CN110452922A - The method that gene editing is carried out to Pediococcus acidilactici using endogenous CRISPR system - Google Patents
The method that gene editing is carried out to Pediococcus acidilactici using endogenous CRISPR system Download PDFInfo
- Publication number
- CN110452922A CN110452922A CN201910728089.6A CN201910728089A CN110452922A CN 110452922 A CN110452922 A CN 110452922A CN 201910728089 A CN201910728089 A CN 201910728089A CN 110452922 A CN110452922 A CN 110452922A
- Authority
- CN
- China
- Prior art keywords
- pediococcus acidilactici
- pmg36e
- plasmid
- gene
- gene editing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Pediococcus acidilactici gene editing plasmids, its construction method includes: will be containing there are two the mini-CRISPR sequences of repetitive dna sequence and two three type restriction enzyme site Bbs1 to be cloned into shuttle plasmid pMG36E and conversion into Escherichia coli, transformant is obtained, then activated, extracting obtains Pediococcus acidilactici gene editing plasmid pMG36E-C.Also disclose the method that gene knockout, insertion and point mutation are carried out to Pediococcus acidilactici using endogenous CRISPR system, cloned foreign CRISPR nuclease gene is not needed, genome editor quickly efficiently can be carried out to Pediococcus acidilactici by gene editing plasmid, editorial efficiency is conducive to application and promotes up to 90%;The bacterial strain for completing editor only needs 2-3 passage that the knockout plasmid elimination with resistance can be completed, and continuously edits conducive to multiple genes, changes Nutrition and Metabolism approach or insertion novel metabolic pathways, to reach directional transformation.
Description
Technical field
The present invention relates to gene engineering technology fields, in particular to a kind of to utilize endogenous CRISPR system to lactic acid sheet ball
The method that bacterium carries out gene editing, specifically building edit plasmid, electrotransformation editor plasmid to Pediococcus acidilactici and utilize volume
Collect the application method that plasmid pair Pediococcus acidilactici carries out gene editing, genetic modification and lactic acid bacteria especially suitable for lactic acid bacteria
The biosynthesis of metabolite.
Background technique
Pediococcus acidilactici is a kind of important lactic acid bacteria, can convert cream for glucide by bacterial metabolism activity
Acid.Lactic acid is important chemical products, has important application, example in multiple fields such as polymeric material, food, cosmetics, medicine
Lactic acid has very strong anti-corrosive fresh-keeping effect such as in terms of food, can be used in beverage, meat, fruit storage, have adjust pH value,
It is antibacterial, extend the shelf life, season, being kept for the effects of food color;Lactic acid monomer is polymerized to have in terms of polymeric material good
The polylactic acid of good degradability is for production environment-friendly package material.
Pediococcus acidilactici is widely used in feedstuff industry as probiotics.Pediococcus acidilactici is added in feed,
The lactic acid that fermentation generates can effectively increase the flavor of feed, and the feed intake for improving animal promotes its growth, while reducing pH value
Intestinal acidity environment is maintained, the growth and breeding of pathogenic microorganisms is effectively inhibited;Its bacteriocin for being metabolized synthesis shows wider
Antimicrobial spectrum has apparent inhibiting effect to pathogenic bacteria many in enteron aisle;Pediococcus acidilactici be conducive to safeguard animal intestinal tract health and
Microecological balance enhances animal body immune function.
At present it is mostly the direct utilization of thallus and its metabolite to the application of Pediococcus acidilactici, is lost about Pediococcus acidilactici
The research of biography system is less, therefore cannot be transformed according to production purpose to it, such as its unfavorable metabolic pathway is hindered
It is disconnected, or its beneficial metabolic approach is amplified, cause its application by biggish limitation.
Summary of the invention
It is an object of the invention to solve at least the above problems, and provide the advantages of at least will be described later.
It is a still further object of the present invention to provide a kind of Pediococcus acidilactici gene editing plasmids, in Escherichia coli and lactic acid sheet
On the basis of the shuttle plasmid of coccus, Pediococcus acidilactici gene editing plasmid is constructed, cloned foreign CRISPR nuclease is not needed
Gene, by the editing that can carry out genome using endogenous II-A type CRISPR system.
Gene is carried out to Pediococcus acidilactici using endogenous CRISPR system it is a still further object of the present invention to provide a kind of
Method, gene insertion methods and the method for point mutation of knockout are carried out using gene editing plasmid pair Pediococcus acidilactici
Gene knockout, insertion or point mutation etc. make its metabolic pathway that orientation occur and change to carry out genetic modification to Pediococcus acidilactici
Become, to achieve the purpose that beneficial products overexpression and unfavorable product are not expressed.
