CN110499317A - A kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium - Google Patents
A kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium Download PDFInfo
- Publication number
- CN110499317A CN110499317A CN201910780353.0A CN201910780353A CN110499317A CN 110499317 A CN110499317 A CN 110499317A CN 201910780353 A CN201910780353 A CN 201910780353A CN 110499317 A CN110499317 A CN 110499317A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- osabcg36
- abcg36
- cadmium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to field of plant genetic project technology, and in particular to be a kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium, the gene are rice abc transport Protein G family gene, the sequence of the gene is as shown in SEQ ID NO.1.Rice ABCG36 gene of the invention is mainly expressed in root, and by the induction of Cd；Subcellular Localization shows that it is primarily targeted on cell membrane.The present invention essentially describes effect of the OsABCG36 gene in rice Cd transhipment.OsABCG36 of the invention can be used as a cadmium transport protein, play a significant role in terms of the solution cadmium poison of rice.
Description
Technical field
The invention belongs to field of plant genetic project technology, and in particular to be a kind of rice Os ABCG36 gene and its
Transport the effect in heavy metal cadmium.
Background technique
Cadmium is a kind of harmful heavy metal being present in nature, all has very high toxicity to plant, animal and people.Make
Cd too high levels in object will lead to nutrient imbalance, protein function disorder, DNA and cell membrane damage and toxic active oxygen
(ROS) accumulation, is remarkably decreased so as to cause plant growth and yield.More seriously, the accumulation of Cd can in edible crop
Human health can be threatened, such as in the 1970s, in " Itai-itai diseases " that Japan occurs, precisely due to having eaten containing the big of cadmium poison
Caused by rice.
In order to adapt to the pollution of Cd in environment, plant has evolved the side of body that a variety of regulatory mechanisms carry out Cd in response environment
Compel, such as the discharge to Cd, chelating and isolation.In these mechanism, abc transport protein family plays in the Cd resistance of plant
Very important effect.For example, AtABCG36/AtPDR8 is positioned on the cytoplasma membrane of root cells in arabidopsis, mainly
Make Cd Cd complex discharge cell to have the function that removing toxic substances.Another abc transport albumin A tABCB25/AtATM3 positioning
In the cadmium tolerance that arabidopsis on mitochondrial membrane, can be enhanced after overexpression in plant body, but its specific resistance to cadmium regulates and controls machine
System is still not clear.In addition, be reported can be by Cd by two ABCC type transporters AtABCC1 and AtABCC2 in arabidopsis
It is isolated in vacuole.Another ABCC type transporter AtABCC3 by the way that PC-Cd compound is transported in the vacuole of arabidopsis,
And then participate in the tolerance of cadmium.In rice, by the OsABCG43 gene of Cd inducing expression, heterogenous expression in yeast after can be with
Improve the Cd tolerance of yeast.However, if it also assists in there are also other abc transport bodies and still needs in the tolerance of rice Cd
Research.
An ABCG type transporter is had found in research before --- OsABCG36/OsPDR9, it was reported that be by Cd
Induction, and speculate that it may play a role in heavy metal cadmium stress.However, the function of OsABCG36/OsPDR9 is not yet clear
Chu.Rice (Oryza sativa) is one of daily staple food of people, is also important unifacial leaf model plant and cereal crops,
How focus that high-quality and high yield rice be always people is produced.Due to the pollution in environment by heavy metal, especially
The increasingly exacerbation of cadmium poison pollution, the rice for how producing cadmium tolerance become one of the hot spot of numerous researchs.However, specific thin
The specificity of born of the same parents position, biological function and these metal transport proteins is still unknown in rice.Therefore, it is resistance to illustrate cadmium poison
The effect of the molecular regulation mechanism received in rice is worldwide still a serious problem.In the present invention, we
Obtain the knockout mutations body of two independent OsABCG36 genes by CRISPR-Cas9 technology, and in rice to it
Gene expression dose, cellular localization, transport activity and physiological phenotype etc. are probed into yeast.Result table of the invention
Bright, OsABCG36 is related with the Cd tolerance of rice.
Disclosing the information of the background technology part, it is only intended to increase understanding of the overall background of the invention, without should
It is considered as recognizing or implying in any form that the information constitutes the prior art already known to those of ordinary skill in the art.
