CN110484455A - A mutant strain of Trichoderma with stable and high phytase production - Google Patents

Abstract

The invention provides a Trichoderma mutant strain with high phytase production and application thereof. The preservation number of the mutant strain is CCTCC NO:M2019405, and the enzyme activity of phytase in the fermentation supernatant of its shake flask reaches 3580u/mL, which is 56.0% higher than that of the starting bacteria; the phytase in the fermentation supernatant of the 20L tank The enzyme activity is as high as 40345u/mL, which is 52.1% higher than that of the starting strain, and unexpected technical effects have been achieved. The application of the mutant strain can further reduce the production cost of phytase, and is conducive to accelerating the wide application of phytase in the field of feed.

Description

A mutant strain of Trichoderma with stable and high phytase production

technical field

The invention belongs to the technical field of microbial engineering transformation, and in particular relates to a stable and high-yield phytase mutant strain of Trichoderma and its application.

Background technique

Phytic acid (phytic acid), also known as myo-inositol (1, 2, 3, 4, 5, 6) hexakisphosphate, is the main form of phosphorus storage in plants, especially abundant in seeds. Seeds such as cereals and pulses are the main raw materials for animal feed. Although phytic acid in seeds can be an important source of phosphorus for feeding animals, only ruminants can metabolize phytic acid to utilize the phosphorus; for nonruminants, phytic acid that cannot be digested and metabolized is considered an antinutrient . The reason why phytic acid is regarded as an anti-nutrient is that phytic acid is rich in negative charges and is easy to chelate with positive ions, such as calcium ions, magnesium ions, zinc ions, manganese ions, copper ions, and iron ions. Further, it forms a complex with protein and starch. This complex not only hinders the digestion and absorption of metal ions, but also affects the action of digestive enzymes and hinders the absorption of nutrients.

Phytase is a general term for a class of enzymes that catalyze the hydrolysis of phytic acid and phytate into inositol and phosphoric acid (or phosphate). Phytase has a special spatial structure, which can sequentially separate phosphorus in phytic acid molecules, degrade phytate into inorganic phosphorus and inositol, and release other nutrients bound by phytate. At present, the effect of feeding monogastric animals with phytase has been verified. After adding phytase to the feed, the amount of inorganic phosphorus can be reduced by 5-70%, and the discharge of phosphorus in manure can be reduced by more than 30-40%. Can effectively reduce environmental pollution. Phytase has been widely used as a feed additive in the field of livestock and poultry farming.

Due to the low yield of phytase in natural strains, the phytase produced by natural strains cannot fully meet the requirements of feed processing and phytase application in terms of thermal stability, protease resistance and other enzymatic properties. Therefore, those skilled in the art generally use genetic engineering technology to transform wild-type phytase to obtain mutant proteins with excellent performance, and construct genetically engineered strains such as Pichia pastoris, Aspergillus niger, and Aspergillus oryzae for the fermentation of phytase Production can greatly improve the enzyme activity level of phytase, which is conducive to promoting the wide application of phytase. At present, it is still one of the most important phytase industry goals to increase the unit expression of phytase production strains and further reduce its production cost.

Contents of the invention

In order to solve the problems in the prior art, the invention provides a Trichoderma reesei strain with stable and high phytase production and application thereof. The bacterial strain can greatly increase the expression level of phytase, which is beneficial to the wide application of phytase.

In order to realize the foregoing invention object, the present invention provides following technical scheme:

One aspect of the present invention provides a Trichoderma reesei engineering bacterium, which carries a recombinant vector expressing a phytase gene.

The amino acid sequence of the phytase is SEQ ID NO:1, and the sequence of its coding gene is SEQ ID NO:2.

The present invention also provides a mutant strain Trichoderma reesei UEphy-6 ( Trichoderma reesei UEphy-6), which has been preserved in the Chinese Type Culture Collection Center of Wuhan University, Wuhan, China on May 29, 2019, with the preservation number CCTCC NO: M2019405.

The invention also provides the application of the mutant strain in the production of phytase.