Gene editing is completed using Pediococcus acidilactici gene editing plasmid it is a still further object of the present invention to provide a kind of
The Pediococcus acidilactici for completing single gene editing is carried out counter-selection by the counter-selection method of Pediococcus acidilactici, is obtained prominent without plasmid
Become bacterial strain, then competence is prepared with it, secondary or more gene editing is carried out, to realize the continuous of Pediococcus acidilactici
Gene editing, screening obtain the more excellent bacterial strain of expression performance.
In order to realize object of the present invention and further advantage, a kind of Pediococcus acidilactici gene editing plasmid is provided,
The construction method of the gene editing plasmid the following steps are included:
It will be containing there are two mini-CRISPR sequence, the lactic acid sheet balls of repetitive dna sequence and two three type restriction enzyme site Bbs1
The shuttle plasmid pMG36E of bacterium carries out digestion respectively, then converts after digestion products enzyme is connected into Escherichia coli, is screened, is obtained
It is transferred to the transformant of pMG36E-C;
The transformant of pMG36E-C is transferred to described in activation, extracting plasmid obtains Pediococcus acidilactici gene editing plasmid
pMG36E-C;
Wherein, the DNA sequence dna is as shown in SEQ ID NO:1.
Preferably, the restriction enzyme site of the mini-CRISPR sequence and pMG36E are Xba1, Pst1.
Preferably, the screening conditions are as follows: by the Escherichia coli comprising mini-CRISPR sequence, pMG36E, be coated on
LB solid medium tablets, 37 DEG C of cultures, picking transformant simultaneously carry out PCR verifying.
The present invention also provides a kind of method for carrying out gene knockout to Pediococcus acidilactici using endogenous CRISPR system, packets
Containing following steps:
Step 1: being that 3 ' end NGG design spacer, and root according to the PAM of Pediococcus acidilactici II-A type CRISPR system intracellular
Homology arm is separately designed according to the quasi- upstream and downstream sequence for knocking out gene, it is any that two homology arms are cloned into claim 1-3
The item pMG36E-C, building knock out plasmid pMG36E-S-LR;
Step 2: the pMG36E-S-LR electricity is gone into competence Pediococcus acidilactici, with the MRS plate containing erythromycin into
Row screening, picking single colonie simultaneously carries out PCR verifying, to obtain gene knockout mutant strain.
The present invention also provides a kind of method for carrying out gene insertion to Pediococcus acidilactici using endogenous CRISPR system, packets
Containing following steps:
Step 1: being that 3 ' end NGG and quasi- insertion point are set according to the PAM of Pediococcus acidilactici II-A type CRISPR system intracellular
Spacer is counted, and according to the upstream and downstream sequence design homology arm of quasi- insertion point, by two homology arms and quasi- insertion
Plasmids Plasmids pMG36E-S-LGR is inserted into gene cloning to any one of the claim 1-3 pMG36E-C, building;
Step 2: the pMG36E-S-LGR electricity being gone into competence Pediococcus acidilactici, with the MRS plate containing erythromycin
It is screened, picking single colonie simultaneously carries out PCR verifying, to obtain gene insertion mutation strain.
The present invention also provides it is a kind of using endogenous CRISPR system to Pediococcus acidilactici carry out point mutation method,
It comprises the steps of:
Step 1: being that 3 ' end NGG and quasi- mutational site are set according to the PAM of Pediococcus acidilactici II-A type CRISPR system intracellular
Spacer is counted, and according to the upstream and downstream sequence design homology arm in quasi- mutational site, by two homology arms and purpose base
Because being cloned into any one of claim 1-3 pMG36E-C, mutant plasmid pMG36E-S-LMR is constructed;
Step 2: the pMG36E-S-LMR electricity being gone into competence Pediococcus acidilactici, with the MRS plate containing erythromycin
It is screened, picking single colonie simultaneously carries out PCR verifying, to obtain point mutation bacterial strain.
Preferably, the preparation method of the competence Pediococcus acidilactici, comprising: following steps: the cream in cryopreservation tube is taken
Sour piece coccus is crossed to MRS solid medium, after picking single colonie, is activated overnight with MRS fluid nutrient medium, is obtained seed liquor;
Seed liquor is forwarded to the MRS fluid nutrient medium culture containing threonine to logarithmic phase, then by bacterium solution with containing sugarcane
The electricity of sugar turns buffer and washs 3-4 time, and uses bacteriolyze enzymatic treatment 20-30min, is then buffered with the electricity containing sucrose and glycerol turn
Liquid suspension cell obtains competence Pediococcus acidilactici.