Summary of the invention
The invention discloses a rice Os ABCG36 gene and its effects in transhipment heavy metal cadmium, are Study On Rice
Resistance to cadmium regulatory mechanism provides a candidate gene.
Technical solution provided by the invention is as follows:
A kind of rice Os ABCG36 gene is rice abc transport Protein G family gene, the sequence of the gene such as SEQ
Shown in ID NO.1.
The present invention provides effect of the rice Os ABCG36 gene in transhipment heavy metal cadmium.
Compared with prior art, the invention has the following beneficial effects:
(1) rice Os ABCG36 gene of the invention is mainly expressed in the root of rice, and expression is induced by Cd.When
Its transport function is analyzed in yeast shows that the ability of OsABCG36 transhipment Cd ion is remarkably reinforced compared to empty carrier.
(2) transient expression OsABCG36 shows that it is positioned on cell membrane in rice protoplast body cell.
(3) the prominent of two different mutational sites has been screened in the building that mutant plants are carried out using CRISPR-Cas9 technology
Variant plant carries out subsequent experimental.To mutant plants carry out Cd processing after amount root long discovery, mutant plants root long compared to
Wild type obviously shortens, and shows sensitivity phenomenon to Cd.The result shows that OsABCG36 takes part in the tolerance tune of Cd in rice
Control.
Detailed description of the invention
Fig. 1 is that the sequence analysis of ABCG family in rice and arabidopsis analyzes result；
Fig. 2 is OsABCG36 gene structure figure and mutant plants type；
Fig. 3 is expression of the OsABCG36 in root and stem；
Fig. 4 is the processing of different Cd concentration, influence of the different disposal time to OsABCG36 expression；
Fig. 5 is OsABCG36 in rice protoplast sub-cellular positioning scenarios；
Fig. 6 is that OsABCG36 transports Activity Results analysis in yeast；
Fig. 7 is the analysis of OsABCG36 mutant plants seedling cadmium tolerance.
Specific embodiment
Presently preferred embodiments of the present invention is explained in detail below with reference to each attached drawing, so that advantages of the present invention and spy
Sign easier can be readily appreciated by one skilled in the art, to make apparent specific boundary to protection scope of the present invention
It is fixed.
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material and reagent as used in the following examples, are commercially available unless otherwise specified.
Embodiment 1:
1. vegetable material and growth conditions
Wild type OryzasativaLcv.Nipponbare rice and two OsABCG36 mutant plants are used for this research.
Rice paddy seed is soaked in deionized water, after 28 DEG C of dark germination 48h, seed is put on strainer, is put in and contains
There is 0.5mM CaCl2In the plastic containers of deionized water, 28 DEG C of culture 2d.Various experiments are used for after root long length to 20-30mm.
The acquisition of 2.OsABCG36 gene complete sequence
For the CDS sequence of isolated OsABCG36, Trizol kit (Life is used according to product description
Technologies) total serum IgE is extracted from rice root tissue.Total serum IgE (1 μ g) is taken, Hiscript II Q RT is used
The synthesis of SuperMix Kit (Vazyme) synthetic agent box (Takara) progress first chain of cDNA.The cDNA of acquisition is used for down
The template of OsABCG36 complete sequence is obtained in column different experiments.
The building of 3.OsABCG36 mutant plants
OsABCG36 full length gene is 4374bp, has 21 exons and 20 intrones, is had as shown in Figure 2 A
Gene structure figure.
In order to construct the mutant plants of OsABCG36 gene, created using CRISPR-Cas9 genomic knockout system.
Firstly, two target sequences of selection are respectively CGCTCGGCATTCTGCCCAAC and GACCTACAACGGGCACGGCA, structure
Having built tool, there are two the pCRISPR-OsABCG36 plasmids of OsABCG36 specificity target spot.Then, soil Agrobacterium bacterial strain is utilized
The method of wild type OryzasativaLcv.Nipponbare rice is infected to construct mutant plants.Finally, designing corresponding primer pair design object target spot position
Set and PCR screening carried out to homozygous mutation body plant using PCR method, and after sequence verification, selected two it is independent pure
It closes mutant plants (osabcg36-1 and osabcg36-2) and carries out following experiments, as a result as shown in Figure 2 B.