The phytase production of the mutant strain Trichoderma reesei UEphy-6 obtained by the applicant through multiple rounds of mutagenesis screening has been significantly improved. The enzyme activity of phytase in the fermentation supernatant of Trichoderma reesei UEphy-6 reached 3580u/ml, which was 56.0% higher than that of the starting bacteria; the activity of phytase in the fermentation supernatant of the 20L tank was as high as 40345u/ml, Compared with the starting bacterial strain, it has improved by 52.1%, and has achieved unexpected technical effects. The application of the mutant strain can further reduce the production cost of phytase, and is conducive to accelerating the wide application of phytase in the field of feed.

Description of drawings

Fig. 1 is 20L fermentation tank fermentation curve;

Figure 2 is the SDS-PAGE protein electrophoresis diagram: where: M is the protein molecular weight marker, lanes 1 and 2 are the fermentation supernatants of Trichoderma reesei UEphy-P2 and Trichoderma reesei UEphy-6 respectively, and the arrow points to Phytase Phy.

Detailed ways

The present invention uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENTPROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, the invention is not limited to any particular methodology, protocols and reagents described.

The present invention will be described in detail below in conjunction with specific embodiments.

Embodiment 1: the cloning of phytase gene and the construction of expression vector

According to the codon preference of Trichoderma sp. , the amino acid sequence SED ID NO: 1 of the phytase Phy gene derived from Escherichia coli was codon-optimized, and was provided by General Biosystems (Anhui) Limited The company synthesized its coding nucleotide sequence SED ID NO:2.

Design upstream and downstream primers Phy-F and Phy-R according to the synthesized nucleotide sequence, the sequence is as follows:

Phy-F: GGC TCTAGA CAGTCGGAGCCCGAGCTGAAGC;

Phy-R: ATA ACGCGT TTAGAGCGAGCAGGCGGGAATT.

Using the synthesized nucleotide sequence as a template, the upstream and downstream primers Phy-F and Phy-R were used to amplify, and the PCR amplification product was recovered using a gel recovery kit. The above PCR amplification product was double-digested with restriction endonucleases XbaI and MluI, and the expression vectors pC2G and pC1G were double-digested with XbaI and MluI at the same time, and the double-digestion fragment of the PCR amplification product was double-digested with the expression vector pC2G The product was ligated overnight and introduced into Escherichia coli DH5a. After sequencing verification, the recombinant expression vector pC2G-Phy was obtained. The double-digested fragment of the PCR amplification product was ligated with the expression vector pC1G double-digested product overnight, and introduced into E. coli DH5a, which was verified by sequencing After that, the recombinant expression vector pC1G-Phy was obtained.

Embodiment 2: the construction of the Trichoderma reesei engineering bacterium UEphy that once transforms phytase gene

1. Protoplast preparation

Take the spore suspension of Trichoderma reesei ( Trichoderma reesei ) UE strain, inoculate it on a PDA plate, and culture it at 30°C for 6 days; 0.5% yeast powder, 1% glucose, 0.1% uridine) liquid medium, 30°C, 220 rpm shaking culture for 14~16 h;

Collect the mycelia by filtering with sterile gauze and wash once with sterile water; place the mycelium in a conical flask containing 20 mL of 10 mg/mL lyase solution (Sigma L1412), at 30°C, 90 rpm for 1-2 h; use a microscope to observe and detect the progress of protoplast transformation;

Add pre-cooled 20 mL of 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl ₂ ) into the above Erlenmeyer flask, shake gently, and collect the filtrate by filtering with sterile Miracloth filter cloth, 3000 rpm , centrifuge at 4°C for 10 min; discard the supernatant, add 5 mL of pre-cooled 1.2 M sorbitol solution to suspend the cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-cooled 1.2 M sorbitol suspension (200 μL/tube, the concentration of protoplasts is 10 ⁸ /mL).