Preferably, the electricity goes to the condition in competence Pediococcus acidilactici are as follows: electricity turn parameter be 2500V, 25uF,
200 Ω, plasmid concentration 500ng.
The present invention also provides a kind of lactic acid sheets that gene editing is completed using the Pediococcus acidilactici gene editing plasmid
The counter-selection method of coccus, which is characterized in that the gene editing mutant strain that will be completed according to the method, not antibiotic
It crosses and cultivates on MRS solid medium, by 2-3 for secondary culture, picking single colonie carries out PCR verifying, and screening obtains plasmid
The purpose bacterial strain of loss.
The present invention is include at least the following beneficial effects:
The present invention will be contained based on Escherichia coli and shuttle plasmid pMG36E there are two repetitive sequence and two three types
The mini-CRISPR sequence of restriction enzyme site Bbs1 is cloned into the shuttle plasmid pMG36E, constructs Pediococcus acidilactici gene editing
Plasmid pMG36E-C.Gene editing is carried out to Pediococcus acidilactici based on endogenous CRISPR, does not need the Cas base of cloned foreign
Cause operates more simple.
Gene editing is carried out to Pediococcus acidilactici based on endogenous CRISPR, it is prominent by point mutation, deletion mutation or insertion
Become and change its Nutrition and Metabolism approach or be inserted into new metabolic pathway, to reach the mesh for being oriented transformation to Pediococcus acidilactici
, and purpose product or overexpression purpose product are obtained by the microbial fermentation effect of transformation bacterial strain, it can also block
Its unfavorable metabolic pathway is to eliminate the synthesis and secretion of unfavorable metabolite.
The efficiency for carrying out gene editing using the technology is higher compared to traditional homologous recombination, therefore can be when shorter
Interior completion gene editing work, saves time cost, is conducive to the application of the editing technique and promotes.
The bacterial strain that the present invention completes editor only needs two counter-selection can be completed to passage three times, obtains the purpose bacterium of plasmid loss
Strain monoclonal is conducive to the continuous editor for completing multiple genes in the short time, is given birth to carry out secondary gene editing
Producing metabolism performance more has excellent purpose bacterial strain.
Further advantage, target and feature of the invention will be partially reflected by the following instructions, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Detailed description of the invention
Fig. 1 is the map of plasmid pMG36E of the present invention;
Fig. 2 is the map of matter pMG36E-C of the present invention:
Fig. 3 is the electrophoretogram that mini-CRISPR segment of the present invention is cloned into plasmid pMG36E;
Fig. 4 is that plasmid pMG36E-C of the present invention is converted to the electrophoretogram of Pediococcus acidilactici;
Fig. 5 is that the present invention is obtained using the method that editor plasmid pMG36E-C carries out gene knockout to Pediococcus acidilactici
The pure genotype knock-out bacterial strain of pkt missing;
Fig. 6 is the map of present invention insertion plasmid pMG36E-St-LR;
Fig. 7 is that the present invention is obtained using the method that editor plasmid pMG36E-C carries out gene insertion to Pediococcus acidilactici
The pure genotype mutations bacterial strain that pkt gene delection, tkt gene are inserted into;
Fig. 8 is the insertion tkt base that the present invention carries out counter-selection acquisition to the Pediococcus acidilactici genetic engineering bacterium that editor is completed
The bacterial strain that the pure genotype mutations bacterial strain and Emr gene of cause are lost.
Specific embodiment
The present invention is described in further detail below, to enable those skilled in the art's refer to the instruction text being capable of evidence
To implement.
It should be appreciated that such as " having ", "comprising" and " comprising " term used herein are not precluded one or more
The presence or addition of a other elements or combinations thereof.
Embodiment 1
Pediococcus acidilactici edits the construction method of plasmid, comprising the following steps:
A, holding up biological (Wuhan) the company synthesis DNA sequence dna containing there are two of section is GTTTCAGAAGGATGTTAAATCAATAAG
The mini-CRISPR segment of the repetitive sequence of GTTAAGATC and two three type restriction enzyme site Bbs1 are (such as SEQ ID NO:2 institute
Show);
B, mini-CRISPR segment, pMG36E (laboratory preservation, map are as shown in Figure 1) are subjected to digestion (37 respectively
DEG C, 3h), restriction enzyme site Xba1, Pst1;
By above-mentioned digestion products enzyme even conversion to Escherichia coli, it is coated with the LB solid medium containing 400ug/ml erythromycin
Plate, 37 DEG C of cultures, picking transformant simultaneously carry out PCR verifying;Design a pair of pMG36E universal primer 36F/36R (36F:
GGCAATCGTTTCAGCAGAAAAATTC 36R:CGTTTTCAGACTTTGCAAGCTTGC), PCR amplification inspection is carried out with the primer
Survey whether the band containing 300bp, to verify whether mini-CRISPR segment is cloned on plasmid, PCR amplification result such as Fig. 3
Shown, wherein 3# (i.e. the 4th swimming lane from left to right) is the transformant for being successfully transferred to pMG36E-C (map is as shown in Figure 2);
C, activated under 37 DEG C, 180rpm condition of culture with the LB liquid medium containing 400ug/ml erythromycin it is above-mentioned just
True transformant, extracting plasmid obtain Pediococcus acidilactici gene editing plasmid pMG36E-C.