The extraction of 4.RNA and gene expression dose analysis
In order to study OsABCG36 expression pattern, wild rice seedling (15d) is taken to handle 6h using 10 μM of Cd, and same
When with being control experiment group without the sample that Cd is handled, 4 repetitions of every group of experiment.Root and stem are sampled respectively, after sampling
It is put into liquid nitrogen at once, is put into spare in -80 DEG C of refrigerators until extracting RNA.Use Trizol Reagent Kit (Life
Technologies total serum IgE) is extracted.And Hiscript II Q RT SuperMix Kit (Vazyme) is used, for cDNA the
The synthesis of one chain.And use ChanQTM SYBR Color qPCR Master Mix (Vazyme) and StepOnePlus
Real-Time PCR system (Analytik jena) carries out qRT-PCR analysis.Primer used in OsABCG36 gene expression is
The 5 '-GGTCTCATTGGAGGCAGAG-3 ' of-ATTCTAGCAAGAGAGCAAGTG 3 ' and 5 '；And using histone H 3 is as interior
Reference object, PCR sequence are 5 '-GGTCAACTTGTTGATTCCCCTCT-3 ' and 5 '-AACCGCAAAATCCAAAGAACG-3 ', knot
Fruit is as shown in Figure 3.
From the figure 3, it may be seen that OsABCG36 gene of the invention is mainly expressed in the root of rice, and by the induction of Cd it
Afterwards, expression conspicuousness increases.
In order to study OsABCG36 expression to the response condition of Cd, firstly, taking wild rice seedling (5d) respectively
Main root sample extraction RNA is taken after handling 3h with 0,5,10,15,20 μM of Cd；Secondly, being located respectively to rice seedling using 10 μM of Cd
Reason 0,1,3,6,12, takes main root sample afterwards for 24 hours and extracts RNA, does RT-PCR analysis, each experiment 4 using above-mentioned same procedure
A repetition, as a result as shown in Figure 4.
By Fig. 4 A it is found that the expression of OsABCG36 gene is induced by Cd height, with the increase of Cd concentration, water is expressed
It is flat successively to increase.By Fig. 4 B it is found that in preceding 3h, as time increases, expression is successively increased, and subsequent expression starts
Successively decrease.
The Subcellular Localization of 5.OsABCG36
In order to construct GFP-OsABCG36 fusion expression vector, special primer (the 5 '-AAGCTTCGA of OsABCG36 are used
TGGACGCGGCGGGGGAGATCCAGAA-3 ' and 5 '-GGATCCTCATCTCTTCTGGAAGTTGAACTT-3 '), expanded using PCR
Increase the full length sequence of OsABCG36 out.Then, the DNA fragmentation of amplification is cloned into the code area GFP on pYL322-GFP carrier
Below, GFP-OsABCG36 recombinant plasmid is generated.
Plasmid GFP-OsABCG36 or GFP empty carrier are utilized with cell membrane marker plasmid mCherry-OsRac3 respectively
The method cotransformation of PEG mediated transformation is in rice leaf protoplast, total using laser after being incubated at room temperature 12-15h
Confocal scanning microscopy (TCS SP8；Leica it) takes pictures, as a result as shown in Figure 5.
As shown in Fig. 5 A-D, GFP empty carrier (green fluorescence) is positioned at the positions such as cytoplasmic cell core, and cell membrane marker
MCherry-OsRac3 (red fluorescence) is only positioned on cell membrane.However, as shown in Fig. 5 E-H, GFP-OsABCG36 with
MCherry-OsRac3 common location analysis finds that green fluorescence and red fluorescence can merge, and illustrates that OsABCG36 is positioned at carefully
On after birth.
6. yeast analysis is tested
In order to construct pYES2-OsABCG36 recombinant vector, primer 5'- is used first from rice cDNAAAGCTTAAAA
TGGACGCGGCGGGGGAGATCCA-3' and 5'-GGATCCTCATCTCTTCTGGAAGTTGAACT-3' passes through PCR amplification
Method has obtained the overall length ORF segment of OsABCG36.Then, amplified fragments are connected on pYES2 carrier (Invitrogen),
Obtain pYES2-OsABCG36 recombinant plasmid.
In order to verify the transhipment relationship of the OsABCG36 and Cd in yeast, yeast strain used in the present invention is ycf1
(MATa lpha,trp1,3,u2,ura3；Δycf:TRY1).Firstly, pYES2-OsABCG36 and empty carrier pYES2 is converted
Into ycf1 bacterial strain.Then, the conversion bacterial strain being incubated overnight is taken to adjust consistent OD600Afterwards, respectively contact plate in containing 0,5,10,
15μM CdSO4In solid SD-ura (2% galactolipin).It is photographed to record after 30 DEG C of culture 3d, as a result as shown in Figure 6A.