2. Expression vector transformation

The following operations were all carried out on ice. Take 10 μg of the recombinant plasmid pC2G-Phy and add it to a 7 mL sterile centrifuge tube containing 200 μL of protoplast solution, and then add 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl , 50 mM CaCl ₂ ), flick the bottom of the tube to mix well, and place on ice for 20 min; add 2 mL of 25% PEG, mix well and place at room temperature for 5 min; add 4 mL of 1.2M sorbitol, mix gently and pour into Melted and maintained at 55°C in the upper medium (0.1% MgSO ₄ , 1% KH ₂ PO ₄ , 0.6% (NH ₄ ) ₂ SO ₄ , 1% glucose, 18.3% sorbitol, 0.35% agarose); light Mix gently and spread on the prepared lower medium plate (2% glucose, 0.5% (NH ₄ ) ₂ SO ₄ , 1.5% KH ₂ PO ₄ , 0.06% MgSO ₄ , 0.06% CaCl ₂ , 1.5% agar) , cultured at 30°C for 5-7 days until transformants grew out, and the grown transformants were picked to the lower medium plate for re-screening, and the strains with smoother colony edges were positive transformants.

3. Fermentation verification and enzyme activity determination

Inoculate the positive transformant obtained from the above re-screening on a PDA solid plate, and incubate it upside down in a constant temperature incubator at 30°C for 6-7 days. After the spores are abundant, take two pieces of mycelia with a diameter of 1cm and inoculate them in a 50mL fermentation medium. (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH ₄ ) ₂ SO ₄ , 0.09% MgSO ₄ , 2% KH ₂ PO ₄ , 0.04% CaCl ₂ , 0.018% Tween-80, 0.018% Trace elements) in a 250mL Erlenmeyer flask, cultured at 30°C for 48 hours, then at 25°C for 48 hours, and the fermentation supernatant was taken for phytase enzyme activity test.

(1) Enzyme activity assay method

Enzyme activity definition: at a temperature of 37°C and a pH of 5.5, 1 μmol/L of inorganic phosphorus is released from a sodium phytate solution with a concentration of 5.0 mmol/L per minute, which is a unit of phytase activity, expressed in U.

Determination method: Accurately weigh 0.6804g of standard potassium dihydrogen phosphate (5.9) baked at 105°C to constant weight in a 100ml volumetric flask, dissolve it with acetic acid buffer (5.1), and dilute to 100ml with a concentration of 50.0mmol/ L. Dilute to different concentrations with acetic acid buffer solution (5.2) according to the ratio in Table 1, and react with the test sample for determination. Take the concentration of inorganic phosphorus as the abscissa, and the absorbance value as the ordinate, and list the linear regression equation (y=ax+b).

The reacted sample was left to stand in a water bath for 10 minutes, centrifuged on a centrifuge (6.7) at 4000r/min for 10 minutes, the supernatant was zeroed with the blank of the standard curve, and the sample blank was measured at a wavelength of 415nm in a spectrophotometer (6.3). (A ₀ ) and the absorbance value of the sample solution (A), AA ₀ is the measured absorbance value. Phytase activity was calculated using the linear regression equation.

Phytase activity was calculated according to the following formula:

U=F×C/(m×30)

In the formula:

U--the activity of phytase in the sample, U/g;

C--enzyme activity calculated by the linear regression equation according to the absorbance value of the actual sample liquid, U;

F - the total dilution factor of the sample solution before reaction;

m--sample mass, g;

30--response time, min.

The results show that the highest enzyme activity of the shake flask fermentation supernatant of the Trichoderma reesei engineered bacterium constructed by the present invention can reach 1970 U/ml. The applicant named the Trichoderma reesei engineering strain with the highest fermentation enzyme activity as Trichoderma reesei UEphy ( Trichoderma reesei UEphy).

The construction of the Trichoderma reesei engineering bacteria UEphy-P2 of embodiment 3 secondary transformation phytase gene

1. Preparation of uracil-deficient host bacteria

1.1 Principle:

5-Fluoroorotic acid can induce the loss of orotate nucleotidyl transferase or orotidine monophosphate decarboxylase in the uracil nucleotide synthesis pathway, so that 5-fluoroorotic acid cannot form toxic substances5 -fluorouracil nucleotides, which confer resistance to 5-fluoroorotic acid, whose pyrimidine nucleotide nutrition can be supplemented by adding uracil to the medium, thus utilizing 5-fluoroorotic acid-induced formation of urine The pyrimidine auxotrophic strain can grow in the medium containing 5-fluoroorotic acid and uracil; while the wild-type strain cannot grow in the medium containing 5-fluoroorotic acid because it does not have resistance to 5-fluoroorotic acid. grown under the culture conditions. Therefore, 5-fluoroorotic acid is commonly used to screen for uracil-deficient mutants.