Embodiment 2
The method for preparing competence Pediococcus acidilactici, specifically includes the following steps:
A, the Pediococcus acidilactici in cryopreservation tube is taken to cross to MRS plate, stationary culture for 24 hours, is grown in 37 DEG C of incubators
Picking cultivates 12h in 37 DEG C, 180rpm into 20mL MRS liquid medium after single colonie;
B, 400 μ L culture solutions is taken to be forwarded in the fresh MRS culture solution of 20mL (the D/L- threonines of 600 μ L40mM of addition),
37 DEG C, 180rpm culture about 3h to OD600It is 1.5;
C, 4 DEG C of 1.5mL bacterium solution, 10000rpm centrifugation 5min are taken, supernatant is abandoned, 1mL electricity is added and turns buffer I (sucrose
205.37g/L, three water potassium phosphate 1.86g/L, magnesium chloride hexahydrate 0.20g/L, pH7.5) after suspension thalline, 4 DEG C, 10000rpm from
Heart 5min abandons supernatant, and adding 1mL electricity, to turn buffer I repeated centrifugation primary, removes supernatant.Turn buffer I with 100 μ L electricity to suspend
Thallus, is added the 1mg/mL lysozyme of 10 μ L, and handles 30min in 37 DEG C of water-baths.Then 4 DEG C, 10000rpm centrifugation
5min abandons supernatant, and then plus 1mL electricity turns buffer I suspended centrifugal twice, is eventually adding 500 μ L electricity and turns buffer II (sucrose
171.15g/L, glycerol 10%) suspension cell, every 80 μ L dispenses to obtain Pediococcus acidilactici electricity and turns competence, -80 DEG C of preservations.
Embodiment 3
Editor plasmid pMG36E-C is converted to the method for Pediococcus acidilactici, specifically includes the following steps:
The pMG36E-C of 500ng is added into a 80ul Pediococcus acidilactici competence, electroporated, electricity turns parameter and is
900ul recovery medium is added in 2500V, 25uF, 200 Ω immediately, wherein the recovery medium includes following mass concentration
Component: sucrose 171.15g/L, glucose 20g/L, tryptone 10g/L, yeast extract 4g/L, beef extract 8g/L, acetic acid
Sodium 3g/L, diammonium hydrogen citrate 2g/L, dipotassium hydrogen phosphate 2g/L, epsom salt 0.2g/L, manganese sulfate monohydrate 0.05g/L are spat
Then warm 80l mL/L is incubated for 3h in 37 DEG C, 180rpm, take MRS solid training of the 100ul bacterium solution coating containing 5ug/ml erythromycin
Support base plate, 37 DEG C of cultures;
Multiple transformants are grown after 2 days on plate, transformation efficiency reaches 6*103cfu/ug;10 transformant activation of picking
After, with universal primer 36F/36R a pair of of on pMG36E (36F:GGCAATCGTTTCAGCAGAAAAATTC36R:
CGTTTTCAGACTTTGCAAGCTTGC PCR amplification) is carried out, detects whether the band containing 300bp, verification result such as Fig. 4 institute
Show: the result shows that 10 transformants have been transferred to editor plasmid pMG36E-C.
Embodiment 4
The method that gene knockout is carried out to Pediococcus acidilactici using editor plasmid pMG36E-C, specifically includes the following steps:
A, it using orotic acid phosphoribosynltransferase pyrE as gene to be knocked out, is designed according to 3 ' NGG
AACAACAACTAACTCCTGCCCAGCTAGATT is spacer, it is cloned by BbsI single endonuclease digestion, the method for enzyme even
PMG36E-C, building knock out plasmid pMG36E-Se;
B, using Pediococcus acidilactici genome as template, two pairs of primers are designed, it may be assumed that
E-LF:AACTGCAG GGCTGGGGGGCATGGAC
E-LR:AGTTGCGCCCCATTGGTTTGAACCCCTTTATTTGGATTTC
E-RF:TAAAGGGGTTCAAACCAATGGGGCGCAACTACAAC
E-RR:CCCAAGCTTACCCGCAAAGTAGACTTGTGC,
The upstream and downstream 700bp for expanding pyrE gene by the method for PCR passes through SOE's respectively as left arm, right arm
Method connects the two, is cloned into pMG36E-Se by PstI/HindIII double digestion, the method for enzyme even, building knocks out
Plasmid pMG36E-Se-LR;
C, plasmid pMG36E-Se-LR will be knocked out to convert by method for transformation described in embodiment 3 to Pediococcus acidilactici, is used
MRS plate containing 5ug/ml erythromycin is screened, and picking single colonie simultaneously carries out PCR verifying, designs pyrE base on genome
Because the pair of primers pyrE-F/pyrE-R at left arm right arm both ends (includes the Duan Xu including pyrE gene in amplification gene group
Column), it may be assumed that
PyrE-F:GGACGGGCACTACTTTACTTGTA
PyrE-R:CGGAGCGGGGTGCATGATAA carries out PCR amplification, obtains two items of different sizes
Band, judgement know to obtain mixing genotype strain;
D, above-mentioned mixing genotype strain to be crossed to not antibiotic MRS plate, picking single colonie is crossed again,
17 single colonies of picking activate simultaneously, using primer pyrE-F/pyrE-R and primer pyrE-F2/pyrE-R2 (in amplification gene group
PyrE gene), wherein
PyrE-F:GGACGGGCACTACTTTACTTGTA
PyrE-R:CGGAGCGGGGTGCATGATAA
PyrE-F2:ATGACGGAAACACAAACTCAAGC
PyrE-R2:TTATTTAATTGTTGTAGTTGCGCC,
Carry out PCR verifying, PCR verification result is as shown in Figure 5: 2-19 swimming lane is the PCR of primer pyrE-F/pyrE-R in a
Verification result, 2-11 swimming lane is the PCR verification result that primer is pyrE-F2/pyrE-R2 in 20-26 swimming lane and b in a.Explanation obtains
The 11# single colonie obtained is the pure genotype knock-out bacterial strain of pyrE missing.
Embodiment 5
The method that gene insertion is carried out to Pediococcus acidilactici using editor plasmid pMG36E-C, specifically includes the following steps:
A, it is to be inserted into gene with bacillus coagulans transketolase gene tkt, designs angle of striking to be inserted according to 3 ' NGG
Pkt gene the preceding paragraph ACTTGAACTTGCCTGACTTCCGCCAATACG sequence is spacer, it is passed through BbsI single endonuclease digestion, enzyme
Method even is cloned into pMG36E-C, building insertion plasmid pMG36E-St;
B, using Pediococcus acidilactici genome as template, two pairs of primers are designed, it is non-by the method amplification gene group of PCR one
The upstream and downstream 700bp of encoding loci is connected left arm, tkt gene and right arm by the method for SOE respectively as left arm, right arm
It picks up and, and pMG36E-St, building insertion plasmid pMG36E- are cloned by PstI/HindIII double digestion, the method for enzyme even
St-LR (map is as shown in Figure 6);
C, insertion plasmid pMG36E-St-LR is converted by method for transformation described in embodiment 3 to Pediococcus acidilactici, is used
MRS solid medium tablets containing 5ug/ml erythromycin are screened, picking single colonie, design insertion point on genome
Pkt upstream and downstream pair of primers, it may be assumed that
Pkt knockout-F:GCCGGACGAACGCTCTCTAAC
Pkt knockout-R:TGGCTGAGCCAGCTTTTGATG, carries out PCR amplification, and PCR result is two items of different sizes
Band, judgement are mixing genotype strain;
D, above-mentioned mixing genotype strain to be crossed to not antibiotic MRS plate, picking single colonie is crossed again,
7 single colonies of picking activate and utilize primer tkt-F/tkt-R, it may be assumed that
Tkt-F:CCTTAATTAA CCCCTTCAGCTTGAGCTC,
Tkt-R:TGGCTGAGCCAGCTTTTGATG
And primer pkt-F2/pkt-R2,
Pkt-F2:ATGACAGACTATTCATCTAAAGCTT
Pkt-R2:TTATTTAACGTCTTTCCATACCC carries out PCR verifying, shown in result figure 7: 4# single bacterium
It falls as the pure genotype mutations bacterial strain of pkt gene delection, the insertion of tkt gene.
