CN102061272B - Lactobacillus salivarius SIL1 and application thereof - Google Patents
Lactobacillus salivarius SIL1 and application thereof Download PDFInfo
- Publication number
- CN102061272B CN102061272B CN2010105234341A CN201010523434A CN102061272B CN 102061272 B CN102061272 B CN 102061272B CN 2010105234341 A CN2010105234341 A CN 2010105234341A CN 201010523434 A CN201010523434 A CN 201010523434A CN 102061272 B CN102061272 B CN 102061272B
- Authority
- CN
- China
- Prior art keywords
- sil1
- lactobacillus salivarius
- bacterial strain
- intestinal
- animal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses porcine source lactobacillus salivarius SIL1 and application thereof and belongs to the technical field of microorganisms. The lactobacillus salivarius SIL1 has high tolerance to acid, cholate and temperature, can tolerate culture solution with pH3 and cholate content of 6 grams per liter and can grow in simulated gastrointestinal juice. After the lactobacillus salivarius SIL1 is treated at the temperature of 60 DEG C for 30 minutes, the growth of strains is not influenced. The lactobacillus salivarius SIL1 has 100 percent of bacteriostatic effect on in vitro cocultureEscherichia coli and salmonella, can be colonized into animal intestinal canals, and has functions of adjusting the distribution of animal intestinal flora and promoting animal growth.
Description
One, technical field
The present invention relates generally to microbial technology field, be specifically related to a kind of novel probiotic lactobacillus salivarius strains SIL1 (
Lactobacillus salivarius) and use.
Two, background technology
One deck mikrobe or mikrobe layer are arranged in the animal intestinal usually, under normal circumstances are animal when being in healthy state, the unusual or pathogenic phenomena of performance, and this one deck mikrobe is called enteric microorganism.It is an indispensable integral part in the animal gastrointestinal tract, is useful and harmless to the host animal overwhelming majority.A large amount of evidences of using the experimental animal of aseptic or antibiotic treatment to do; Because the mikrobe that existed of enteron aisle competes the attachment sites on the intestines mucosa with the pathogenic bacteria of intrusion, thus normal intestinal flora can the external pathogenic bacterium of competitive exclusion in the field planting of enteron aisle.
Milk-acid bacteria is one of intravital useful microbe of animal, is the normal field planting flora of animal intestinal, and its field planting and suppresses the adhesion of other pathogenic bacteria on intestinal epithelial cell.In more than 400 kind of anaerobism of gi tract or aerobic microbiological, milk-acid bacteria accounts for 10%.The research performance is compared with the diarrhea pig, and normal piglets enteron aisle intestinal bacteria quantity obviously descends, and the lactobacillus spp number improves greatly; Inoculate piglet with lactobacillus spp, intestinal bacteria quantity obviously reduces than control group in its intestinal tissue homogenate, and lactobacillus spp quantity improves greatly.The antifungal mechanism of milk-acid bacteria mainly is through the interaction between self and meta-bolites and other mikrobe, adjusts the relation between the flora, thereby keeps the relatively stable of micropopulation optimal vigor combination in the micro-ecological environment and this combination.In addition, milk-acid bacteria is prone to combine with intestinal epithelial cell, plays the occupy-place effect, and harmful bacterium is had the barrier elimination ability.
Based on the plurality of advantages of milk-acid bacteria, it has become the vast research focus of being engaged in area research personnel such as lactobacillus food additive, probiotics exploitation, fodder industry.Wherein on fodder industry, milk-acid bacteria is normal processes probiotics together with other probiotic bacteriums and is used for feed, promotes particularly growing of young animal of livestock and poultry, the minimizing M & M.But the maximum shortcoming of milk-acid bacteria is exactly that vitality is very fragile at present, can't be stored for a long time.Discover that milk-acid bacteria must could produce effect at the enteron aisle privileged site.And the erosion of natural milk-acid bacteria non-refractory, hydrochloric acid in gastric juice and cholate; Most lactic acid bacteria can be dead behind feed granulating; Be difficult to play a role through the gastric environment enteron aisle that arrives safe and sound; Also can't be adsorbed on the appropriate location of intestinal mucosa, the result can only be along with ight soil excretes, and has produced not any effect.Given this; The separation of the lactobacillus strain of strong tolerance and screen extremely urgent; This not only is related to the Sustainable development of breeding green livestock and poultry industry and the safety in production of animal product, also is that healthy living, protection breeding ecological environment and the China that guarantees numerous people gets into the inevitable choice that WTO takes part in international competition.