1.2 Screening method:

Dilute the freshly collected spores of Trichoderma reesei UEphy ( Trichoderma reesei UEphy) to about ¹ ×107 spores/ml with 0.1% Tween-20 solution, and spread them on 1.5g/ml 5-fluoroorotic acid and 1.87g/ml Uridine (uridine nucleoside) basic solid medium (2% glucose, 0.5% (NH ₄ ) ₂ SO ₄ , 1.5% KH ₂ PO ₄ , 0.06% MgSO ₄ , 0.06% CaCl ₂ , 1.5 % agar) plates, spread about 1×10 ⁶ spores on each plate, and culture at 30°C in the dark for 4 days; the strains grown on the above plates were respectively inserted into the basic medium plate and the basic culture medium containing 1.87mg/ml Uridine The strain that only grows on the Uridine-containing plate but does not grow on the Uridine-free minimal medium plate is a uracil-deficient mutant strain, named Trichoderma reesei UEphy-P ( Trichoderma reesei UEphy-P).

2. Protoplast preparation

The method is as in Example 2.

3. Expression vector transformation

The following operations were performed on ice. Take 10 μg of recombinant plasmid pC1G-Phy and add it to a 7mL sterile centrifuge tube containing 200 μL of protoplast solution, then add 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl 2 ), Gently flick the bottom of the tube to mix and place on ice for 20min; add 2mL of 25% PEG, mix well and place at room temperature for 5min; add 4mL of 1.2M sorbitol, mix gently and pour into the upper culture medium that has been melted and kept at 55°C (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose); gently mix and spread on the prepared lower medium plate (2% glucose , 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar), culture at 30°C for 5~7d until transformants grow.

The grown transformants were picked to the lower medium plate for re-screening, and the strains with smoother colony edges were selected and transferred to the PDA plate for cultivation.

4. Fermentation verification and enzyme activity determination

Inoculate the positive transformant obtained from the above re-screening on a PDA solid plate, and incubate it upside down in a constant temperature incubator at 30°C for 6-7 days. After the spores are abundant, take two pieces of mycelia with a diameter of 1cm and inoculate them in a 50mL fermentation medium. (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH ₄ ) ₂ SO ₄ , 0.09% MgSO ₄ , 2% KH ₂ PO ₄ , 0.04% CaCl ₂ , 0.018% Tween-80, 0.018% Trace elements) in a 250mL Erlenmeyer flask, cultured at 30°C for 48 hours, then at 25°C for 48 hours, and the fermentation supernatant was taken for enzyme activity determination. See Example 2 for the enzyme activity assay method.

The results show that the fermented enzyme activity of the Trichoderma reesei engineering strain obtained by secondary transformation of the present invention can reach 2295U/ml, and the applicant named this Trichoderma reesei engineering strain with the highest fermented enzyme activity as Trichoderma reesei UEphy- P2 ( Trichoderma reesei UEphy-P2).

Example 4 UV mutagenesis and screening

The mutations caused by ultraviolet mutagenesis are very random, and the effects of mutations are also random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to carry out multiple rounds of ultraviolet mutagenesis, the workload of screening is relatively large, and there is a possibility that effective positive mutations cannot be obtained. However, because ultraviolet mutagenesis requires simple equipment, low cost, and a large number of mutants can be obtained in a short period of time, it is still a commonly used method of mutagenesis selection.

The applicant used Trichoderma reesei UEphy-P2 as the starting strain, and carried out genetic modification on it by means of ultraviolet mutagenesis to further increase the yield of its phytase.

1. Determine the fatality rate:

Trichoderma reesei engineering bacteria UEphy-P2 was inoculated on a PDA plate and cultured at 30°C for 5-7d. When a large number of spores are produced on the surface of the colony, draw 5ml of sterile water to elute to obtain the spore liquid, resuspend with sterile water after centrifugation, and count with a hemocytometer. Take a 90mm petri dish, add 5ml of diluted spore suspension (concentration is 1×10 ⁷ ), add a rotor and stir on a magnetic stirrer to make the spore liquid in a uniform state. In a sterile ultra-clean workbench, use a UV lamp with a power of 9w to irradiate above a vertical distance of 20cm for 30s, 45s, 60s, 75s, 90s, 105s, and 120s respectively, and take the irradiated spore liquid and dilute 10, 100, 1000 times, take 100ul coated PDA plate, culture at 30°C for 2-3 days and then count, take the unirradiated spore liquid as a control, and calculate the lethal rate. The lethal rate was 95% when irradiated for 90s, and this irradiation time was selected for subsequent mutagenesis experiments.

2. The first round of mutagenesis screening:

Take a 90mm petri dish, add 5ml of diluted spore suspension (concentration is 1×10 ⁷ ), add a rotor and stir on a magnetic stirrer to make the spore liquid in a uniform state. In a sterile ultra-clean workbench, irradiate with a UV lamp with a power of 9w at a vertical distance of 20cm, dilute 1000 times after irradiation for 90s, take 100ul to coat a PDA plate, and incubate at 30°C for 2-3d.

A total of 200 PDA plates were coated and cultured at 30°C for 2-3 days. Each plate grew 30-50 colonies. Firstly, mutants with short branches were screened out by colony morphology. The applicant picked out a total of 85 mutant bacteria with small colony shape, dense hyphae, and short villi around the colony, and put them on the PDA plate respectively, and cultured them at 30° C. for 5-7 days. Bacterial blocks with a size of 2 cm × 2 cm were cut from each transformant, respectively inoculated in 50 ml liquid shake flask medium for fermentation, and cultured at 28° C. for 5 days. After 5 days of culture, the supernatant obtained by centrifuging the bacteria was the crude enzyme solution, and the phytase activity was detected respectively. At the same time, the starting strain Trichoderma reesei engineering strain UEphy-P2 was used as the control group.

The results showed that among the 85 mutant strains obtained by the first round of ultraviolet mutagenesis screening, the enzyme activity of phytase in the fermentation supernatant of none of the mutant strains was higher than that of the original strain; among them, the enzyme activity of 62 mutant strains was the same as The starting bacteria were basically the same, and the enzyme activities of the remaining 23 mutant strains were even lower by 8-13% than the starting bacteria.

The applicant continued to carry out 9 rounds of mutagenesis screening according to the above method, and finally obtained 3 mutant strains whose phytase production was significantly higher than that of the starting strain, which were named Trichoderma reesei UEphy-3, UEphy-4, and UEphy-6 respectively. Among them, the enzyme activity of phytase in the fermentation supernatant of Trichoderma reesei UEphy-6 was the highest, reaching 3580u/ml, which was 56.0% higher than that of the starting bacteria.

Further, the applicant fermented the starting strain Trichoderma reesei UEphy-P2 and the above-mentioned mutant strain Trichoderma reesei UEphy-6 in a 20L tank respectively. The fermentation curve is shown in Figure 1. After 160 hours of fermentation, the bacteria were centrifuged to obtain The supernatant is the crude enzyme solution, which is detected by protein electrophoresis and phytase activity.

The electrophoresis detection results are shown in Figure 2, where the arrow points to the phytase, indicating that both Trichoderma reesei UEphy-P2 and Trichoderma reesei UEphy-6 can effectively express phytase Phy. The results of enzyme activity detection showed that the phytase enzyme activity in the fermentation supernatant of the starting strain Trichoderma reesei UEphy-P2 was 26530u/ml, while the phytase enzyme activity in the fermentation supernatant of the mutant strain Trichoderma reesei UEphy-6 The liveness is as high as 40345u/ml, which is 52.1% higher than that of the starting strain, and unexpected technical effects have been achieved.

The applicant has deposited Trichoderma reesei UEphy-6 ( Trichoderma reesei UEphy-6) in the Chinese Type Culture Collection Center of Wuhan University, Wuhan, China on May 29, 2019, with the deposit number CCTCC NO: M2019405.

sequence listing

<110> Qingdao Weilan Biological Group Co., Ltd.

<120> A mutant strain of Trichoderma with stable and high phytase production

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 410

<212> PRT

<213> Escherichia coli

<400> 1

Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg

1 5 10 15

His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val

20 25 30

Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr

35 40 45

Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln

50 55 60

Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Pro

65 70 75 80

Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr

85 90 95

Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val

100 105 110

His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu

115 120 125

Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile

130 135 140

Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln

145 150 155 160

Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn

165 170 175

Leu Cys Leu Asn Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln

180 185 190

Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr

195 200 205

Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln

210 215 220

Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser

225 230 235 240

His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu

245 250 255

Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu

260 265 270

Asp Leu Ile Met Ala Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala

275 280 285

Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp

290 295 300

Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu

305 310 315 320

Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu

325 330 335

Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu

340 345 350

Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu

355 360 365

Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu

370 375 380

Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val

385 390 395 400

Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu

405 410

<210> 2

<211> 1233

<212>DNA

<213> Escherichia coli

<400> 2

cagtcggagc ccgagctgaa gctggagtcc gtggtcatcg tctcgcgaca cggcgtccgc 60

gccccccacca aggccacgca gctgatgcag gacgtgaccc ccgacgcctg gccgacatgg 120

cccgtcaagc tgggctggct gacgccccgc ggcggcgagc tgattgccta cctgggccac 180

taccagcgac agcgactggt ggccgacggc ctcctggcca agaagggctg cccccagccc 240

ggccaggtgg ccattattgc cgacgtggac gagcgcacgc gaaagacggg cgaggccttc 300

gccgccggcc tggcccccga ctgcgccatt accgtgcaca cgcaggccga cacgtcgtcg 360

cccgaccccc tgttcaaccc cctcaagacg ggcgtgtgcc agctcgacaa cgccaacgtg 420

acggacgcca ttctgtcgcg cgccggcggc agcattgccg acttcacgggg ccaccgacag 480

accgccttcc gagagctgga gcgcgtcctg aacttccccc agtccaacct gtgcctcaac 540

cgagagaagc aggacgagtc gtgctcgctg acccaggccc tgccctcgga attgaaagtg 600

tccgccgaca acgtgtcgct cacgggcgcc gtcagcctgg cctccatgct cacggagatt 660

ttcctcctac aacaggccca gggcatgccc gagcccggct ggggccgcat tacggactcg 720

caccagtgga acaccctcct ctccctgcac aacgcccagt tctacctgtt acaacgaacg 780

cccgaggtgg cccgatcccg cgccacgccc ctcctggacc tcatcatggc cgccctcacg 840

ccccaccccc cccagaagca ggcctacggc gtgacgctcc ccacgtcggt gctcttcatt 900

gccggccacg acaccaacct cgccaacctg ggcggcgccc tagaactgaa ctggaccctc 960

cccggccagc ccgacaacac gccccccggc ggcgagctgg tcttcgagcg atggcgacga 1020

ctgtcggaca actcgcagtg gattcaggtc agcctggtgt tccagaccct ccagcagatg 1080

cgagacaaga cgcccctctc gctgaacacg ccccccggcg aggtcaagct caccctggcc 1140

ggctgcgaag agcgaaacgc ccagggcatg tgctcgctcg ccggcttcac ccagattgtg 1200

aacgaggccc gaattcccgc ctgctcgctc taa 1233

Claims (8)

1. a kind of trichoderma reesei engineered strain, which is characterized in that the trichoderma reesei engineered strain is carried for recombinating table Up to the recombinant plasmid of phytase.

2. trichoderma reesei engineered strain as described in claim 1, which is characterized in that the amino acid sequence of the phytase is SEQ ID NO:1。

3. trichoderma reesei engineered strain as claimed in claim 1 or 2, which is characterized in that the phytase, encoding nucleoside Acid sequence is SEQ ID NO:2.

4. a kind of trichoderma reesei mutant strain, which is characterized in that the trichoderma reesei mutant strain is to described in claim 1 Trichoderma reesei engineered strain carry out ultraviolet mutagenesis after screening obtain.

5. trichoderma reesei mutant strain as claimed in claim 4, which is characterized in that the guarantor of the trichoderma reesei mutant strain Hiding number is CCTCC NO:M2019405.

6. application of the trichoderma reesei engineered strain described in claim 1 in production phytase.

7. application of the trichoderma reesei mutant strain as claimed in claim 4 in production phytase.

8. a kind of method for producing phytase, which is characterized in that the method is using bacterial strain described in claim 1 or 4 Fermenting and producing phytase.