Embodiment 6
The method that gene mutation is carried out to Pediococcus acidilactici using editor plasmid pMG36E-C, specifically includes the following steps:
It A, is to be designed to mutated gene according to 3 ' NGG with L-type lactic acid dehydrogenase gene L-LDH
AATCATCAACAAGAAGGGTGCTACATTCTA is spacer, it is cloned by BbsI single endonuclease digestion, the method for enzyme even
PMG36E-C constructs mutant plasmid pMG36E-Sldh;
B, using Pediococcus acidilactici genome as template, two pairs of primers are designed, pass through L- in the method amplification gene group of PCR
The upstream and downstream 700bp of LDH gene is respectively as left arm, right arm, by the method for SOE by left arm, target gene LDH2 and the right side
Arm connects, and is cloned into pMG36E-Sldh by digestion, the method for enzyme even, constructs mutant plasmid pMG36E-Sldh-LR;
C, mutant plasmid pMG36E-Sldh-LR is converted by method for transformation described in embodiment 3 to Pediococcus acidilactici,
It is screened with the MRS plate containing 5ug/ml erythromycin, picking single colonie.
D, it chooses above-mentioned single colonie to cross to not antibiotic MRS plate, picking single colonie is crossed again, picking 10
A single colonie activation simultaneously carries out PCR amplification and sequencing to LDH gene, wherein having 1 single colonie is to be mutated to mutated gene L-LDH
For the mutant strain of LDH2.
Embodiment 7
To the method that the Pediococcus acidilactici genetic engineering bacterium that editor is completed carries out counter-selection, specifically includes the following steps:
The mixing genotype Pediococcus acidilactici of pkt gene knockout will be completed in the not antibiotic flat lining out of MRS
Secondary culture is carried out, is repeated the process 2 times, single colonie 21 on picking plate utilize primer Emr-F:
AGTTTATGCATCCCTTAACTTA, Emr-R:TCGACCCATATTTAAAAAGC expand the Emr gene on plasmid, PCR amplification
As a result as shown in Figure 8: 17# single colonie is the pure genotype mutations bacterial strain of pkt gene knockout, and Emr gene is lost, i.e. generation matter
Grain is lost.
Although the embodiments of the present invention have been disclosed as above, but its is not only in the description and the implementation listed
With it can be fully applied to various fields suitable for the present invention, for those skilled in the art, can be easily
Realize other modification, therefore without departing from the general concept defined in the claims and the equivalent scope, the present invention is simultaneously unlimited
In specific details and shown here as with attached drawing.
Sequence table
<110>Hua Zhong Agriculture University
<120>method that gene editing is carried out to Pediococcus acidilactici using endogenous CRISPR system
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtttcagaag gatgttaaat caataaggtt aagatc 36
<210> 2
<211> 194
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gtttcagaag gatgttaaat caataaggtt aagatcaggt cttcgacgtc gaagacctgt 60
ttcagaagga tgttaaatca ataaggttaa gatctgagag catcaaaaaa gaggagccgt 120
cccattaagg gtcggttcct ctttcactat gtaatgccca gatagctggg acaaatggat 180
aaactccgca caaa 194
<210> 3
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ggcaatcgtt tcagcagaaa aattc 25
<210> 4
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgttttcaga ctttgcaagc ttgc 24
<210> 5
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aactgcaggg ctggggggca tggac 25
<210> 6
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
agttgcgccc cattggtttg aaccccttta tttggatttc 40
<210> 7
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
taaaggggtt caaaccaatg gggcgcaact acaac 35
<210> 8
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cccaagctta cccgcaaagt agacttgtgc 30
<210> 9
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ggacgggcac tactttactt gta 23
<210> 10
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cggagcgggg tgcatgataa 20
<210> 11
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
atgacggaaa cacaaactca agc 23
<210> 12
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
ttatttaatt gttgtagttg cgcc 24
<210> 13
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
gccggacgaa cgctctctaa c 21
<210> 14
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
tggctgagcc agcttttgat g 21
<210> 15
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
ccttaattaa ccccttcagc ttgagctc 28
<210> 16
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
tggctgagcc agcttttgat g 21
<210> 17
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
atgacagact attcatctaa agctt 25
<210> 18
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
ttatttaacg tctttccata ccc 23
<210> 19
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
agtttatgca tcccttaact ta 22
<210> 20
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
tcgacccata tttaaaaagc 20
Claims (9)
1. a kind of Pediococcus acidilactici gene editing plasmid, which is characterized in that the construction method of the gene editing plasmid include with
Lower step:
It will be containing there are two the mini-CRISPR sequences of repetitive dna sequence and two three type restriction enzyme site Bbs1, Pediococcus acidilactici
Shuttle plasmid pMG36E carries out digestion respectively, then converts after digestion products enzyme is connected into Escherichia coli, and through screening, acquisition is transferred to
The transformant of pMG36E-C;
The transformant of pMG36E-C is transferred to described in activation, extracting plasmid obtains Pediococcus acidilactici gene editing plasmid pMG36E-C;
Wherein, the DNA sequence dna is as shown in SEQ ID NO:1.