Three, summary of the invention
Technical problem
To the weak point that exists in the prior art, the present invention provides a boar source lactobacillus salivarius, and acid, cholate and temperature are had good tolerability, can in simulated gastric intestinal juice, grow; Handle 30min, do not influence the growth of bacterial strain for 60 ℃; External intestinal bacteria of cultivating altogether and Salmonellas are had 100% fungistatic effect, can be in the animal intestinal field planting, have and regulate that microbial population of animal intestinal tract distributes and the function of promotion growth of animal.
Technical scheme
For reaching above purpose, realize through following technical scheme:
One strain lactobacillus salivarius strains is provided, derives from weanling pig, the preservation name is called: lactobacillus salivarius (
Lactobacillus salivarius) SIL1, depositary institution: Chinese typical culture collection center, address: Lopa Nationality an ancient woman's ornament mountain, wuchang, wuhan district Wuhan University, preservation date: on October 26th, 2010, preserving number: CCTCC M2010281.
This bacterial strain Gram-positive, the spherical in shape or oval of microscopically, paired or short chain shape, no gemma, atrichia; On the MC flat board, grow, can form pink colour, the mellow and full small colonies of smooth surface, neat in edge has molten calcium circle; In the MRS liquid nutrient medium, be even muddy growth, put the thalline deposition that is white in color for a long time.35~38 ℃ of optimum growth temperatures, appropriate pH are 5.0~7.0, can in 5% sodium-chlor meat soup, grow.Can utilize sucrose, trehalose, fructose, lactose, semi-lactosi, glucose, SANMALT-S, N.F,USP MANNITOL, seminose, saligenin, amygdaloside; Can not utilize pectinose, cellobiose, melizitose, raffinose, rhamnosyl, ribose, wood sugar, sorbyl alcohol.Catalase, oxidase negative do not reduce nitrate salt, not liquefy gelatin.
Lactobacillus salivarius of the present invention (
Lactobacillus salivarius) the SIL1 strain can be used to regulate microbial population of animal intestinal tract, promotes growth of animal.
Beneficial effect
SIL1 of the present invention through 16S rRNA be accredited as lactobacillus salivarius (
Lactobacillus salivarius).
Resistance is tested and is shown, lactobacillus salivarius of the present invention (
Lactobacillus salivarius) SIL1 has certain acidproof, bile tolerance ability, grow in the nutrient solution that can be 6g/L at nutrient solution and the cholate content of pH3; Can in simulated gastric intestinal juice, grow; Handle 30min, do not influence its growth for 60 ℃.
Extracorporeal bacteria inhibitor test shows that the SIL1 bacterial strain all reaches 100% to the Escherichia coli O 157 of co-cultivation 24h and the bacteriostasis rate of Salmonellas.
The mouse application test proves, lactobacillus salivarius of the present invention (
Lactobacillus salivarius) the SIL1 strain intestinal microflora that can regulate the alteration of intestinal flora mouse distributes, can be in the mouse intestinal field planting, the growth of mouse is had promoter action.
Four, description of drawings
Fig. 1, lactobacillus salivarius (
Lactobacillus salivarius) growth curve of SIL1;
Fig. 2, pcr amplification product lactobacillus salivarius (
Lactobacillus salivarius) SIL1 16s rRNA gene fragment electrophorogram
M:DNA Marker DL5000; The 1:SIL1 bacterial strain
Fig. 3, double digestion identify lactobacillus salivarius (
Lactobacillus salivarius) SIL1 16s rRNA gene fragment electrophorogram
M:DNA Marker DL2000; The 1:SIL1 bacterial strain
Fig. 4, SIL1 are to the influence of stool in mice flora
1:6 day normal control group; 2:6 day model group; 3:11 day normal control group; 4:11 day natural recovering group
5:11 day bacterial strain treatment group; 6:16 day normal control group; 7:16 day natural recovering group; 8:16 day bacterial strain treatment group
Fig. 5 SIL1 is to the influence of stool in mice flora
1,2:21 day normal control group; 3,4,5:21 day natural recovering group; 6,7,8:21 day bacterial strain treatment group
Five, embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.
Embodiment one: the separation of bacterial strain
MC nutrient agar: soy peptone 5g, beef extract 5g, yeast extract 5g, glucose 20g, lactose 20g, lime carbonate 10g, agar 15g, 1% neutral red solution 5ml, zero(ppm) water 1000ml, 6,121 ℃ of sterilizations of pH value 15min.
MRS liquid nutrient medium: peptone 10g, Carnis Bovis seu Bubali cream 10g, yeast extract paste 5g, diammonium hydrogen citrate 2g, glucose 20g; Tween-80 lml, sodium acetate 5g, potassium hydrogenphosphate 2g, sal epsom 0.58g; Manganous sulfate 0.25g, zero(ppm) water 1000ml, 6.2~6.4,121 ℃ of sterilizations of pH value 15min.
The healthy weanling pig of 27 ages in days, kind is the Su Zhong pig, derives from six directions animal experiment base, academy of agricultural sciences, Jiangsu Province.The heart bloodletting, the aseptic ileal contents 1g that takes is in the test tube that fills the 5ml sterile saline; Mixing 10min gets supernatant and lines the MC flat board, behind 37 ℃ of constant temperature culture 24~48h; The picking redness has the bacterium colony of molten calcium circle; Inoculation screening repeatedly is until obtaining uniform single bacterium colony, called after SIL1.
Gram stain microscopy: bacterial strain SIL1 is G
+, the spherical in shape or oval of microscopically, paired or short chain shape, no gemma, atrichia; On the MC flat board, grow, can form pink colour, the mellow and full tip-like small colonies of smooth surface, neat in edge has molten calcium circle; In the MRS liquid nutrient medium, be even muddy growth, put the thalline deposition that is white in color for a long time.
Embodiment two: the physics and chemistry of bacterial strain and cultural characters
1, bacterial strain SIL1 can utilize sucrose, trehalose, fructose, lactose, semi-lactosi, glucose, SANMALT-S, N.F,USP MANNITOL, seminose, saligenin, amygdaloside; Can not utilize pectinose, cellobiose, melizitose, raffinose, rhamnosyl, ribose, wood sugar, sorbyl alcohol.Catalase, oxidase negative do not reduce nitrate salt, not liquefy gelatin.35~38 ℃ of bacterial strain SIL1 optimum growth temperatures, appropriate pH are 5.0~7.0, can in 5% sodium-chlor meat soup, grow.
2, the mensuration of growth curve
With activatory SIL1 bacterium liquid with 2 % (about 10
6Cfu/mL) inoculum size is inoculated in the MRS liquid nutrient medium, and 37 ℃, 160rpm cultivates 30h, and is every at a distance from the 2h sampling, under 600nm, measures light absorption value, draws growth curve chart.The result shows that SIL1 cultivates 2h and promptly gets into logarithmic phase, and 14h gets into stationary phase.
Embodiment three: the nucleic acid of bacterial strain is identified
1, primer:
According to the gene order of the milk-acid bacteria 16S rRNA that logins among the GenBank, with reference to its 368-1049 position gene fragment, the design primer:
F?5’-TCGGCTCGTAAAACTCTG-3’;
R5’-?GGACTTAACCCAACATCTCA?-3’。
Primer is synthetic by Invitrogen company, and amplified fragments is V3-V7, long 682bp.
2,16s rRNA gene sequencing:
Picking list bacterium colony is put in the centrifuge tube, and it is resuspended to add 50 L sterile distilled waters, boiling water bath 2min, and 12000r/min, 5min promptly contains 16S rRNA gene in the supernatant.The pcr amplification system is 50 L systems, 93 ℃ of preparatory sex change 3min; 94 ℃ of 45s, 55 ℃ of 1min, 72 ℃ of 1.5min, 30 circulations; 72 ℃ are extended 10min.The PCR product reclaims the back and is connected with the pMD18-T carrier, through ammonia benzyl resistance and the screening of blue hickie,
BamH I with
HinD III double digestion identifies that positive plasmid is checked order by Invitrogen company.
3, result
Analyze the PCR product with 1.2% agarose gel electrophoresis, occur specificity purpose band at the 682bp place, be consistent with the expection size (Fig. 1).With BamH I and Hind III the bacterial clone plasmid is carried out double digestion and identify, fragment be consistent with theoretical size (Fig. 2).The standard sequence of having delivered among sequencing result and the GenBank carry out homology draw after relatively the SIL1 bacterial strain be lactobacillus salivarius (
Lactobacillus salivarius), homology is 99%.
Embodiment four: the resistance research of bacterial strain
1, acidproof, bile tolerance test
With activatory SIL1 bacterium liquid with 2 % (about 10
6Cfu/mL) it is in 3,4,5,6 the MRS liquid nutrient medium that inoculum size is inoculated in pH respectively, and gallbladder salinity is in the liquid nutrient medium of 0g/L, 3g/L, 6g/L, establishes 3 repetitions for every group, and 37 ℃, 160r/min cultivates 8h, and the OD that respectively organizes bacterium liquid is surveyed in sampling
600nmValue.
2, temperature sensitive test
With activatory SIL1 bacterium liquid with 2 % (about 10
6Cfu/mL) inoculum size is inoculated in respectively in the 5 pipe MRS liquid nutrient mediums, and every pipe is established 3 repetitions, and behind 45 ℃, 50 ℃, 55 ℃, 60 ℃ processing 30 min, 37 ℃, 160r/min cultivates 8 h, and the OD that respectively organizes bacterium liquid is surveyed in sampling
600nmValue.
3, gi tract resistance test
The MRS liquid nutrient medium is added NaCl 5 g/L, adjust pH to 3.0,121 ℃ of sterilization 15 min, aseptic interpolation stomach en-5 g/L process SGF.The MRS liquid nutrient medium is added pig cholate 3 g/L, NaCl 5 g/L, adjust pH to 8.0,121 ℃ of sterilization 15 min, aseptic interpolation trypsinase l0 g/L processes simulated intestinal fluid.With activatory SIL1 bacterium liquid with 2 % (about 10
6Cfu/mL) inoculum size is linked into respectively in MRS liquid nutrient medium (contrast) and the simulated gastric intestinal juice, establishes 3 repetitions for every group, and 37 ℃, 200 r/min cultivate 12 h, and the OD that respectively organizes bacterium liquid is surveyed in sampling
600nmValue.
5, result
From the result; Along with the reduction of medium pH value and the rising of cholate content; The corresponding reduction of the speed of growth of bacterial strain, but the pH value be 3 nutrient solution and cholate content be 6g/L nutrient solution in still can grow, explain that this strain bacterium has certain acidproof, bile tolerance ability; In addition, bacterial strain also has certain resistibility to stomach en-and trypsinase, can in simulated gastric intestinal juice, grow; From table, can find out, along with the rising of bacterial strain treatment temp (45 ℃ ~ 60 ℃), its OD
600nmBe worth on a declining curvely, but 60 ℃ handled 30min, do not influence the growth of bacterial strain.
Table 1 is respectively organized the OD of bacterium liquid
600nmMV
Embodiment five: the extracorporeal bacteria inhibitor test of bacterial strain
With activatory SIL1, Escherichia coli O 157 and Salmonellas bacterium liquid, respectively with 2% (about 10
6Cfu/mL) inoculum size is inoculated in the 10ml MRS liquid nutrient medium simultaneously, substitutes SIL1 with sterile saline in addition, in kind inoculates the MRS liquid nutrient medium as positive control with Escherichia coli O 157 and Salmonellas bacterium liquid.Establish 3 repetitions for every group, 37 ℃, 200r/min cultivates 24h.Adopt dull and stereotyped viable bacteria counting method, Mai Kangkai is dull and stereotyped in the sampling coating, and 37 ℃ are spent the night; Red bacterium colony is intestinal bacteria; All the other are Salmonellas, and record intestinal bacteria and Salmonellas bacterium colony MV calculate the inhibiting rate of each test strain to Escherichia coli O 157 and Salmonellas.
The result shows; The SIL1 bacterial strain all reaches 100% to the Escherichia coli O 157 of co-cultivation 24h and the bacteriostasis rate of Salmonellas; Explain that this bacterial strain can keep its advantage state in environment through the metabolism of self, Escherichia coli O 157 and the Salmonellas that is in the same environment had antagonistic action.
Embodiment six: bacterial strain is to the influence of alteration of intestinal flora mouse intestinal flora and growth performance
1, test organisms liquid preparation
With the MRS liquid culture of SIL1 bacterial strain, the centrifugal 10min of 3000rpm, bacterial sediment is resuspended in the sterile saline, and being condensed into the bacterium number is 5 * 10
10The bacteria suspension of cfu/ml.
2, experimental animal and grouping
30 of female ICR small white mouses, 18-20g, the conventional raising.20 of picked at random, every mornings 9, : 00 irritated gastric hydrochloric acid lincomycin 0.2mL (20mg)/only; In addition 10 the same time of every day is irritated stomach equivalent sterile saline as the normal control group, continuous 5 days, preparation alteration of intestinal flora mouse model.The 6th day (model prepares successfully), with 20 alteration of intestinal flora mouse, be divided into 2 groups at random, one group 10 as SIL1 bacterial strain treatment group, and every mornings 9, : 00 only irritated stomach bacteria suspension 0.2 ml/; In addition 10 as natural recovering group, and with normal control group same treatment, the same time of every day is irritated stomach equivalent sterile saline, continuous 15 days.21 days whole test phases, the growth and the defecation situation of observing small white mouse every day.: 00 collected excrement appearance respectively at the 6th, 11,16,21 day mornings 8, and-70 ℃ of preservations are subsequent use; Respectively the mouse of bacterial strain treatment group and natural recovering group was weighed in the 6th, 21 day.
3, the extraction of the total DNA of excrement appearance
Take by weighing 1g ight soil and in frozen water, thaw, be suspended in 10ml sterilization PBS damping fluid (pH 7.4) and abundant vortex mixing.4 ℃, centrifugal 3 min of 3000 r/min remove solid particulate, get supernatant.Supernatant is in 4 ℃, the centrifugal 5-10 min of 12000 r/min, collecting precipitation.To precipitate (thalline) with PBS liquid washing 3 times, with reference to the method for Zoetendal etc., earlier with pearl mill method Mechanical Crushing sample, then with phenol and chloroform/its total DNA of primary isoamyl alcohol method extraction.
4, the amplification of excrement appearance flora 16s rRNA gene order
Adopt a pair of bacterium universal primer that the V7-V9 district fragment of the 16S rRNA gene of excrement appearance flora is carried out pcr amplification.Pcr amplification system 50 L, 94 ℃ of preparatory sex change 5min; 94 ℃ of 45 s, 57 ℃ of 45 s, 72 ℃ of 45 s, 25 circulations; 72 ℃ are extended 10 min.Primer is synthetic by Invitrogen company:
U968f:5’-CGC?CCG?GGG?CGC?GCC?CCG?GGC?GGG?GCG?GGG?GCA?CGG?GGG?GAA?CGC?GAA?GAA?CCT?TAC-3’
L1401r:5’-CGG?TGT?GTA?CAA?GAC?CC-3’
5, DGGE and atlas analysis
With reference to the method for Muyzer etc., pcr amplification product is carried out DGGE analyze.DGGE is with 8% polyacrylamide gel (containing propionic acid amide, dipropyl acidamide, urea, methane amide and glycerine), and the urea concentration gradient is 40% ~ 70%.Electrophoresis adopts Dcode DGGE system, at first 200V voltage prerunning 5min, 50V voltage electrophoresis 16h then.After electrophoresis finishes, carry out EB dyeing,, see Fig. 4 and Fig. 5 with GS-800 gray scale scanning appearance scanning spectra.
6, the sequencing of advantage band and analysis
With advantage band among Fig. 5 and SIL1 bacterial strain, adopt primer and PCR system in above-mentioned 4 to increase, product recovery back is connected with pMD 18-T carrier and is transformed into
E.coliDH5 α, through ammonia benzyl resistance and the screening of blue hickie, positive plasmid is checked order by Invitrogen company, and the homology of sequence is analyzed comparison.
7, the SIL1 bacterial strain is to the influence of mouse intestinal flora
Can find out that from Fig. 4 and Fig. 5 irritate the gastric hydrochloric acid lincomycin after 5 days, total count obviously reduces in the model group stool in mice, explains that model prepares successfully.The alteration of intestinal flora mouse is after irritating stomach SIL1 bacteria suspension, and the stool in mice flora is distributed with tangible change: at 5-10 days that irritate stomach, the quantity of dominant bacteria was along with the prolongation of irritating the stomach time is in rising trend in the intestines; The 15th day, the quantity of dominant bacteria significantly reduced in the intestines, and tends towards stability; The natural recovering group mouse is along with the continuity of time, and intestinal microflora distributes and then trends towards gradually normally.Find through comparison that the advantage band among Fig. 5 is checked order, this advantage band and lactobacillus salivarius (
Lactobacillus salivarius) the V7-V9 fragment homology of 16S rRNA gene of SIL1 is 99%, this explanation SIL1 bacterial strain can change the distribution of mouse intestinal flora through the propagation metabolism of self, and finally become the dominant bacteria in the intestinal microflora in the mouse intestinal field planting.
8, the SIL1 bacterial strain is to the influence of mouse growth performance
Prepare in the process at the alteration of intestinal flora model, model group mouse diet descends, and dead and tangible diarrhoea phenomenon occurs, arranges soft excrement, and it is more that profile normally contains moisture, and bedding and padding are moist.Irritate between gastric phase at whole bacteria suspension, the bacterial strain treatment group mouse mental status, search for food well, weight average rate of increase (33.71%) utmost point is significantly higher than natural recovering group (20.39%).In addition, bacterial strain treatment group mouse does not find that individual organ has abnormal conditions after dissecting, and can judge tentatively that the SIL1 bacterial strain is safe to mouse.
Mouse weightening finish situation relatively before and after table 2 bacteria suspension was irritated stomach
Annotate: * * represent difference extremely significantly (
P<0.01)
Claims (2)
1. a strain lactobacillus salivarius (Lactobacillus salivarius) SIL1, its preserving number is CCTCC M2010281.
2. the application in the adjusting microbial population of animal intestinal tract of the said bacterial strain SIL1 of claim 1, the promotion growth of animal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010105234341A CN102061272B (en) | 2010-10-28 | 2010-10-28 | Lactobacillus salivarius SIL1 and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010105234341A CN102061272B (en) | 2010-10-28 | 2010-10-28 | Lactobacillus salivarius SIL1 and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102061272A CN102061272A (en) | 2011-05-18 |
CN102061272B true CN102061272B (en) | 2012-07-04 |
Family
ID=43996778
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010105234341A Expired - Fee Related CN102061272B (en) | 2010-10-28 | 2010-10-28 | Lactobacillus salivarius SIL1 and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102061272B (en) |
Families Citing this family (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103289927B (en) * | 2013-05-30 | 2015-03-25 | 中国农业科学院哈尔滨兽医研究所 | Lactobacillus salivarius strain and application thereof |
CN103289926B (en) * | 2013-05-30 | 2015-08-26 | 中国农业科学院哈尔滨兽医研究所 | One strain lactobacillus salivarius strains and application thereof |
CN104789497A (en) * | 2015-04-02 | 2015-07-22 | 河南农业大学 | Acid-resistant and bile-salt-resistant Lactobacillus strain as well as screening method and application thereof |
CN105567583A (en) * | 2015-11-30 | 2016-05-11 | 沈阳农业大学 | Application of chicken-source lactobacillus salivarius |
CN110591987B (en) * | 2019-11-01 | 2021-05-14 | 四川农业大学 | Lactobacillus salivarius358 and application thereof, silage additive and silage |
CN111281896B (en) * | 2020-02-14 | 2020-11-03 | 昆明加加宁生物制品有限公司 | Composite microbial inoculum for adjusting micro-ecological balance of gynecology |
CN113388550B (en) * | 2021-07-16 | 2023-05-05 | 新希望六和股份有限公司 | Lactobacillus salivarius NHE-LsE33 and application thereof |
CN116731899A (en) * | 2023-01-10 | 2023-09-12 | 迪辅乐生物(上海)有限公司 | Police dog lactobacillus salivarius CA03 and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101538545A (en) * | 2009-04-08 | 2009-09-23 | 内蒙古蒙牛乳业(集团)股份有限公司 | Lactobacillus salivarius and food composition thereof |
-
2010
- 2010-10-28 CN CN2010105234341A patent/CN102061272B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101538545A (en) * | 2009-04-08 | 2009-09-23 | 内蒙古蒙牛乳业(集团)股份有限公司 | Lactobacillus salivarius and food composition thereof |
Also Published As
Publication number | Publication date |
---|---|
CN102061272A (en) | 2011-05-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102061272B (en) | Lactobacillus salivarius SIL1 and application thereof | |
CN103820363B (en) | A kind of preparation and application of faecium bacterium powder | |
CN102373172B (en) | Enterococcus faecium and application thereof | |
CN102747003B (en) | Screening and application of probiotic Enterococcus faecium | |
CN101671638B (en) | New strain of bifidobacterium and fermentative preparation method and application thereof | |
CN102690771B (en) | Functional lactobacillus plantarum and application thereof | |
CN109749957B (en) | Preparation and application of lactobacillus gasseri preparation with aquatic pathogenic bacteria antagonistic property | |
CN106399196A (en) | Lactobacillus plantarum HEW-A490 and application thereof | |
CN103421715B (en) | Lactobacillus rhamnosus and application thereof | |
CN105062933A (en) | Lactobacillus reuteri and application thereof | |
CN102517238B (en) | Acid-producing bacillus cereus and application thereof | |
CN102391962B (en) | Enterococcus faecium preparation agent and manufacturing technology thereof | |
CN102226157A (en) | Lactobacillus fermentum and application thereof | |
CN109679882A (en) | One Enterococcus faecalis DT1-1 and its application | |
CN105368755A (en) | Acid-yielding Enterococcus faecium, bacteriostatic microecological preparation and application thereof | |
CN102321552B (en) | Clostridium butyricum used for feeding, and application thereof | |
CN105524855B (en) | A kind of bacillus coagulans and its application with aquatic pathogenic bacterium antagonistic properties | |
CN103289926B (en) | One strain lactobacillus salivarius strains and application thereof | |
CN108587957A (en) | One plant height produces the screening and application of the probiotic Bacillus licheniformis of complex enzyme | |
WO2008023580A1 (en) | Animal feed additive | |
CN107177522A (en) | One plant height activity forage plant lactobacillus and its cultural method and application | |
CN108004182A (en) | One plant of lactobacillus paracasei and its application in aquaculture | |
CN102304484B (en) | New strain of pseudoalteromonas flavipulchra and use thereof | |
CN105132321A (en) | Enterococcus faecium, culture medium thereof for high-density solid-state fermentation, and high-density solid-state fermentation method | |
Wang et al. | Improving the quality of Laminaria japonica-based diet for Apostichopus japonicus through degradation of its algin content with Bacillus amyloliquefaciens WB1 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120704 Termination date: 20131028 |