By Fig. 6 A it is found that on the SD-ura culture medium of not Cd, the life of saccharomycete and empty carrier containing OsABCG36
Long situation is similar.However, on the culture medium containing Cd, the saccharomycete containing OsABCG36 than the saccharomycete containing empty carrier with
The increase of Cd concentration grow more preferably, show the feature of resistance to Cd.
PYES2's and pYES2-OsABCG36 will be contained to the transhipment situation of Cd in order to study the OsABCG36 in yeast
Bacterial strain was incubated overnight to exponential phase, and OD is taken600(2% galactolipin) is resuspended in SD-ura culture medium for 4.0 thallus
(pH 4.5).After cultivating 4h, by the OD of each bacterial strain6004.0 are adjusted to, and final concentration of 20 μM of CdSO is added4Solution.It shakes
After bed culture 4 hours, cell is collected, is rinsed using deionized water primary.By OD600(4.0) identical cell is resuspended in fresh
In SD-ura culture medium (2% galactolipin), 4h is cultivated under the conditions of 30 DEG C, every 2h collects a thallus, and thallus uses 2N HCl
After digestion, ICP-MS (Plasma Quant MS is used；Analytik Jena AG) measurement Cd content.3 weights of every group of experiment
It is multiple, as a result as shown in Figure 6B.
By Fig. 6 B it is found that Cd content and containing empty carrier after Cd solution 4h is added, in the yeast strain containing OsABCG36
Cd content compares no significant difference in yeast strain.In subsequent 4h, as time increases, the yeast containing OsABCG36
Bacterial strain Cd content is substantially reduced compared to the bacterial strain containing empty carrier, shows that the yeast strain containing OsABCG36 releases more
The Cd of content, so that more resistance to Cd is shown, it is as a result consistent with Fig. 6 A.
The phenotypic analysis of 7.OsABCG36 mutant plants
In order to study mutant plants to the tolerance of Cd, by the wild type and two OsABCG36 mutant plants after germination
Strain seed pendulum in contain 0.5mM CaCl2In aqueous solution, it is transferred to after root long to 5mm containing 2 μM of Cd and 0.5mM CaCl2
In solution (pH 4.5), and the seedling of the same solution culture of Cd is not added as a control group.Phenotype is observed after 5d and records root
Long and stem length, as a result summarizes and sees Fig. 7.
It is consistent with mutant plants growing way in the wild type that do not cultivate plus in the solution of Cd as shown in Fig. 7 A, to its root long
Discovery is measured with stem length, it is almost the same (Fig. 7 C)；However, the seedling cultivated in the solution containing Cd, the root of mutant strain
The long root long compared to wild type obviously shortens, and shows sensitive phenotype (Fig. 7 B), measures discovery to its root long, and two
The root production of mutant plants obviously shortens compared to wild type, and stem length and wild type no significant difference (Fig. 7 D).
The aforementioned description to specific exemplary embodiment of the invention is in order to illustrate and illustration purpose.These descriptions
It is not wishing to limit the invention to disclosed precise forms, and it will be apparent that according to the above instruction, can much be changed
And variation.The purpose of selecting and describing the exemplary embodiment is that explaining specific principle of the invention and its actually answering
With so that those skilled in the art can be realized and utilize a variety of different exemplary implementation schemes of the invention and
Various chooses and changes.The scope of the present invention is intended to be limited by claims and its equivalents.
Sequence table
<110>Guangxi University
<120>a kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium
<130> 2019
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4374
<212> DNA
<213> OsABCG36
<400> 1
atggacgcgg cgggggagat ccagaaggtg gcgagcatgc ggctaggggg gagcatgagg 60
ggggacagcg ggtcgatgtg gaggagaggg gacgacgtgt tctcgaggtc gtcgagggag 120
gaggacgacg aggaggcgct gcggtgggcg gcgctcgaga agctgcccac ctacgaccgc 180
gtgcgccgcg ccatcctgcc gctcggtggc gacgacggcg ccggggacgg aggagggaag 240
ggcgtcgtgg acgtgcacgg gctcggcccg cgcgagcgcc gcgcgctcct cgagcgcctc 300
gtgcgcgtcg ccgacgagga caacgagaag ttcctcctca agctcaagga ccgcgtcgac 360
cgggtgggga tcgacatgcc gacgatcgag gtgcggttcg agcacctgga ggcggaggcg 420
gaggtccgcg tcggcaacag cggcctcccc accgtcctca actccatcac caacaccctc 480
gaggaagccg gcaacgcgct cggcattctg cccaaccgga agcagaccat gcccgtcctc 540
cacgacgtca gcggcatcat caagccccgc aggatgactc tgctgttagg cccaccgggg 600
tcaggcaaga ccaccttgct gctcgcgttg gccggaaggc tcggcaaaga tctcaaggct 660
tcaggaaaag tgacctacaa cgggcacggc atggaggaat tcgtgccgga gaggacggcg 720
gcttacatca gccagcacga cctccacatc ggagagatga ccgtcaggga gacacttgcc 780
ttctcggcac gatgccaggg tgttggcagt cgctttgata tgttgactga gctgtcaagg 840
cgagagaagg cagcgaacat taagcctgac gccgatatcg atgcattcat gaaggcggct 900
gcaatgggag gacaggaggc aaacgtgaac actgactata tactgaagat attaggacta 960
gagatatgcg ctgacacgat ggttggggac gagatgctga ggggcatctc aggtgggcaa 1020
agaaagcgtg ttacgactgg tgagatgctg gttgggccag ccagggcgct cttcatggac 1080
gagatctcaa ctgggcttga cagctccact acattccaga tagtgaattc gcttaggcaa 1140
actgtccaca tcctcggtgg cacagctgtt atctccctgc tgcagccggc gcctgagact 1200
tacaacttgt ttgatgatat catcctcctc tcagacggtc agattgtgta ccagggcccc 1260
cgagaggatg tgcttgaatt cttcgagtcc atggggttta agtgtcctga caggaagggt 1320
gttgccgact tcttgcaaga agtgacttct aagaaagatc aaaggcagta ctgggcgagg 1380
catgacaagc cctacaggtt tgtgacggtt aaggaatttg tgagtgcatt ccagtcgttc 1440
cacacaggga gagctatagc aaacgaactt gctgttccgt ttgataagag taagagccat 1500
cctgccgcac tggctaccac aaggtacggt gctcctggca aggagctgct gaaggcaaat 1560
attgacaggg agattctcct catgaagagg aactctttcg tctacatgtt cagaaccttc 1620
cagttgatgg tggtgtcact cattgcaatg acactcttct tccgtacgaa aatgaaacgt 1680
gattctgtga ccagcggggg catctacatg ggcgcactct tctttggtgt gcttatgatc 1740
atgttcaatg gtttctcaga gcttgcgctc actgtcttta agttgcctgt tttcttcaag 1800
cagagggatc tcctttttta tcctgcatgg tcgtacacta taccctcatg gattctcaag 1860
atcccaatca cgtttattga ggttggtggg tatgtgttct taacatacta cgtcattggg 1920
tttgactcaa acgtgggcag cttcttcaag cagtatttgc tcatgttagc aatcaatcag 1980
atggcgggat cacttttccg attcattggt ggggcagcga ggaacatgat tgttgcaaat 2040
gtctttgcat cattcatgct gctaattttt atggtattgg gtggattcat tctagcaaga 2100
gagcaagtga agaaatggtg gatttggggc tactggatat ccccgatgat gtacgcccag 2160
aatgccatct cagttaatga actcatgggg cacagctgga acaaaattgt gaatagctct 2220
gcctccaatg agacccttgg tgtgcaagtc ctcaagtccc gtggagtatt ccctgaagcc 2280
aggtggtatt ggattgggtt tggtgcaatg atcggcttca ccatcctttt caatgctctc 2340
ttcacccttg cccttacata cctcaggcca tatggaaatt cccgtcagtc agtatcagaa 2400
gaggaactga aagagaagcg tgccaatctg aatggtgaga ttgtgggtga cgttcacttg 2460
tcatctggaa gtacgcgtag gccaatggga aacggcactg aaaatgattc aacaattgtt 2520
gatgatgata ctgaggttac tcaaaggggg atggttctcc catttactcc gctttcactc 2580
agctttgaca atgtcagata ttctgttgac atgccacagg aaatgaaagc acaaggtgta 2640
gctgatgacc ggttggagct cctcaaaggt gttagtggtt cattcaggcc aggggtgttg 2700
actgcactaa tgggtgtcag tggtgctggc aagacaacac tgatggatgt attggctggg 2760
agaaagacag gtgggtacat tgaaggaagc atcaacattt caggatatcc aaagaaacaa 2820
gagacttttg cacgtgtgtc tggatactgt gagcagaacg atatccactc accgcaggtc 2880
acagtctatg agtcgctact tttctcagca tggctccgtc ttcctgagga tgtagattcc 2940
aacactagaa agatgttcat tgaggaggtg atggagcttg tggagctcaa gtcactgaga 3000
gatgctttgg ttgggcttcc tggagtgaat ggtctgtcca ctgaacaaag aaagaggcta 3060
acaatcgcag tggagcttgt tgcaaaccct tcgattatat tcatggacga gccaacctca 3120
gggcttgatg cacgagcagc tgcaattgtg atgaggacag tgaggaacac tgttaatact 3180
ggcagaactg tggtgtgcac aattcatcag cctagcattg acatatttga agcatttgat 3240
gagcttttcc tgatgaagcg aggtggtgaa gagatctatg ctggtccact aggccatcat 3300
tcttcggagc tgatcaagta ttttgagagt atcccagggg tcagcaaaat caaagatggc 3360
tataacccag caacatggat gttggaggtg acaacaattg gtcaagagca ggcacttggt 3420
gttgatttta gtgatatata caagaagtct gaactttacc agaggaacaa ggccttgata 3480
aaggacctga gccaaccagc ccccgattca agtgacctgt atttccctac ccaatattct 3540
cagtcttctt taacacaatg catggcttgc ctgtggaagc aaaacctgtc atactggagg 3600
aaccctcctt acaatgccgt taggttcttt ttcactactg tcattgctct tctctttggt 3660
accatcttct gggaccttgg cggcaaagtg acgaagtcac aagacttgtt caatgccatg 3720
gggtcaatgt atgcagcagt gctgttcatc ggtgtcatga actgtacatc tgttcagcca 3780
gtggtggccg tggagcggac agtcttttac cgtgaaaggg ctgccggcat gtactcggcg 3840
tttccatatg catttggcca ggttgtcatt gagatcccat acacactggt tcaggctact 3900
gtatacggga tcatagtgta tgcgatgatt gggttcgagt ggacggctgc caagttcttc 3960
tggtacctct tcttcatggt cttcacgctc ctctacttca cattctacgg catgatggcg 4020
gtcggcctga caccgaacta ccacattgcc tcgatcgtct catcggcgtt ctacgccatc 4080
tggaatctct tctccggctt cgtcatcccc cgacctagag tcccaatctg gtggagatgg 4140
tattgctggg cgtgccccgt cgcgtggacg ctgtacggcc tcgtcgtctc ccagttcggt 4200
gacatcgaga cgccgatgga agacggcacc cctgtgaagg tgtttgtgga gaactacttc 4260
ggcttcaagc acagctggtt gggctgggtg gccaccgtgg tcgctgcctt cgctttcctc 4320
ttcgcttcct tgtttggctt cgctatcatg aagttcaact tccagaagag atga 4374
Claims (2)
1. a kind of rice Os ABCG36 gene, which is characterized in that the gene is rice abc transport Protein G family gene, described
The sequence of gene is as shown in SEQ ID NO.1.
2. effect of the rice Os ABCG36 gene according to claim 1 in transhipment heavy metal cadmium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910780353.0A CN110499317A (en) | 2019-08-22 | 2019-08-22 | A kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910780353.0A CN110499317A (en) | 2019-08-22 | 2019-08-22 | A kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110499317A true CN110499317A (en) | 2019-11-26 |
Family
ID=68589173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910780353.0A Pending CN110499317A (en) | 2019-08-22 | 2019-08-22 | A kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499317A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112143739A (en) * | 2020-09-30 | 2020-12-29 | 广西大学 | Rice OsABCC9 gene and application thereof in cadmium transfer |
| CN112301036A (en) * | 2020-10-16 | 2021-02-02 | 湖南杂交水稻研究中心 | Gene OsABCG38 for regulating and controlling rice cadmium accumulation and encoding protein and application thereof |
| CN112500460A (en) * | 2020-11-18 | 2021-03-16 | 中国水稻研究所 | Mutant gene OsABCC1 for regulating and controlling accumulation of cadmium and arsenic in rice and application thereof |
-
2019
- 2019-08-22 CN CN201910780353.0A patent/CN110499317A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112143739A (en) * | 2020-09-30 | 2020-12-29 | 广西大学 | Rice OsABCC9 gene and application thereof in cadmium transfer |
| CN112143739B (en) * | 2020-09-30 | 2022-08-09 | 广西大学 | Rice OsABCC9 gene and application thereof in cadmium transfer |
| CN112301036A (en) * | 2020-10-16 | 2021-02-02 | 湖南杂交水稻研究中心 | Gene OsABCG38 for regulating and controlling rice cadmium accumulation and encoding protein and application thereof |
| CN112301036B (en) * | 2020-10-16 | 2022-09-27 | 湖南杂交水稻研究中心 | Gene OsABCG38 for regulating and controlling rice cadmium accumulation and encoding protein and application thereof |
| CN112500460A (en) * | 2020-11-18 | 2021-03-16 | 中国水稻研究所 | Mutant gene OsABCC1 for regulating and controlling accumulation of cadmium and arsenic in rice and application thereof |
| CN112500460B (en) * | 2020-11-18 | 2021-08-17 | 中国水稻研究所 | Mutant gene OsABCC1 for regulating and controlling accumulation of cadmium and arsenic in rice and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110499317A (en) | A kind of rice Os ABCG36 gene and its effect in transhipment heavy metal cadmium | |
| CN109161550A (en) | A kind of the SlbHLH59 gene and application method of regulation tamato fruit ascorbic acid content | |
| CN108164588A (en) | Application of the cotton transport protein GhBASS5 genes in plant salt tolerance | |
| CN107022551B (en) | A kind of regulation arabidopsis seedling stage trophosome is big, early blossoming and the increased corn gene of grain weightZmGRAS37And its application | |
| CN107937416A (en) | Improve gene and its application of nitrogen fertilizer for paddy rice utilization ratio and yield | |
| CN107435047A (en) | In a kind of plant phosphorus signal network Tolerant to low P key gene GmPHR25 and its with application | |
| CN106591322A (en) | Gingko MADS-box transcription factor gene GbMADS9 for controlling blossoming of plants and encoding protein and application of Gingko MADS-box transcription factor gene GbMADS9 | |
| CN103289972A (en) | Rice long-grain related gene and application for same | |
| CN106047889A (en) | Application of soybean MYB transcription factor gene in improvement of soybean isoflavone biosynthesis | |
| CN108728454A (en) | A kind of potato StDWF1 genes and preparation method thereof and the gene is overexpressed to promote the method for potato Rapid Rooting | |
| CN104531718B (en) | Apple V-ATPase subunit genes MdVHA-B1S396A and its degeneration-resistant application | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN110343705A (en) | It is a kind of regulation tomato ascorbic acid accumulation NBS-LRR gene and its application | |
| CN113322261B (en) | Application of soybean ABC transporter gene GmALS3 in breeding of low-phosphorus-resistant and aluminum-toxicity-resistant plants | |
| CN102732528A (en) | Application of OXHS 4 gene in controlling drought resistance of paddy rice | |
| CN109055396A (en) | Application of the arabidopsis PPR1 gene in regulation plant Cadmium resistance performance | |
| CN109694876A (en) | Cultivate the method for low Cd accumulation rice and its purposes of associated materials | |
| CN108977445A (en) | Application of the arabidopsis microRNA400 in regulation cadmium-resistant vegetable | |
| US20070079394A1 (en) | Proteins imparting boron-tolerance and genes thereof | |
| CN100591767C (en) | Epiphyte pathogenic gene MNH6 born of rice blast bacterium and application thereof | |
| CN107400671A (en) | Pear fruit saccharide transporter gene PbTMT4 and its application | |
| CN104611345B (en) | A kind of gene for improveing fruit quality and its coded product and application | |
| CN104098664A (en) | Aapplication of arabidopis thaliana calmodulin combined protein gene ATIQM2 in flowering regulation | |
| CN109867715A (en) | A kind of chloroplast protein and ATPase enzymatic activity mutant are improving the application in stress resistance of plant | |
| CN106191001A (en) | The application in improving plant salt endurance of phospholipase PLD ζ 1 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191126 |