2. Pediococcus acidilactici gene editing plasmid as described in claim 1, which is characterized in that the mini-CRISPR sequence
And the restriction enzyme site of pMG36E is Xba1, Pst1.
3. Pediococcus acidilactici gene editing plasmid as described in claim 1, which is characterized in that the screening conditions are as follows: will wrap
The Escherichia coli of sequence containing mini-CRISPR, pMG36E are coated on LB solid medium tablets, 37 DEG C of cultures, picking transformant
And carry out PCR verifying.
4. a kind of method for carrying out gene knockout to Pediococcus acidilactici using endogenous CRISPR system, which is characterized in that include
Following steps:
Step 1: being 3 ' end NGG design spacer according to the PAM of Pediococcus acidilactici II-A type CRISPR system intracellular, and according to quasi-
The upstream and downstream sequence for knocking out gene separately designs homology arm, and two homology arms are cloned into any one of claim 1-3 institute
PMG36E-C is stated, building knocks out plasmid pMG36E-S-LR;
Step 2: the pMG36E-S-LR electricity being gone into competence Pediococcus acidilactici, is sieved with the MRS plate containing erythromycin
Choosing, picking single colonie simultaneously carries out PCR verifying, to obtain gene knockout mutant strain.
5. a kind of method for carrying out gene insertion to Pediococcus acidilactici using endogenous CRISPR system, which is characterized in that include
Following steps:
Step 1: being that 3 ' end NGG and quasi- insertion point design according to the PAM of Pediococcus acidilactici II-A type CRISPR system intracellular
Spacer, and according to the upstream and downstream sequence design homology arm of quasi- insertion point, by two homology arms and quasi- insertion base
Because being cloned into any one of claim 1-3 pMG36E-C, building insertion plasmids Plasmids pMG36E-S-LGR;
Step 2: the pMG36E-S-LGR electricity being gone into competence Pediococcus acidilactici, is carried out with the MRS plate containing erythromycin
Screening, picking single colonie simultaneously carries out PCR verifying, to obtain gene insertion mutation strain.
6. a kind of method for carrying out point mutation to Pediococcus acidilactici using endogenous CRISPR system, which is characterized in that packet
Containing following steps:
Step 1: being that 3 ' end NGG and quasi- mutational site are designed according to the PAM of Pediococcus acidilactici II-A type CRISPR system intracellular
Spacer, and according to the upstream and downstream sequence design homology arm in quasi- mutational site, by two homology arms and target gene
It is cloned into any one of claim 1-3 pMG36E-C, constructs mutant plasmid pMG36E-S-LMR;
Step 2: the pMG36E-S-LMR electricity being gone into competence Pediococcus acidilactici, is carried out with the MRS plate containing erythromycin
Screening, picking single colonie simultaneously carries out PCR verifying, to obtain point mutation bacterial strain.
7. the method as described in claim 4,5 or 6, which is characterized in that the preparation method of the competence Pediococcus acidilactici, packet
It includes following steps: the lactobacillus in cryopreservation tube being taken to cross to MRS solid medium, after picking single colonie, with MRS fluid nutrient medium
It is activated overnight, obtains seed liquor;
Seed liquor is forwarded to the MRS fluid nutrient medium culture containing threonine to logarithmic phase, then by bacterium solution with containing sucrose
Electricity turns buffer and washs 3-4 time, and with bacteriolyze enzymatic treatment 20-30min, then turns buffer with the electricity containing sucrose and glycerol and hangs
Floating cell, obtains competence Pediococcus acidilactici.
8. the method as described in claim 4,5 or 6, which is characterized in that the electricity goes to the item in competence Pediococcus acidilactici
Part are as follows: it is 2500V, 25uF, 200 Ω, plasmid concentration 500ng that electricity, which turns parameter,.
