05-26 | 苏州苏大赛尔免疫生物技术有限公司 | Kit for detecting specificity platelet antoantibody by combination of monoclonal antibody and nano-microspheres |
| US20170205404A1 (en) * | 2016-01-19 | 2017-07-20 | General Electric Company | Multifunctional beads and methods of use for capturing rare cells |
| CN105925572B (en) * | 2016-06-07 | 2020-08-21 | 杭州微著生物科技有限公司 | DNA coding microsphere and synthetic method thereof |
| CN108424844B (en) * | 2018-04-08 | 2020-07-28 | 上海交通大学 | Single-molecule sequencing chip and preparation method thereof |
| CN109920482A (en) * | 2019-01-29 | 2019-06-21 | 厦门大学 | A method of analyzing unicellular content |
| CN110499361B (en) * | 2019-07-31 | 2022-11-25 | 齐鲁工业大学 | Preparation method and application of terminal base flow type fluorescence sequencing microspheres |
-
2019
- 2019-07-31 CN CN201910700888.2A patent/CN110499361B/en active Active
-
2020
- 2020-07-27 WO PCT/CN2020/104765 patent/WO2021018080A1/en active Application Filing
-
2021
- 2021-12-17 ZA ZA2021/10573A patent/ZA202110573B/en unknown
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005003375A2 (en) * | 2003-01-29 | 2005-01-13 | 454 Corporation | Methods of amplifying and sequencing nucleic acids |
| CN1932033A (en) * | 2006-09-22 | 2007-03-21 | 东南大学 | Nucleic acid sequencing process based on micro array chip |
| CN1940088A (en) * | 2006-10-10 | 2007-04-04 | 东南大学 | DNA sequence measurement based on primer extension |
| CN102634587A (en) * | 2012-04-27 | 2012-08-15 | 东南大学 | Method for combined and extended detection of continuous mutation of base by deoxyribonucleic acid (DNA) chips |
| CN103667469A (en) * | 2013-11-29 | 2014-03-26 | 武汉科技大学 | DNA sequencing method based on universal bases |
Non-Patent Citations (1)
| Title |
|---|
| 张瑞华等: "分散聚合法制备流式聚苯乙烯微球的研究", 《山东轻工业学院学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021018080A1 (en) * | 2019-07-31 | 2021-02-04 | 齐鲁工业大学 | Method for preparing terminal base flow fluorescent sequencing microspheres and use thereof |
| CN117330759A (en) * | 2022-09-14 | 2024-01-02 | 杭州赛基生物科技有限公司 | Kit for detecting tumor-associated diagnosis related factors and detection method thereof |
| CN117330759B (en) * | 2022-09-14 | 2024-03-15 | 杭州赛基生物科技有限公司 | Kit for detecting tumor-associated diagnosis related factors and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| ZA202110573B (en) | 2022-04-28 |
| WO2021018080A1 (en) | 2021-02-04 |
| CN110499361B (en) | 2022-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110431237A (en) | For the analysis system close to labeling biomolecule orthogonal in cellular compartment | |
| CN105264088B (en) | Improve the dynamic range of multiple epitopes in identification of cell | |
| JP7100680B2 (en) | Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications | |
| ES2320604T3 (en) | IDENTIFICATION OF DNA POLYMORPHISMS THROUGH THE USE OF FLOW CYTOMETRY. | |
| CN110268059A (en) | Unicellular full-length genome library and the combined index method for preparing it | |
| CN105934523A (en) | Multiplex detection of nucleic acids | |
| CN107407685A (en) | The method of quick accurate distribution, visualization and analysis individual cells | |
| CN102634587B (en) | Method for combined and extended detection of continuous mutation of base by deoxyribonucleic acid (DNA) chips | |
| CN107532213A (en) | Method for detecting multiple nucleotide sequences in sample simultaneously | |
| CN110036117A (en) | Increase the method for the treating capacity of single-molecule sequencing by multi-joint short dna segment | |
| CN104254617A (en) | Method of dna detection and quantification by single-molecule hybridization and manipulation | |
| CN102586456B (en) | Method for detecting copy number variations through multiple competitive polymerase chain reaction (PCR) | |
| CN111073961A (en) | High-throughput detection method for gene rare mutation | |
| JP2017533709A (en) | Sequencing from multiple primers to increase data speed and density | |
| CN110004225B (en) | Tumor chemotherapeutic drug individualized gene detection kit, primers and method | |
| CN110499361A (en) | A kind of preparation method and application of terminal bases streaming fluorescence sequencing microballoon | |
| CN101570784B (en) | Signal combination coding-based DNA ligation sequencing method | |
| CN107312873B (en) | A kind of multiple liquid phase genetic chip detection primer, kit and method of 5 kinds of Respiratory Tract of Mice cause of diseases of quick differentiation | |
| CN109628573B (en) | Kit for noninvasive prenatal detection of 12 chromosome microdeletion and microduplication syndrome and special probe set thereof | |
| AU2017246638B2 (en) | Multiplexed analysis of neuron projections by sequencing | |
| CN117552114A (en) | Single cell profile analysis based on aptamer sequencing | |
| WO2023216707A1 (en) | Universal preclinical bio-distribution detection kit for nk cell therapy products | |
| CN107250381A (en) | The normalized iterative bar code of DNA set and sequencing | |
| WO2021103695A1 (en) | Single-base continuous extension flow-type targeted sequencing method | |
| CN113795591A (en) | Methods and systems for characterizing tumors and identifying tumor heterogeneity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |