CN108728454A - A kind of potato StDWF1 genes and preparation method thereof and the gene is overexpressed to promote the method for potato Rapid Rooting - Google Patents

Abstract

The present invention provides a kind of potato StDWF1 genes and preparation method thereof and is overexpressed the gene to promote the method for potato Rapid Rooting, it is related to potato molecular biology field, by StDWF1 gene clonings, over-express vector structure, During Agrobacterium be transferred to and etc. realize by be overexpressed potato StDWF1 genes promote potato Rapid Rooting purpose, at least shift to an earlier date 10 days to take root, is conducive to enhance potato plant growth growing way.

Description

A kind of potato StDWF1 genes and preparation method thereof and the gene is overexpressed to promote Into the method for potato Rapid Rooting

Technical field

The present invention relates to potato molecular biology fields, and in particular to a kind of potato StDWF1 genes and its preparation side Method and the gene is overexpressed to promote the method for potato Rapid Rooting.

Background technology

Potato is the fourth-largest staple food grain in China, has the features such as yield is high, full of nutrition, edible is processed, pacifies to grain All risk insurance barrier is of great significance；But every year due to storage of potato is improper caused by suffer heavy losses, have to Potato Industry huge Big impact.

Potato is in edible upper men and women, old and young's all edibles, and the market demand is big, therefore raising potato yield is necessary, But during potato growth, fruit is just only will produce growing into certain length when its root system, the life of potato at present Long period is 80-120 days, and growth cycle cannot meet the market demand, to shorten potato raw long period, improves rooting rate, It is effective means to reduce rootage duration.

Invention content

The present invention provides a kind of potato StDWF1 genes, when by the dormancy time of gene alteration potato and taking root Between, it is allowed to balance the contradiction of storage of potato and growth.

In order to solve the above technical problems, the technical solution adopted by the present invention is as follows：

A kind of potato StDWF1 genes, base sequence such as SEQ ID NO:Shown in 1.

A kind of preparation method of potato StDWF1 genes, includes the following steps：

(1) total serum IgE is extracted from Potato Cultivars Favorita test tube seedling；

(2) cDNA is synthesized according to the total serum IgE reverse transcription of extraction；

(3) PCR amplification introduces XbaI and SmaI restriction enzyme sites using cDNA as template before the areas CDS of cDNA, and design expands Increase primer StDWF1PF and StDWF1PR, and adds primer StDWF1PF, primer StDWF1PR, 10 × amplification buffer, sterile Water, dNTPs, Taq archaeal dna polymerase mixing simultaneously carry out PCR amplification, wherein cDNA, primer StDWF1PF, primer StDWF1PR, 10 × amplification buffer, sterile water, dNTPs, Taq archaeal dna polymerase volume be respectively：1μL,1μL,1μL,2μL,15.3μL, 0.5 μ L, 0.2 μ L, and cDNA, primer StDWF1PF, primer StDWF1PR and dNTPs concentration be respectively 10~100ng/ L,2μM/μl,2μM/μl,10mmol/L；

Amplimer StDWF1 PF, StDWF1 PR base sequence respectively such as SEQ ID NO:2,SEQ ID NO:3 institutes Show；

(4) recovery purifying pcr amplification product obtains potato StDWF1 genes through sequencing analysis.

Preferably, in step (1), the opportunity of extraction Favorita test tube seedling total serum IgE is blade seeding stage, extraction unit Position is the tender leaf of Favorita test tube seedling.

Preferably, the extracting method of total serum IgE uses Trizol methods in step (1), is as follows：

(1a) is ground：Mortar is put into 4 spoonfuls of liquid nitrogen and Potato Cultivars Favorita specimen locations, and liquid nitrogen is rapid after being evaporated completely Fine powder is worn into, is quickly charged with after EP pipes plus 1mL Trizol, violent mixing, room temperature puts 5-10min；

(1b) 4 DEG C of 12000rpm centrifuge 5min, draw in supernatant to new pipe, and 200ml chloroforms are added, slight to shake up and down It shakes, is stored at room temperature 5min；

(1c) 4 DEG C of 12000rpm centrifuge 10min, and Aspirate supernatant is added isometric phenol/chloroform/isoamyl alcohol to new pipe, runs Mixing；

(1d) 4 DEG C of 12000rpm centrifuge 20min, and for Aspirate supernatant to new pipe, being gradually added into absolute ethyl alcohol makes its final concentration It is 12%, Quick spin after the mixing that turns upside down；

(1e) 4 DEG C of 12000rpm centrifuge 10min, draw 400mL supernatants to new pipe, are added on 0.7 times of volume isopropanol Reverse mixing down, and 0.2 times of volume 1mol/L NaAc-20 DEG C is added and precipitates 1h；

(1f) 4 DEG C of 12000rpm centrifuge 15min, abandon supernatant, and 75% ethyl alcohol of 1mL is added and washes precipitation, 4 DEG C, 8500rpm from Heart 3min, then 75% ethyl alcohol of 1mL is added to wash 2 times；

(1g) outwells supernatant, sops up surplus liquid as possible, and super-clean bench up-draught 10min removes residual ethanol, and 80mL is added DEPC handles water, is immediately placed in 55 DEG C of water-bath 5min, and -80 DEG C of 60min are repeated 2 times；

(1h) 4 DEG C of 12000rpm centrifuge 20min, careful to draw 70 μ L of supernatant, pay attention to not contacting bottom to get to total serum IgE, It is frozen in -80 DEG C spare；

Wherein, step (1c)-(1h) is operated on ice.

Preferably, total serum IgE reverse transcription synthesizes cDNA in step (2), by the cDNA synthetic agent box of TakaRa companies Operation instruction carries out reverse transcription, and overall reaction system volume is 20 μ l, and using RNase free centrifuge tubes, reaction system is as follows：

65 DEG C are denaturalized 5 minutes, at least 1 minute cooling on ice rapidly, slightly centrifuge, are then added：

It is uniformly mixed, 55 DEG C of reactions 60min, 70 DEG C of 15min make enzyme inactivate, -20 DEG C of preservations.

Preferably, the reaction condition of PCR amplification is in step (3)：

(3a) carries out pre-degeneration reaction under the conditions of 95 DEG C, when a length of 3min；

(3b) carries out reaction of degeneration (RD) under the conditions of 95 DEG C, when a length of 30s；

(3c) anneals 30s under the conditions of 54-58 DEG C；

(3d) extends 1-1.5min under the conditions of 72 DEG C；

(3e) circulation step (3b)~(3d) 35 times；

(3f) extends 10min under the conditions of 72 DEG C；

(3g) keeps the temperature pending under the conditions of 4 DEG C.

Preferably, the method for recovery purifying pcr amplification product specifically comprises the following steps in step (4)：

(4a) column equilibration step：600 μ l equilibrium liquids are added into adsorption column, 10000rpm centrifuges 1min, outwells collecting pipe Balance waste liquid and be returned to collecting pipe again；

Pcr amplification product is placed in the Ago-Gel of 0.01g/ml by (4b), and Ago-Gel is transferred to centrifuge tube In, 100 μ l liquor kalii aceticis, 50 DEG C of water-bath 10min, and the centrifuge tube that turns upside down are added into centrifuge tube, fully dissolves gel；

(4c) imports dissolved gel in adsorption column, and 12000rpm centrifuges 1min, outwells collecting pipe waste liquid and will inhale Attached column is put into collecting pipe again；

(4d) 600 μ l solution D NA wash buffer, 12000rpm centrifugation 1min are added into adsorption column, outwell collection Adsorption column is simultaneously put into collecting pipe by pipe waste liquid again；

Adsorption column is put into collecting pipe by (4e), and 12000rpm centrifuges 2min, and stands 10min；

Adsorption column is put into a clean centrifuge tube by (4f), and it is slow that suitable elution is vacantly added dropwise to adsorbed film centre position Fliud flushing is placed at room temperature for 2min, and 12000rpm centrifuges 2min, collects DNA solution；

The solution that centrifugation obtains is re-poured into adsorption column by (4g), and room temperature puts 1min, and 12000rpm centrifuges 2min to improve The rate of recovery to get the potato StDWF1 gene outcomes to potato StDWF1 gene outcomes, obtained be stored in -20 DEG C it is spare.

A method of potato StDWF1 genes are overexpressed to promote potato Rapid Rooting, are included the following steps：

(1) over-express vector is built

A. cloning vector is connected：Potato StDWF1 genes are connect with pMD19-T cloning vectors, first by potato StDWF1 genes heat 5min at 65 DEG C, and following reaction system is then added：

After mixing centrifugation, 4 DEG C of connection 18h, then in -20 DEG C of preservations；

Wherein, solution I is isometric mixed solution of 50mM glucose, 25mM Tris-HCL, 10mM EDTA, and pH value is 8.0；

B. recombinant plasmid dna converts：By 5 μ l cloning vectors connection products and 100 μ l bacillus coli DH 5s on superclean bench α competent cells are uniformly mixed, ice bath 30min；42 DEG C of water-bath heat shock 90s, then ice bath 5min；800 μ l fluid nutrient mediums are added, 37 DEG C, 220rpm shaken cultivations 40min；On the LB solid mediums of Amp antibiotic have been added, the content of Amp antibiotic is 100 μ g/ml uniformly apply the IPTG mixed liquors of the X-gal and 4 a concentration of 200mg/ml of μ l that spread 40 a concentration of 20mg/ml of μ l；Bacterium After body renewal cultivation, room temperature 3000rpm, 2min centrifuge bacterium solution, take out 800 μ l supernatants with pipettor, remaining 100 μ l are resuspended； On superclean bench, bacterium solution is uniformly coated in tablet, 30min-60min is placed and is inverted then at 37 DEG C after fully absorbing 16-18h is cultivated, single bacterium colony identification is chosen after growing；Single bacterium colony to be identified is added in the ddH2O of 20 μ l, is uniformly mixed, made For the template of bacterium solution PCR identification reaction systems, PCR product is into row agarose gel electrophoresis；The bacterium that picking gel electrophoresis is positive It drops down onto in the liquid LB solid mediums containing Amp antibiotic, 37 DEG C of shaken cultivation 8h, extracts plasmid, after plasmid PCR detection, And the positive colony for obtaining detection carries out plasmid PCR identification, and positive plasmid is accredited as through PCR, is contained through sequencing analysis The pMD19-T carriers of target fragment；

C. restriction enzyme BamH1 and SmaI is used to distinguish pMD19-T carrier and overexpression of the double digestion containing target fragment The pBI121 carriers that digestion obtains are recycled with target fragment and are connected with T4-DNA ligases, endonuclease reaction by carrier pBI121 It is carried out at 37 DEG C, connection reacts on 4 DEG C overnight；Connection product pBI121-StDWF1 is converted into competent escherichia coli cell again, Picking single bacterium colony expands numerous, extraction plasmid, is transformed into the competent cell of Agrobacterium tumefaciems after PCR, digestion and sequencing identification；

(2) plasmid containing target gene is transferred to Agrobacterium

A. it is big mould containing 50 μ g/ml rifampins, 15 μ g/ml celebratings to be inoculated in 5ml for the single bacterium colony of picking Agrobacterium tumefaciems GV3101 In the YEB fluid nutrient mediums of element, in 28 DEG C, 200 revs/min of overnight shaking cultures；

B. absorption is incubated overnight bacterium solution 2ml and is added in YEB fluid nutrient mediums of the 50ml containing identical antibiotic, 28 DEG C of oscillations It is 0.5 to cultivate to OD600, bacterium solution ice bath 30 minutes；

C.4 DEG C, 2500g centrifuges 5 minutes collection bacterium；

D. plus 10ml 0.15M NaCl suspension agrobatcerium cells, 2500g are centrifuged 5 minutes；

E. the 20mmol/L CaCl of 1ml precoolings are added₂Suspension cell, this step operate on ice, obtained Agrobacterium sense By state cell, and used in 24 hours；

F. it takes 100ml Agrobacteriums competent cell and melts on ice, the pMD19-T containing target fragment that 1mg is added is carried Body stands 30 minutes after mixing on ice, the quick-frozen 1min in liquid nitrogen, 37 DEG C of water-bath 5min, and it is not antibiotic that 1ml is then added YEB culture mediums, 28 DEG C of shaken cultivation 4 hours at a slow speed；5000rpm centrifuges 30 seconds collection bacterium, abandons supernatant, and 0.1ml is added and is free of antibiosis The YEB culture mediums suspension cell again of element, is coated on containing 50 μ g/ml rifampins, 15 μ g/ml gentamicins and 50mg/ml On the YEB tablets of Kana antibiotic, 28 DEG C are cultivated about 48 hours；The single bacterium colony grown on picking tablet, is inoculated in containing 50mg/ Ml Kana antibiotic and corresponding in the YEB liquid mediums of the antibiotic of agrobacterium strains, 28 DEG C of shaken cultivations are stayed overnight；It carries Part Plasmid DNA is taken, carries out PCR amplification identification by template of Plasmid DNA, identification, which is positive, to be obtained being transferred to containing target gene Plasmid Agro-Bacterium；

(3) During Agrobacterium test tube seedling potato stem section

A. test tube seedling stem section preculture, on superclean bench, numerous test tube seedling stem section is expanded in shearing, and by the stem after shearing Section, which is lain in, carries out preculture on solid medium, 20 DEG C or so dark culturing 2-3d；

B. Agrobacterium activates, and takes and is transferred to the plasmid Agro-Bacterium bacterium solution streak inoculation containing target gene in solid containing 50mg/L In the YEB culture mediums of Kan and 50mg/L Rif, 27 DEG C of culture 48h, envelope ware is in 4 DEG C of preservations；4mL is added in 10mL centrifuge tubes YEB culture mediums choose single bacterium colony, and 220rpm, 27 DEG C are shaken bacterium 16h, be stored in 4 DEG C it is spare；With 1：100 connect bacterium fills in 10mL centrifuge tubes Fresh liquid YEB culture mediums in, 220rpm, 27 DEG C are shaken bacterium 12h, be stored in 4 DEG C it is spare；

C. During Agrobacterium co-cultures and screening takes the bacterium shaken by stem section income aseptic bottle on superclean bench Liquid, 6000rpm centrifuge 5min, remove supernatant, and MS fluid nutrient mediums are added and are resuspended；By the good stem section of preculture from solid medium It is transferred to small beaker；The bacterium after being resuspended is poured into small beaker, liquid infects 2-3min；Bacterium solution is outwelled, sterile water wash stem section is poured into, It is transferred on aseptic filter paper after being repeated twice and sucks excessive moisture, stem section is then transferred to the symbiosis for being lined with two layers of aseptic filter paper In culture medium, 24 DEG C of dark culturing 36h；Stem section is put into the sterile water of the Cef containing 100mg/L and is cleaned 3~4 times, it is extra to sop up Screening and culturing medium is transferred to after moisture, 16h light/8h is dark, light intensity 60 μm of ol/m2.s1,22 ± 1 DEG C；

D. callus tissue culture changes 1 subculture every 10-14d, removes lethal, pollution because of Agrobacteriuna overgrowth With complete albefaction plant to get to be overexpressed potato StDWF1 genes potato plant.

Preferably, step (1) structure over-express vector during, extract plasmid the step of be：

I. it draws in 3ml bacterium solutions to 5ml centrifuge tubes, 5000rpm is centrifuged 30 seconds, collects bacterium；

II. plus 200ml solution Is, suspension thalline is acutely vibrated with oscillator, wherein solution I is 50mM glucose, 25mM Isometric mixed solution of Tris-HCL, 10mM EDTA, pH value 8.0；

III. plus the solution IIs that have configured of 300ml, mixing is overturned, wherein solution II is 0.2nM NaOH, 1% mass fraction SDS isometric mixed solution；

IV. the solution III of 300ml precoolings, ice bath 5~10 minutes, wherein solution after mixing is added after solution clarification immediately III be 3mM potassium acetates, 2mM acetic acid, 75% mass fraction the isometric mixed solution of alcohol (；

V.4 DEG C, 5000rpm is centrifuged 15 minutes；

VI. supernatant is taken, isometric chloroform/isoamyl alcohol is added, after overturning mixing, 5000rpm centrifuges 5 minutes precipitation eggs In vain；

VII. supernatant is drawn, 0.7 times of volume isopropanol, mixing are added；5000rpm is centrifuged 10 minutes, and supernatant is abandoned in suction, then is used 70% ethyl alcohol washing precipitation, 8000rpm, 5min abandon supernatant；Drying at room temperature is dissolved in appropriate ddH2O2 to get to extraction after ten minutes Target plasmid, 4 DEG C save backup.

Preferably, during step (1) structure over-express vector, plasmid PCR detection first expands to be detected again, and step is such as Under：

20 μ l plasmids to be checked are added in reaction system, ice bath environment sequentially adds following components：

Mixing, slightly centrifugation are sunk to the bottom, and carry out cyclic amplification reaction, and the condition of cyclic amplification reaction is specially：

(3a) carries out pre-degeneration reaction under the conditions of 95 DEG C, when a length of 3min；

(3b) carries out reaction of degeneration (RD) under the conditions of 95 DEG C, when a length of 30s；

(3c) anneals 30s under the conditions of 54-58 DEG C；

(3d) extends 1-1.5min under the conditions of 72 DEG C；

(3e) circulation step (3b)~(3d) 35 times；

(3f) extends 10min under the conditions of 72 DEG C；

(3g) is kept the temperature under the conditions of 4 DEG C；

Pcr amplification product is analyzed through 1.0% agarose gel electrophoresis, obtains analysis result.

Compared to the prior art, the beneficial effects of the invention are as follows：

Present invention finds the potato StDWF1 genes that influence potato dormancy time and late growth are taken root, clones Potato StDWF1 coding sequences build gene overexpression plant, establish the basis of StDWF1 gene functional research；It is logical Overexpression DWF1 gene plants are crossed, the mechanism that analysis StDWF1 is sprouted in potato tubers for potato tubers storage, is sprouted and divided Sub- mechanism study lays the foundation, Reasonable Regulation And Control stem tuber storage and sprouting；Construct a kind of type of rearing of New Potato Varieties.

Description of the drawings

Fig. 1 is the agarose gel electrophoresis detection figure of potato Total RNAs extraction；

Fig. 2 is PCR amplification result agarose gel electrophoresis detection figure；

Fig. 3 is target gene plasmid amplification agarose gel electrophoresis detection figure；

Fig. 4 is pBI121-StDWF1 recombinant plasmid Bam H1/Sam double digestion agarose gel electrophoresis detection figures；

Fig. 5 is state diagram of the potato test tube seedling stem section after During Agrobacterium and co-cultivation；

Fig. 6 is state diagram of the potato test tube seedling stem section through During Agrobacterium and after co-culturing 2 days；

Fig. 7 is state diagram of the potato test tube seedling stem section through During Agrobacterium and after co-culturing 45 days；

Fig. 8 is potato test tube seedling stem section after During Agrobacterium and co-cultivation, is transferred in root media and is given birth to The growth figure of root screening；

Fig. 9 is that potato test tube seedling strain expands numerous growth figure；

Figure 10 is the PCR testing result figures of pBI121-StDWF1 transgenic lines npt II；

Figure 11 is that WT lines are overexpressed root length comparison diagram of the transfer-gen plant at 40 days with StDWF1；

Figure 12 is the leaf size comparison diagram that WT lines are overexpressed transfer-gen plant with StDWF1；

Figure 13 is the situation comparison diagram of taking root at 20-30 days that WT lines are overexpressed transfer-gen plant with StDWF1；

Figure 14 is the plant height comparison diagram that WT lines are overexpressed transfer-gen plant with StDWF1；

Figure 15 is the agarose gel electrophoresis detection figure of blade Total RNAs extraction；

Figure 16 is different tissues position StDWF1 gene expression analysis figures；

Figure 17 is StDWF1 genes in blade different times expression analysis figure.

Specific implementation mode

All features disclosed in this specification can be with any other than mutually exclusive feature and/or step Mode combines.

It elaborates below in conjunction with the accompanying drawings to the present invention.

Embodiment 1

Potato StDWF1 genes, base sequence such as SEQ ID NO:Shown in 1.

StDWF1 gene clonings and the method for being overexpressed the gene, it is specific as follows：

Material to be tested：Potato Cultivars Favorita (FW) test tube seedling, by Sichuan Agricultural University's potato research and development The heart provides.

Plasmid：PMDTM19-T Simple Vector are purchased from TaKaRa companies；PBI121 over-express vectors

Bacterial strain：Bacillus coli DH 5 alpha；Agrobacterium GV3101

Reagent：DEPC (pyrocarbonic acid diethyl ester), Trizol be purchased from Invitrogen companies, water-saturated phenol, H2O2, chloroform, Isoamyl alcohol, isopropanol, ethyl alcohol, sodium acetate etc. are purchased from Chengdu Ke Long chemical reagents factory.Reverse transcription reagent box RevertAid First Strand cDNA Synthesis are purchased from Thermo；It is public purchased from Tiangeng that DNA gel purifies QIAquick Gel Extraction Kit, 50 × TAE buffer solutions Department；High-fidelity Pfu enzymes, restriction enzyme, DNA Ligation Kit 2.0 are purchased from TaKaRa companies.

Common agents are prepared：

1. Total RNAs extraction reagent

0.1%DEPC：It is added 0.5mL DEPC in 500mL ddH2O2,37 DEG C, room temperature preservation can be placed in after 150rpm, 6h It is spare.

DEPC water：The DEPC of 0.1ml is dissolved in 100ml water, is shaken overnight, 120 DEG C of sterilizing 20min.

75% ethyl alcohol (V/V)：The ethyl alcohol of 25ml is added in the DEPC water of 75ml (now with the current)

2. agarose gel electrophoresis reagent

1 × TAE buffer solutions：It takes 50 × TAE of 20ml in 1L graduated cylinders, and ddH2O is added and is settled to 1L.

3. bacteria culture media

Escherichia coli LB culture mediums (1L)：Tryptose 10g, yeast powder 5.0g, NaCl10.0g add water 1L, Tris tune pH extremely 7.0,15g agar powders, 121 DEG C of sterilizing 20min are added if solid.

Agrobacterium YEB culture mediums (1L)：Tryptose 5.0g, sucrose 5.0g, MgSO4.7H2O, yeast powder 10g, beef extract 5.0g adds water 1L, Tris tune pH7.0, and 15g agar powders, 121 DEG C of sterilizing 20min are added if solid.

Key instrument equipment：

PCR instrument (Bio-Rad), micropipettor (Eppendorf), temperature control shaking table (Thermo), electro-heating standing-temperature cultivator, Electrophoresis apparatus and Horizontal electrophoresis tank (Bio-Rad), high speed freezing centrifuge (Thermo), gel imaging system (Bio-Rad).

One, StDWF1 gene clonings

(1) Total RNAs extractions

The mortar used in RNA, EP pipes, pipette tips, ddH2O water, 1mol/L NaAc is extracted to handle for 24 hours through 0.1%DEPC, 121 DEG C of 20min degradation DEPC, mortar, EP pipes and pipette tips etc. are dried at 80 DEG C.DEPC processing water is used for preparing 75% ethyl alcohol.

RNA extractions use Trizol methods, are as follows：

1. grinding：Mortar is put into 4 spoonfuls of liquid nitrogen and samples taken potato wedge, and liquid nitrogen wears into rapidly fine powder after being evaporated completely, rapid to fill 1mL Trizol, violent mixing, room temperature is added to put 5-10min after entering EP pipes.

2. 4 DEG C of 12000rpm centrifuge 5min, draw in supernatant to new pipe, and 200ml chloroforms are added, it is slight to rock up and down, It is stored at room temperature 5min.

It operates on ice below：

3. 4 DEG C of 12000rpm centrifuge 10min, Aspirate supernatant is added isometric phenol/chloroform/isoamyl alcohol to new pipe, overturns Mixing.

4. 4 DEG C of 12000rpm centrifuge 20min, for Aspirate supernatant to new pipe, being gradually added into absolute ethyl alcohol keeps its final concentration of 12%, Quick spin after the mixing that turns upside down.

5. 4 DEG C of 12000rpm centrifuge 10min, 450mL is drawn to new pipe, 0.7 times of volume isopropanol of addition turns upside down mixed It is even, and 0.2 times of volume 1mol/L NaAc-20 DEG C is added and precipitates 1h.

6. 4 DEG C of 12000rpm centrifuge 15min, supernatant is abandoned, 75% ethyl alcohol of 1mL is added and washes precipitation, 4 DEG C, 8500rpm centrifugations 3min, then 75% ethyl alcohol of 1mL is added to wash 2 times.

7. outwelling supernatant, surplus liquid is sopped up as possible, and super-clean bench up-draught 10min removes residual ethanol, and 80mL DEPC are added Water is handled, 55 DEG C of water-bath 5min are immediately placed in, -80 DEG C of 60min are repeated 2 times.

8. 4 DEG C of 12000rpm centrifuge 20min, careful to draw 70 μ L of supernatant, pay attention to not contacting bottom, -80 DEG C freeze it is spare.

RNA purity and Concentration Testing

RNA integralities are detected with agarose gel electrophoresis：+ 6 μ 1.5 × Loading of L Buffer of 2 μ L samples, 1% agar Sugar, Gel Red dyestuffs, 80V, 40min, 1 × TAE buffer solutions.

OD230, OD260, OD280 are measured after taking 5 μ L sample+2mL water to dilute 400 times, calculate OD260/OD280, OD260/OD230 compares the purity of RNA ,=OD260 × 400 × 40 RNA concentration (ng/ μ L).

Testing result such as Fig. 1 extracts total serum IgE, agarose gel electrophoresis inspection from cultivation type Potato Cultivars Favorita It surveys, has two apparent bands (28S and 18S), show that RNA mass is preferable.

⑵.RT-PCR

1. reverse transcription synthesizes cDNA

Reverse transcription is carried out by the cDNA synthetic agent box operation instructions of TakaRa companies, overall reaction system is 20 μ l, is used RNase free centrifuge tubes, reaction system are as follows：

65 DEG C are denaturalized 5 minutes, at least 1 minute cooling on ice rapidly, slightly centrifuge, are then added：

Slight to be uniformly mixed, 55 DEG C of reactions 60min, 70 DEG C of 15min make enzyme inactivate, -20 DEG C of preservations.

2. PCR amplification

Before the areas CDS of target gene and introduce XbaI and SmaI restriction enzyme sites (convenient for carrier connection with), used in amplification Primer is as follows：

The primer of StDWF1 CDS amplification is：

StDWF1PF:5’GGATCC-ATGGCAGATGTTCAGGC 3’

StDWF1 PR:5’CCCGGG-TCAATCTTCAGGCTCAT 3’

Reaction system is 20 μ l, sequentially adds following component：

Mixing, slightly centrifugation are sunk to the bottom, and are carried out amplification reaction by following cycle, reaction condition：

(a) carry out pre-degeneration reaction under the conditions of 95 DEG C, when a length of 3min；

(b) carry out reaction of degeneration (RD) under the conditions of 95 DEG C, when a length of 30s；

(c) anneal 30s under the conditions of 54-58 DEG C；

(d) extend 1-1.5min under the conditions of 72 DEG C；

(e) circulation step (b)~(d) 35 times；

(f) extend 10min under the conditions of 72 DEG C；

(g) it is kept the temperature under the conditions of 4 DEG C；

1.0% (w/v) agarose gel electrophoresis analyzes PCR amplification result such as Fig. 2, and as a result display obtains the piece of 1704bp Section.

(3) target fragments recovery purifying

It is as follows with reference to the method for Tiangeng DNA gel QIAquick Gel Extraction Kit：

A. column equilibration step：600 μ l equilibrium liquids are added into adsorption column, 10000rpm centrifuges 1min, outwells collecting pipe Balance waste liquid is simultaneously returned to collecting pipe again.

B. the Ago-Gel containing target gene is cut.

C. to equipped with target gene gel centrifuge tube be added 100 μ l liquor kalii aceticis, 50 DEG C of water-bath 10min, and up and down Reverse centrifuge tube, fully dissolves gel.

D. dissolved gel is imported in adsorption column, 12000rpm centrifuges 1min, outwells collecting pipe waste liquid and will adsorb Column is put into collecting pipe again.

E. 600 μ l solution PW are added into adsorption column, 12000rpm centrifuges 1min, outwells collecting pipe waste liquid and by adsorption column It is put into collecting pipe again.

F. step 5 is repeated.

G. adsorption column is put into collecting pipe, 12000rpm centrifuges 2min, and stands 10min.

H. adsorption column is put into a clean centrifuge tube, suitable elution buffer is vacantly added dropwise to adsorbed film centre position Liquid is placed at room temperature for 2min.12000rpm centrifuges 2min, collects DNA solution.

I. the solution that centrifugation obtains is re-poured into adsorption column, room temperature puts 1min, and 12000rpm centrifuges 2min to improve back Yield.Obtained DNA (StDWF1 genes) product be stored in -20 DEG C it is spare.

Two, over-express vector is built

(1) target fragment connect and converts with cloning vector

1. connecting

The PCR product of recovery purifying is connect with pMD19-T cloning vectors, reaction system is as follows：

Target fragment heats 5min at 65 DEG C, on ice extremely cold operation：

After mixing centrifugation, 4 DEG C of connection 18h, -20 DEG C of preservations.

2. recombinant plasmid dna converts

A. 5 μ l connection products are uniformly mixed with 100 μ l bacillus coli DH 5 alpha competent cells on superclean bench, ice bath 30min。

B.42 DEG C water-bath heat shock 90s, ice bath 5min.

C. it is added 800 μ l fluid nutrient mediums, 37 DEG C, 220rpm shaken cultivations 40min.

D. on the LB solid mediums of Amp have been added (100 μ g/ml), uniformly apply and spread 40 μ l of X-gal (20mg/ml) With the mixed liquor of 4 μ l of IPTG (200mg/ml).

E. after thalline renewal cultivation, room temperature 3000rpm, 2min centrifuge bacterium solution, take out 800 μ l supernatants with pipettor, are resuspended Remaining 100 μ l.

F. on superclean bench, bacterium solution is uniformly coated in tablet, place 30min-60min after fully absorbing again It is inverted culture 16-18h in 37 DEG C, single bacterium colony identification is chosen after growing.

(2) identification of recombinant plasmid

The picking white single bacterium colony in blue hickie screening and culturing medium, is added in the ddH2O of 20 μ l, is uniformly mixed, as The template of bacterium solution PCR identification reaction systems, PCR product is into row agarose gel electrophoresis.The bacterium colony that picking gel electrophoresis is positive To in the LB liquid medium containing Amp antibiotic, 37 DEG C of shaken cultivation 8h extract plasmid, and after carrying out plasmid PCR identification, Send positive plasmid to sequencing.

Wherein, plasmid extraction is according to OMEGA plasmid extraction kit operating procedures：

(a) it draws in about 3ml bacterium solutions to 5ml centrifuge tubes, 5000rpm is centrifuged 30 seconds, collects bacterium.

(b) add 200ml solution Is, acutely vibrate suspension thalline with oscillator.

(c) solution II for adding 300ml to configure, overturns mixing.

(d) solution III of 300ml precoolings, ice bath 5~10 minutes after mixing is added after solution clarification immediately.

(e) 4 DEG C, 5000rpm centrifuge 15 minutes.

(f) supernatant is taken, isometric chloroform/isoamyl alcohol is added, after overturning mixing, 5000rpm centrifuges 5 minutes precipitation eggs In vain.

(g) supernatant is drawn, 0.7 times of volume isopropanol, mixing are added.5000rpm is centrifuged 10 minutes, and supernatant is abandoned in suction, then is used 70% ethyl alcohol washing precipitation, 8000rpm, 5min abandon supernatant.Drying at room temperature is dissolved in appropriate ddH2O2 after ten minutes, and 4 DEG C of preservations are standby With.

Plasmid PCR detects, in biological order-checking, operation specific as follows after first amplified reaction, electrophoretic analysis：

Reaction system is 20 μ l, and following components is added with this on ice：

Mixing, slightly centrifugation are sunk to the bottom, and are pressed noodles part and are carried out cyclic amplification reaction：

(a) carry out pre-degeneration reaction under the conditions of 95 DEG C, when a length of 3min；

(b) carry out reaction of degeneration (RD) under the conditions of 95 DEG C, when a length of 30s；

(c) anneal 30s under the conditions of 54-58 DEG C；

(d) extend 1-1.5min under the conditions of 72 DEG C；

(e) circulation step (b)~(d) 35 times；

(f) extend 10min under the conditions of 72 DEG C；

(g) it is kept the temperature under the conditions of 4 DEG C；

Pcr amplification product serves the raw work sequencing in sea after the analysis of 0.8% agarose gel electrophoresis, by positive colony, as a result As shown in figure 3, testing result shows that target fragment is successfully connected with cloning vector, StDWF1 gene coded sequence segments are obtained.

(3) cloning vector digestion and over-express vector structure

With pMD19-T carrier of restriction enzyme BamH1 and SmaI the difference double digestion containing target fragment and it is overexpressed load The pBI121 carriers that digestion obtains are recycled with target fragment and are connected with T4 ligases by body pBI121 (sky).Endonuclease reaction exists 37 DEG C of progress, connection react on 4 DEG C overnight.

Wherein, endonuclease reaction system and coupled reaction system are as follows：

Connection product pBI121-StDWF1 is converted into competent escherichia coli cell, progress culture medium resistance screening, PCR, digestion and sequencing identification.

(4) plasmid containing target gene is transferred to Agrobacterium

The preparation of I Agrobacterium competent cell

(a) it from the single bacterium colony of picking Agrobacterium tumefaciems GV3101 on YEB solid plates, is inoculated in 5ml and contains 50 μ g/ml profit good fortune In flat, 15 μ g/ml gentamicins YEB fluid nutrient mediums, 28 DEG C, 200 revs/min of overnight shaking cultures；

(b) absorption is incubated overnight bacterium solution 2ml and is added in 50mlYEB fluid nutrient mediums and (contains identical antibiotic), and 28 DEG C are shaken Swing culture to OD600 be 0.5, bacterium solution ice bath 30 minutes；

(c) 4 DEG C, 2, the 500g collection bacterium of centrifugation 5 minutes；

(d) plus 10ml 0.15M NaCl suspension agrobatcerium cells, 2,500g, it centrifuges 5 minutes；

(e) the 20mmol/L CaCl2 suspension cells of 1ml precoolings are added, this step operates on ice.

Agrobacterium competence uses in 24 hours.

The conversion (freeze-thaw method) of II pair of Agrobacterium

It takes 100ml competent cells and melts on ice, the recombinant plasmid of 1mg is added, stands 30 minutes after mixing on ice, Then 1ml YEB culture mediums (being free of any antibiotic) are added in the quick-frozen 1min in liquid nitrogen, 37 DEG C of water-bath 5min, 28 DEG C at a slow speed Shaken cultivation 4 hours；5000rpm centrifuges 30 seconds collection bacterium, abandons supernatant, and 0.1ml YEB culture mediums suspension cell again, coating is added In on the YEB tablets containing 50 μ g/ml rifampins, 15 μ g/ml gentamicins (Gen) and 50mg/ml Kna, 28 DEG C are cultivated about 48 Hour.The single bacterium colony grown on picking tablet is inoculated in YEB liquid mediums and (containing 50mg/mlKan and corresponds to the agriculture bar The antibiotic of bacteria strain) in, 28 DEG C of shaken cultivations are stayed overnight.A small amount of extraction Plasmid DNA, PCR amplification is carried out by template of Plasmid DNA Identification is to get to the Agrobacterium GV3101 containing pBI121-StDWF1.

It selects three pMD-StDWF1 recons and send sequencing.Three recon sequencing results are identical, but equal with sequence is announced It has differences：10 differences are wherein shared, only 22 and 133 mutational sites cause amino acid sequence variation.In 22bp Place becomes C by A, and the 8th isoleucine of amino acid sequence is promoted to become leucine；C becomes G at 133 bp, causes 45 leucines of amino acid sequence become valine.Since there is codon degeneracy, the difference of other 8 bases not to draw Play amino acid sequence variation.Optionally three recons send sequencing, as a result still as before, show to may be Potato Cultivars Difference cause gene order different.So far the clone of the StDWF1 genes almost the same with sequence is announced is obtained.This reality Target gene is tested and is cloned from 117 test tube seedling leaf of river taro, sequencing result shares 11 base differences with sequence is announced, causes Amino acid variation have at 2 and position is identical, but changed amino acid is different.So far clone obtains complete with announcement sequence The consistent areas StDWF1 gene C DS.

Plant expression vector pBI121 and recombinant cloning vector are distinguished into digestion, the mesh for purifying being recycled by T4 ligases Segment and digestion over-express vector pBI121 connections, structure by CaMV35S DWF1 gene overexpressions carriers drive and turn Change into competent E.coli.With I double digestion recombinant plasmid of Bamh I and Sma, can digestion go out the segment (Fig. 4) of 1704bp.? Single bacterium colony is obtained in antibiotic YEB solids screening and culturing medium, illustrates the agriculture for obtaining the plasmid containing pBI121-StDWF1 respectively Bacillus strain.

Overall length StDWF1 coded sequences have been cloned in this research from Favorita blade, are compared with sequencing data of whole genome It was found that there are the change of divergence of 10 bases, wherein 2 distinguishing bases result in the mutation of amino acid, but amino acid mutation site Not in FAD binding structural domains, such difference will not cause the variation of protein function, and this sequence difference is mainly due to plant Growing environment difference and breed difference, will not change the function of original protein.Three-dimensional structural analysis shows the amino of mutation Acid will not cause protein 3D structures to generate difference.

Three, it cultivates and is overexpressed StDWF1 Gene in Potato plant

Material：

The test tube seedling of Potato Cultivars river taro No. 10 (C10)；The Agrobacterium containing pBI121-StDWF1 of laboratory structure GV3101。

Reagent：Kanamycins (Kan) and antibiotic cephalo (cef) are purchased from Reagent Company of Wanke.

Plant growth regulator used includes：6-benzyladenine (6-BA), gibberellin (GA3) Thidiazuron (TDZ), Heteroauxin (IAA) etc. is Sigma Products, 2,4- dichlorphenoxyacetic acids (2,4-D) be purchased from Reagent Company of Wanke, be made into It is saved backup in -20 DEG C through 0.22 μm of membrane filtration sterilizing after mother liquor through all needing.Each nutritional ingredient of MS culture mediums is that analysis is pure, Formula is as follows：(unit .mg L-1)

A great number of elements：Potassium nitrate (KNO3) 1900, ammonium nitrate (NH4NO3) 1650, potassium dihydrogen phosphate (KH2PO4) 170, sulphur Sour magnesium (MgSO47H2O) 370, calcium chloride (CaCl22H2O) 440

Trace element：Potassium iodide (KI) 0.83, boric acid (H3BO3) 6.2, manganese sulfate (MnSO44H2O) 22.3, zinc sulfate (ZnSO47H2O) 8.6, sodium molybdate (Na2MoO42H2O) 0.25, copper sulphate (CuSO45H2O) 0.025, cobalt chloride (CoCl2·6H2O)0.025

Molysite：Disodium ethylene diamine tetraacetate (Na2.EDTA) 37.25, ferrous sulfate (FeSO47H2O) 27.85

Organic principle：Inositol 100, glycine 2, thiamine hydrochloride (VB1) 0.1, puridoxine hydrochloride (VB6) 0.5, niacin (VB5)0.5

Solid medium needs that agar 6g/L, sucrose 30g/L is added.In addition to agar, remaining uses 1mol/L after all adding Tris (6.057g is settled to 50mL) adjusts pH to 5.8, adds enduring of agar, boils 3-4 times.

During Agrobacterium Potato microtuber stem section method turns target gene：

1. test tube seedling stem section preculture

On superclean bench, numerous test tube seedling stem section is expanded in shearing, and the stem section after shearing is lain in solid medium Upper carry out preculture, 20 DEG C or so dark culturing 2-3d.

2. Agrobacterium activates

Take original bacteria liquid streak inoculation (Kan containing 50mg/L and 50mg/L Rif) in solid YEB culture mediums, 27 DEG C of cultures About 48h, envelope ware is in 4 DEG C of preservations.4mL YEB are added in 10mL centrifuge tubes, choose single bacterium colony, 220rpm, 27 DEG C are shaken bacterium 16h, are stored in 4 It is DEG C spare.With 1：100 connect bacterium in the fresh liquid YEB filled with 10mL centrifuge tubes, and 220rpm, 27 DEG C are shaken bacterium 12h, are stored in 4 DEG C It is spare.

3. culture medium is prepared

Outstanding bacterium solution：Liquid MS+3% sucrose, pH5.9-6.0.

Stem section pre-culture medium and co-cultivation base：MS+1.0mg/L 6-BA+0.2mg/L TDZ+0.05mg/L 2,4-D+ + 0.6% agar of 0.1mg/LGA3+3% sucrose.

Bud screening and culturing medium：MS+1.0mg/L 6-BA+0.2mg/L TDZ+0.05mg/L 2,4-D+0.1mg/L GA3+ + 0.6% agar+50mg/L Kan+100mg/L Cef+250mg/L Car of 3% sucrose.

It cuts the bud differentiated and accesses screening and culturing medium of taking root：+ 0.6% agar+50mg/L Kan+ of MS+3% sucrose 100mg/L Cef+250mg/L Car。

4. During Agrobacterium co-cultures and screening

Stem section is taken in aseptic bottle on superclean bench, the bacterium solution shaken, 6000rpm is taken to centrifuge 5min, remove supernatant, MS fluid nutrient mediums are added to be resuspended.

The good stem section of preculture is transferred to small beaker from solid medium.

The bacterium after being resuspended is poured into small beaker, liquid infects 2-3min.

Bacterium solution is outwelled, sterile water wash stem section is poured into, is transferred on aseptic filter paper after being repeated twice and sucks excessive moisture, connect It in the symbiotic culture medium for being transferred to stem section and being lined with two layers of aseptic filter paper, 24 DEG C of dark culturing 36h.

Stem section is put into the sterile water of the Cef containing 100mg/L and is cleaned 3~4 times, screening training is transferred to after sopping up excessive moisture Base is supported, 16h light/8h is dark, 60 μm of light intensity ol m-2s-1,22 ± 1 DEG C.

5. callus tissue culture

1 subculture is changed every 10-14d, that changes is more diligent, and differentiation is faster.Removal is lethal, dirty because Agrobacteriuna overgrowth Dye and complete albefaction plant, take 35-90d etc..

The regeneration bud of the callus of culture is identified：

1. screening and identification of taking root

Regeneration bud is cut addition to take root in screening and culturing medium, 60 μm of ol m-2s-1,16h light/8h of light intensity are dark, 20 ± 1 DEG C Culture, the strain to that can grow root can tentatively judge to be transferred to target gene.

2. PCR is detected

Test tube potato leaf DNA is extracted using CTAB methods in a small amount

A.2%CTAB extraction buffer preheats in 65 DEG C of water-baths.

B. it takes 8 test tube seedling leafs in mortar, powdery is milled to liquid nitrogen；

C. the 2%CTAB extraction buffers of 700ul are added, are gently agitated for uniformly, being placed in 65 DEG C of water bath or insulating box In, it gently shakes every 10min, is taken out after 30~60min；

D. after cooling down 2min, chloroform-isoamyl alcohol (24 is added：1) to full packages, 2~3min is gently shaken, keeps the two mixing equal It is even；

E. 10 000rpm are put into centrifuge and centrifuge 10min, at the same time, the isopropanol of 600ul are added another new In sterile centrifugation tube；

F.10 after 000rpm centrifuges 1min, pipettor lightly draws supernatant, is transferred to the centrifuge tube containing isopropanol It is interior, centrifuge tube is slowly fluctuated 30s, DNA floccules can be seen by so that isopropanol is fully mixed to water layer；

G.10000rpm after centrifuging 1min, liquid is outwelled immediately, pays attention to not pouring out white DNA pellet, centrifuge tube is fallen It stands on the paper handkerchief spread out；

H.60s after, upright centrifuge tube is added 75% ethyl alcohol of 720ul and the sodium acetate of 80ul 5M, gently rotates, use hand Thrum tip makes the DNA blocks of precipitation and tube bottom swim in liquid；

I. 30min is placed, the impurity of DNA blocks is made to dissolve；

J.10000rpm after centrifuging 1min, liquid is outwelled, the ethyl alcohol of 800ul 75% is added, DNA is washed into 30min again；

K.10000rpm after centrifuging 30sec, liquid is outwelled immediately, and centrifuge tube is stood upside down on the paper handkerchief spread out；Several minutes Afterwards, upright centrifuge tube, dry DNA (natural air drying is dried up with air duct)；

L. 50ul 0.5 × TE buffer solutions are added, so that DNA is dissolved, takes 4 μ l electrophoresis detections, remaining -20 DEG C save backup.

Synthesize II primers of resistance screening marker gene npt：

nptⅡ-P1：GCTATGACTGGGCACAACAG；

nptⅡ-P2；ATACCGTAAAGCACGAGGAA.

3. positive transgenic strain expression quantity is identified

The strain that double of Quantitative measurement goes out extracts RNA, and each strain selects three bottles, and reverse transcription synthesizes cDNA.And pass through The cDNA of each strain qRT-PCR methods, measure transgenic line in StDWF1 with respect to non-transgenic strain expression quantity.

4. potato turns the phenotypic analysis of plant

The higher strain of transgenic line StDWF1 gene expression amounts is expanded into numerous, 3 bottles of each strain, every bottle is inoculated with 3 buds, Illumination temperature is 24 DEG C, its morphological feature is compared and is observed after 15d, including transgenic line and wild type test tube seedling The indexs such as plant height, root long, fresh weight, stem thickness.

5. data analysis

Significant difference analysis is carried out using spss17.0 (SPSS Inc, Chicago, USA) software, significance is adopted With P < 0.05.

Potato test tube seedling stem section after During Agrobacterium and co-cultivation (Fig. 5), is transferred in bud screening and culturing medium, by 2 The culture in all days or so, stem section, which starts to expand, there is callus (Fig. 6), and callus dissolves green bud (Fig. 7) after 45 days, training It supports to budlet 1cm or so, cuts to be transferred in root media and carry out screening of taking root.Transfer-gen plant is in root media Can normal growth, and nontransgenic plants can be grown in the medium but cannot take root (Fig. 8).Through transgenosis after a period of time Strain expansion is numerous, obtains 61 transgenosis intact plants (Fig. 9) of resistant plant.

Extract transgenic line blade total serum IgE, reverse transcription at cDNA, the electrophoretic analysis through pcr amplification product the result shows that, II genetic fragments of npt (Figure 10) to 676bp can be expanded in pBI121-StDWF1 transgenosis.

It is detected by PCR, selects positive plant, being overexpressed transfer-gen plant to StDWF1 carries out root long, leaf blade size, life Root induction speed and plant height analysis, are overexpressed material root in 40 days and are considerably longer than WT lines, further analyze tissue culture process In the facilitation (Figure 11) of the gene pairs rooting induction started to take root at 20 days as a result, it has been found that being overexpressed, and wild type was at 30 days Do not take root yet (Figure 13), and be overexpressed leaf size, plant height is above wild type (Figure 12 and 14).To sum up show StDWF1 promotes plant strain growth.By following table it is found that the indexs such as No. 4 transfer-gen plant plant heights, fresh weight and root long are compared with non-transgenic Strain rises and significant difference, but other several strains are in addition to there were significant differences for root long and wild type, other three indexs with it is wild Raw type has different degrees of non-significant difference, after illustrating StDWF1 gene overexpressions, plant with growing way promoted.

Embodiment 2

The StDWF1 expression analysis of potato different parts different times：

Extract the leaf of Favorita different tissues (root, stolon, old leaf, tender leaf, stem and stem tuber) and different growth stage The total serum IgE of piece (after planting 2 weeks start to sample, and the sampling period is 1 week), with Oligo (dT) for primer, according to First Strand CDNA Synthesis Kit Revertra Ace- α-reverse recording method synthesizes cDNA.

Internal reference EF1 α L primers are designed according to potato gene group database,

That is EF1 α L F：5'-CTTGTACACCACGCTAAGGAG-3'；

EF1αL R：5'-GTCAATGCAAACCATTCCTTG-3'.

Primer is quantified according to full length cDNA sequence design StDWF1：

DWF1-P1：5'-AGTTGGTGGACTTTCTTCTTTC-3'；

DWF1-P2：5'-TTCTGCATTCCTCTGTTCAAG-3'.

Quantitative PCR reaction system is：4.5 μ L cDNA, upstream and downstream primer (10 μm of ol/L) each 0.25 μ L, 2 × Ssofast Eva Green 5 μ L, ddH2O supply 10 μ L.

Response procedures are 95 DEG C of 30s；95 DEG C of 5s, 55 DEG C of 5s, 39 cycles；95 DEG C of 10s, 65~95 DEG C are done solubility curve, Each temperature is risen with 0.5 DEG C, and stops 5s.

3 repetitions are arranged in each test specimen, and gene expression amount is with 2- △ △ Ct methods in Bio-Rad CFX Manager It is analyzed on V and Excel softwares, measures expression of the StDWF1 at potato different tissues position and blade different growth stage Amount.

After a variety of desaccharification measures such as low-concentration ethanol, NaAc and freeze thawing are added, the preferable RNA of quality has been obtained, The electrophoresis detection of sample segment such as Figure 15, it can be seen that the clear wash rice bands of 28S, 18S, 5S tri-.OD260/230, OD260/280 show Carried RNA sugar-frees, salt and protein contamination, quality satisfaction are built library sequencing and are required, can be used for testing in next step.

Real time PCR potato root, stolon, stem tuber, stem, old leaf and tender leaf StDWF1 gene expressions (figure 16).The results show that having expression in being organized at 5 kinds.Through significance analysis (p≤0.05), StDWF1 genes are in tender leaf, old leaf It is significantly higher than other tissue sites with expression quantity in stolon, followed by, stem tuber, root, stem.Show StDWF1 mainly in Fei Wurui Its tender leaf, old leaf and with expressed in stolon, there are significant differences for each tissue expression.

Quantitative analysis is carried out to blade each period, it is found that StDWF1 genes have expression in each growth phase, using aobvious Entire breeding time is divided into three phases by work property analysis (p≤0.05)：First stage (14d, seeding stage) StDWF1 gene expressions Highest is measured, the StDWF1 of height expression promotes the synthesis of the growth substance such as blade BR, regulates and controls plant strain growth；Second stage (21d- 28d) plant strain growth is in steady, and StDWF1 expression quantity is reduced compared with previous stage in blade；Phase III (35d-56d) is Ma Ling Potato plant strain growth later stage, each substance synthesis activity are obviously reduced, and it is minimum (such as Figure 17) that StDWF1 expression quantity drops to breeding time.

It is the embodiment of the present invention as described above.The present invention is not limited to the above-described embodiments, anyone should learn that The structure change made under the inspiration of the present invention, the technical schemes that are same or similar to the present invention each fall within this Within the protection domain of invention.

Claims (10)

1. a kind of potato StDWF1 genes, which is characterized in that its base sequence such as SEQ ID NO:Shown in 1.

2. a kind of preparation method of potato StDWF1 genes, which is characterized in that include the following steps：

(1) total serum IgE is extracted from Potato Cultivars Favorita test tube seedling；

(2) cDNA is synthesized according to the total serum IgE reverse transcription of extraction；

(3) PCR amplification introduces XbaI and SmaI restriction enzyme sites using cDNA as template before the areas CDS of cDNA, and design amplification is drawn Object StDWF1PF and StDWF1PR, and add primer StDWF1PF, primer StDWF1PR, 10 × amplification buffer, sterile water, DNTPs, Taq archaeal dna polymerase mixing simultaneously carry out PCR amplification, wherein cDNA, primer StDWF1PF, primer StDWF1PR, 10 × Amplification buffer, sterile water, dNTPs, Taq archaeal dna polymerase volume be respectively：1μL,1μL,1μL,2μL,15.3μL,0.5μ L, 0.2 μ L, and cDNA, primer StDWF1PF, primer StDWF1PR and dNTPs concentration be respectively 10~100ng/L, 2 μ M/μl,2μM/μl,10mmol/L；

The base sequence of amplimer StDWF1PF, StDWF1PR are respectively such as SEQ ID NO:2,SEQ ID NO:Shown in 3；

(4) recovery purifying pcr amplification product obtains potato StDWF1 genes through sequencing analysis.

3. a kind of preparation method of potato StDWF1 genes as claimed in claim 2, which is characterized in that in step (1), carry It is the blade seeding stage to take the opportunity of Favorita test tube seedling total serum IgE, and extract part is the tender leaf of Favorita test tube seedling.

4. a kind of preparation method of potato StDWF1 genes as claimed in claim 2, which is characterized in that total in step (1) The extracting method of RNA uses Trizol methods, is as follows：

(1a) is ground：Mortar is put into 4 spoonfuls of liquid nitrogen and Potato Cultivars Favorita specimen locations, and liquid nitrogen is worn into rapidly after being evaporated completely Fine powder, is quickly charged with after EP pipes plus 1mL Trizol, violent mixing, room temperature put 5-10min；

(1b) 4 DEG C of 12000rpm centrifuge 5min, draw in supernatant to new pipe, and 200ml chloroforms are added, slight to rock up and down, room Temperature stands 5min；

(1c) 4 DEG C of 12000rpm centrifuge 10min, and isometric phenol/chloroform/isoamyl alcohol is added to new pipe in Aspirate supernatant, overturns mixed It is even；

(1d) 4 DEG C of 12000rpm centrifuge 20min, and for Aspirate supernatant to new pipe, being gradually added into absolute ethyl alcohol keeps its final concentration of 12%, Quick spin after the mixing that turns upside down；

(1e) 4 DEG C of 12000rpm centrifuge 10min, draw 400mL supernatants to new pipe, 0.7 times of volume isopropanol is added and runs up and down Mixing, and 0.2 times of volume 1mol/L NaAc-20 DEG C is added and precipitates 1h；

(1f) 4 DEG C of 12000rpm centrifuge 15min, abandon supernatant, and 75% ethyl alcohol of 1mL is added and washes precipitation, 4 DEG C, 8500rpm centrifugations 3min, then 75% ethyl alcohol of 1mL is added to wash 2 times；

(1g) outwells supernatant, sops up surplus liquid as possible, and super-clean bench up-draught 10min removes residual ethanol, is added at 80mLDEPC Water is managed, 55 DEG C of water-bath 5min are immediately placed in, -80 DEG C of 60min are repeated 2 times；

(1h) 4 DEG C of 12000rpm centrifuge 20min, careful to draw 70 μ L of supernatant, pay attention to not contacting bottom to get to total serum IgE, in- 80 DEG C freeze it is spare；

Wherein, step (1c)-(1h) is operated on ice.

5. a kind of preparation method of potato StDWF1 genes as claimed in claim 2, which is characterized in that total in step (2) RNA reverse transcriptions synthesize cDNA, and reverse transcription, overall reaction system body are carried out by the cDNA synthetic agent box operation instructions of TakaRa companies Product is 20 μ l, and using RNase free centrifuge tubes, reaction system is as follows：

65 DEG C are denaturalized 5 minutes, at least 1 minute cooling on ice rapidly, slightly centrifuge, are then added：

It is uniformly mixed, 55 DEG C of reactions 60min, 70 DEG C of 15min make enzyme inactivate, -20 DEG C of preservations.

6. a kind of preparation method of potato StDWF1 genes as claimed in claim 2, which is characterized in that PCR in step (3) The reaction condition of amplification is：

(3a) carries out pre-degeneration reaction under the conditions of 95 DEG C, when a length of 3min；

(3b) carries out reaction of degeneration (RD) under the conditions of 95 DEG C, when a length of 30s；

(3c) anneals 30s under the conditions of 54-58 DEG C；

(3d) extends 1-1.5min under the conditions of 72 DEG C；

(3e) circulation step (3b)~(3d) 35 times；

(3f) extends 10min under the conditions of 72 DEG C；

(3g) keeps the temperature pending under the conditions of 4 DEG C.

7. a kind of preparation method of potato StDWF1 genes as claimed in claim 2, which is characterized in that returned in step (4) The method for receiving purifying pcr amplification product specifically comprises the following steps：

(4a) column equilibration step：600 μ l equilibrium liquids are added into adsorption column, 10000rpm centrifuges 1min, outwells the flat of collecting pipe Weighing apparatus waste liquid is simultaneously returned to collecting pipe again；

Pcr amplification product is placed in the Ago-Gel of 0.01g/ml by (4b), and Ago-Gel is transferred in centrifuge tube, to 100 μ l liquor kalii aceticis, 50 DEG C of water-bath 10min, and the centrifuge tube that turns upside down are added in centrifuge tube, fully dissolves gel；

(4c) imports dissolved gel in adsorption column, and 12000rpm centrifuges 1min, outwells collecting pipe waste liquid and by adsorption column It is put into collecting pipe again；

(4d) 600 μ l solution D NA wash buffer, 12000rpm are added into adsorption column and centrifuge 1min, and it is useless to outwell collecting pipe Adsorption column is simultaneously put into collecting pipe by liquid again；

Adsorption column is put into collecting pipe by (4e), and 12000rpm centrifuges 2min, and stands 10min；

Adsorption column is put into a clean centrifuge tube by (4f), and suitable elution buffer is vacantly added dropwise to adsorbed film centre position Liquid is placed at room temperature for 2min, and 12000rpm centrifuges 2min, collects DNA solution；

The solution that centrifugation obtains is re-poured into adsorption column by (4g), and room temperature puts 1min, and 12000rpm centrifuges 2min to improve recycling Rate to get the potato StDWF1 gene outcomes to potato StDWF1 gene outcomes, obtained be stored in -20 DEG C it is spare.

8. a kind of overexpression potato StDWF1 genes are to promote the method for potato Rapid Rooting, which is characterized in that including such as Lower step：

(1) over-express vector is built

A. cloning vector is connected：Potato StDWF1 genes are connect with pMD19-T cloning vectors, first by potato StDWF1 bases Because heating 5min at 65 DEG C, following reaction system is then added：

After mixing centrifugation, 4 DEG C of connection 18h, then in -20 DEG C of preservations；

Wherein, solution I is isometric mixed solution of 50mM glucose, 25mM Tris-HCL, 10mM EDTA, pH value 8.0；

B. recombinant plasmid dna converts：By 5 μ l cloning vectors connection products and 100 μ l bacillus coli DH 5 alpha senses on superclean bench It is uniform by state mixing with cells, ice bath 30min；42 DEG C of water-bath heat shock 90s, then ice bath 5min；It is added 800 μ l fluid nutrient mediums, 37 DEG C, 220rpm shaken cultivations 40min；On the LB solid mediums of Amp antibiotic have been added, the content of Amp antibiotic is 100 μ g/ml uniformly apply the IPTG mixed liquors of the X-gal and 4 a concentration of 200mg/ml of μ l that spread 40 a concentration of 20mg/ml of μ l；Thalline After renewal cultivation, room temperature 3000rpm, 2min centrifuge bacterium solution, take out 800 μ l supernatants with pipettor, remaining 100 μ l are resuspended；? On superclean bench, bacterium solution is uniformly coated in tablet, 30min-60min is placed and is inverted training then at 37 DEG C after fully absorbing 16-18h is supported, single bacterium colony identification is chosen after growing；Single bacterium colony to be identified is added in the ddH2O of 20 μ l, is uniformly mixed, as The template of bacterium solution PCR identification reaction systems, PCR product is into row agarose gel electrophoresis；The bacterium colony that picking gel electrophoresis is positive To in the liquid LB solid mediums containing Amp antibiotic, 37 DEG C of shaken cultivation 8h extract plasmid, after plasmid PCR detection, and The positive colony that detection is obtained carries out plasmid PCR identification, and positive plasmid is accredited as through PCR, obtains containing mesh through sequencing analysis Segment pMD19-T carriers；

C. restriction enzyme BamH1 and SmaI is used to distinguish pMD19-T carrier and over-express vector of the double digestion containing target fragment The pBI121 carriers that digestion obtains are recycled with target fragment and are connected with T4-DNA ligases by pBI121, and endonuclease reaction is 37 DEG C carry out, connection react on 4 DEG C overnight；Connection product pBI121-StDWF1 is converted into competent escherichia coli cell, picking again Single bacterium colony expands numerous, extraction plasmid, is transformed into the competent cell of Agrobacterium tumefaciems after PCR, digestion and sequencing identification；

(2) plasmid containing target gene is transferred to Agrobacterium

A. the single bacterium colony of picking Agrobacterium tumefaciems GV3101 is inoculated in 5ml containing 50 μ g/ml rifampins, 15 μ g/ml gentamicins In YEB fluid nutrient mediums, in 28 DEG C, 200 revs/min of overnight shaking cultures；

B. absorption is incubated overnight bacterium solution 2ml and is added in YEB fluid nutrient mediums of the 50ml containing identical antibiotic, 28 DEG C of shaken cultivations It is 0.5 to OD600, bacterium solution ice bath 30 minutes；

C.4 DEG C, 2500g centrifuges 5 minutes collection bacterium；

D. plus 10ml 0.15M NaCl suspension agrobatcerium cells, 2500g are centrifuged 5 minutes；

E. the 20mmol/L CaCl of 1ml precoolings are added₂Suspension cell, this step operate on ice, obtained Agrobacterium competence Cell, and used in 24 hours；

F. it takes 100ml Agrobacteriums competent cell and melts on ice, the pMD19-T carriers containing target fragment of 1mg are added, mix 30 minutes are stood after even on ice, then the not antibiotic YEB trainings of 1ml are added in the quick-frozen 1min in liquid nitrogen, 37 DEG C of water-bath 5min Support base, 28 DEG C of shaken cultivation 4 hours at a slow speed；5000rpm centrifuges 30 seconds collection bacterium, abandons supernatant, it is not antibiotic that 0.1ml is added YEB culture mediums suspension cell again is coated on anti-containing 50 μ g/ml rifampins, 15 μ g/ml gentamicins and 50mg/ml Kana On the YEB tablets of raw element, 28 DEG C are cultivated about 48 hours；The single bacterium colony grown on picking tablet, is inoculated in containing 50mg/ml Kana antibiotic and corresponding in the YEB liquid mediums of the antibiotic of agrobacterium strains, 28 DEG C of shaken cultivations are stayed overnight；Extraction unit Divide Plasmid DNA, carries out PCR amplification identification by template of Plasmid DNA, identification, which is positive, obtaining being transferred to the plasmid containing target gene Agrobacterium；

(3) During Agrobacterium test tube seedling potato stem section

A. test tube seedling stem section preculture, on superclean bench, numerous test tube seedling stem section is expanded in shearing, and the stem section after shearing is put down It is placed on solid medium and carries out preculture, 20 DEG C or so dark culturing 2-3d；

B. Agrobacterium activate, take be transferred to the plasmid Agro-Bacterium bacterium solution streak inoculation containing target gene in solid Kan containing 50mg/L with In the YEB culture mediums of 50mg/L Rif, 27 DEG C of culture 48h, envelope ware is in 4 DEG C of preservations；4mL YEB trainings are added in 10mL centrifuge tubes Support base, choose single bacterium colony, 220rpm, 27 DEG C are shaken bacterium 16h, be stored in 4 DEG C it is spare；With 1：100 to connect bacterium new in being filled with 10mL centrifuge tubes In fresh liquid YEB culture mediums, 220rpm, 27 DEG C are shaken bacterium 12h, be stored in 4 DEG C it is spare；

C. During Agrobacterium co-cultures and screening takes the bacterium solution shaken by stem section income aseptic bottle on superclean bench, 6000rpm centrifuges 5min, removes supernatant, and MS fluid nutrient mediums are added and are resuspended；By the good stem section of preculture from solid medium transfer Move to small beaker；The bacterium after being resuspended is poured into small beaker, liquid infects 2-3min；Bacterium solution is outwelled, sterile water wash stem section is poured into, weight Multiple be transferred on aseptic filter paper afterwards twice sucks excessive moisture, and stem section is then transferred to the symbiosis training for being lined with two layers of aseptic filter paper It supports in base, 24 DEG C of dark culturing 36h；Stem section is put into the sterile water of the Cef containing 100mg/L and is cleaned 3~4 times, sops up superfluous water It is transferred to screening and culturing medium after point, 16h light/8h is dark, light intensity 60 μm of ol/m2.s1,22 ± 1 DEG C；

D. callus tissue culture changes 1 subculture every 10-14d, removes because of the lethal of Agrobacteriuna overgrowth, pollution and complete Full albefaction plant is to get to the potato plant for being overexpressed potato StDWF1 genes.

9. a kind of overexpression potato StDWF1 genes as claimed in claim 8 to be to promote the method for potato Rapid Rooting, It is characterized in that, step (1) structure over-express vector during, extract plasmid the step of be：

I. it draws in 3ml bacterium solutions to 5ml centrifuge tubes, 5000rpm is centrifuged 30 seconds, collects bacterium；

II. plus 200ml solution Is, suspension thalline is acutely vibrated with oscillator, wherein solution I is 50mM glucose, 25mM Tris- Isometric mixed solution of HCL, 10mM EDTA, pH value 8.0；

III. plus the solution IIs that have configured of 300ml, overturn mixing, wherein solution II be 0.2nM NaOH, 1% mass fraction Isometric mixed solution of SDS；

IV. the solution III of 300ml precoolings is added after solution clarification immediately, ice bath 5~10 minutes after mixing, wherein solution III is The isometric mixed solution of alcohol of 3mM potassium acetates, 2mM acetic acid, 75% mass fraction；

V.4 DEG C, 5000rpm is centrifuged 15 minutes；

VI. supernatant is taken, isometric chloroform/isoamyl alcohol is added, after overturning mixing, 5000rpm centrifuges 5 minutes protein precipitations；

VII. supernatant is drawn, 0.7 times of volume isopropanol, mixing are added；5000rpm is centrifuged 10 minutes, and supernatant is abandoned in suction, then with 70% second Alcohol washing precipitation, 8000rpm, 5min abandon supernatant；Drying at room temperature is dissolved in appropriate ddH2O2 to get to the target of extraction after ten minutes Plasmid, 4 DEG C save backup.

10. a kind of overexpression potato StDWF1 genes as claimed in claim 8 to be to promote the method for potato Rapid Rooting, It is characterized in that, during step (1) structure over-express vector, plasmid PCR detection first expands to be detected again, and steps are as follows：

20 μ l plasmids to be checked are added in reaction system, ice bath environment sequentially adds following components：

Mixing, slightly centrifugation are sunk to the bottom, and carry out cyclic amplification reaction, and the condition of cyclic amplification reaction is specially：

(3a) carries out pre-degeneration reaction under the conditions of 95 DEG C, when a length of 3min；

(3b) carries out reaction of degeneration (RD) under the conditions of 95 DEG C, when a length of 30s；

(3c) anneals 30s under the conditions of 54-58 DEG C；

(3d) extends 1-1.5min under the conditions of 72 DEG C；

(3e) circulation step (3b)~(3d) 35 times；

(3f) extends 10min under the conditions of 72 DEG C；

(3g) is kept the temperature under the conditions of 4 DEG C；

Pcr amplification product is analyzed through 1.0% agarose gel electrophoresis, obtains analysis result.