9. a kind of Pediococcus acidilactici for completing gene editing using Pediococcus acidilactici gene editing plasmid described in claim 1
Counter-selection method, which is characterized in that the gene editing mutant strain that will be completed according to the described in any item methods of claim 4-6, In
It crosses and cultivates on not antibiotic MRS solid medium, by 2-3 for secondary culture, picking single colonie carries out PCR verifying,
Screening obtains the purpose bacterial strain of plasmid loss.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910728089.6A CN110452922B (en) | 2019-08-08 | 2019-08-08 | Method for gene editing of pediococcus acidilactici by using endogenous CRISPR system |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910728089.6A CN110452922B (en) | 2019-08-08 | 2019-08-08 | Method for gene editing of pediococcus acidilactici by using endogenous CRISPR system |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110452922A true CN110452922A (en) | 2019-11-15 |
CN110452922B CN110452922B (en) | 2021-03-26 |
Family
ID=68485329
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910728089.6A Active CN110452922B (en) | 2019-08-08 | 2019-08-08 | Method for gene editing of pediococcus acidilactici by using endogenous CRISPR system |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110452922B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115044600A (en) * | 2022-05-17 | 2022-09-13 | 华中农业大学 | CRISPR polygene editing method based on lactobacillus reuteri |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2016033298A1 (en) * | 2014-08-28 | 2016-03-03 | North Carolina State University | Novel cas9 proteins and guiding features for dna targeting and genome editing |
CN105821071A (en) * | 2015-01-06 | 2016-08-03 | 华东理工大学 | Unmarked gene knock-out method of pediococcus acidilactici DQ2 based on homologous recombination |
CN107574179A (en) * | 2016-09-09 | 2018-01-12 | 康码(上海)生物科技有限公司 | A kind of CRISPR/Cas9 high efficiency gene editing systems for kluyveromyces optimization |
-
2019
- 2019-08-08 CN CN201910728089.6A patent/CN110452922B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2016033298A1 (en) * | 2014-08-28 | 2016-03-03 | North Carolina State University | Novel cas9 proteins and guiding features for dna targeting and genome editing |
CN105821071A (en) * | 2015-01-06 | 2016-08-03 | 华东理工大学 | Unmarked gene knock-out method of pediococcus acidilactici DQ2 based on homologous recombination |
CN107574179A (en) * | 2016-09-09 | 2018-01-12 | 康码(上海)生物科技有限公司 | A kind of CRISPR/Cas9 high efficiency gene editing systems for kluyveromyces optimization |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115044600A (en) * | 2022-05-17 | 2022-09-13 | 华中农业大学 | CRISPR polygene editing method based on lactobacillus reuteri |
CN115044600B (en) * | 2022-05-17 | 2024-02-09 | 华中农业大学 | CRISPR multi-gene editing method based on lactobacillus reuteri |
Also Published As
Publication number | Publication date |
---|---|
CN110452922B (en) | 2021-03-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106399196B (en) | One lactobacillus plantarum HEW-A490 and its application | |
CN110468092A (en) | The genetic engineering bacterium and its construction method of one plant height production Valine and application | |
CN109735556A (en) | The purposes of Priming Glycosyltransferase Gene Involved | |
CN110241061A (en) | Improve the method and its application of Lactobacillus brevis γ-aminobutyric acid synthesis capability | |
CN107172883A (en) | The preparation method of citrulling | |
CN108641979B (en) | Enterococcus faecium, high-density fermentation culture method thereof and microecological preparation prepared from enterococcus faecium | |
CN101880696A (en) | Method for producing L-lactic acid by fermentation and bacterial strain using same | |
CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
CN107354119A (en) | A kind of genetic engineering bacterium of high yield hyaluronic acid and its construction method and application | |
CN102061272B (en) | Lactobacillus salivarius SIL1 and application thereof | |
US8741622B2 (en) | Stress tolerant Bifidobacteria | |
CN111417714A (en) | Nutritional compositions and methods relating thereto | |
BR112020004575A2 (en) | polynucleotide, vector, microorganism of the genus corynebacterium, methods for producing target substance and for preparing a fermented composition, and fermented composition. | |
CN106520802A (en) | GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof | |
CN107177522A (en) | One plant height activity forage plant lactobacillus and its cultural method and application | |
CN107881140A (en) | The Leuconostoc mesenteroides mutant strain of one plant height production mannitol and its application process | |
CN110452922A (en) | The method that gene editing is carried out to Pediococcus acidilactici using endogenous CRISPR system | |
CN107619817A (en) | Produce 3 dehydroshikimate E. coli recombinant stains and its construction method and application | |
CN106754555A (en) | One plant of Leuconostoc mesenteroides mutant strain for producing mannitol and its application process | |
CN105802871B (en) | Lactobacillus group and application thereof in preparation of straw feed | |
CN105524158B (en) | A kind of fly maggot antibacterial peptide, encoding gene, carrier, engineering bacteria and its application | |
CN108373985A (en) | The bacillus amyloliquefaciens engineering bacteria of one high-efficiency degradation caffeine and application | |
CN104480056B (en) | A kind of genetic engineering bacterium of high-yield extracellular polysaccharide and its preparation method and application | |
CN102199644B (en) | Genetic engineering preparation method of cytidine triphosphate | |
CN109329648B (en) | Application of compound microecological preparation for antagonizing vibrio prawn |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |