CN110452301A - A kind of antineoplastic amalgamation protein and its coded polynucleotide and application - Google Patents
A kind of antineoplastic amalgamation protein and its coded polynucleotide and application Download PDFInfo
- Publication number
- CN110452301A CN110452301A CN201910401151.0A CN201910401151A CN110452301A CN 110452301 A CN110452301 A CN 110452301A CN 201910401151 A CN201910401151 A CN 201910401151A CN 110452301 A CN110452301 A CN 110452301A
- Authority
- CN
- China
- Prior art keywords
- seq
- amino acid
- antineoplastic amalgamation
- amalgamation protein
- gnrh
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Wood Science & Technology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to a kind of antineoplastic amalgamation protein, it is D-A-B-C which, which has structure, wherein A is GnRH protein component；B is the transmembrane transport area of PEA albumen；C is DNASE protein component；D is optional signal peptide and/or leader peptide sequences；"-" indicates to connect the peptide bond of above-mentioned each element；Fusion protein specificity provided by the invention is good, cytotoxicity is low, while providing the polynucleotides for encoding the fusion protein, while additionally providing the application field of the fusion protein.
Description
Technical field
The present invention relates to biomedicine technical field more particularly to a kind of antineoplastic amalgamation proteins and its coded polynucleotide
And application.
Background technique
Immunotoxin be lineup's work building with specific cell killing ability hybrid molecule, by toxin part,
Carrier part and targeting moiety three parts composition.Toxin part can be plant, animal, microbe-derived cytotoxin, target
To partially can be monoclonal antibody or cell factor.Immunotoxin has strong toxicity and spy compared with other anti-tumor drugs
Anisotropic high advantage, shows huge application prospect in oncotherapy.
Recombined human luteinising hormone-releasing hormo-Pseudomonas aeruginosa Exotoxin A fusion protein (lyophilized is lyophilized
recombinant human luteinizing hormone releasing hormone- exotoxin of
Pseudomonas aer μ ginosa fusion protein, abbreviation LHRH- PE40) it is erm gene engineering drug research
A kind of pair of tumour cell of production has the recombinant toxin of specific killing action.Its production method is first using genetic engineering
Method will encode receptor binding domain (area the I) excision of Pseudomonas aeruginosa Exotoxin A gene, be replaced as LHRH gene, then by LHRH-
PE40 recombination is cloned in plasmid, goes out LHRH-PE40 fusion protein by engineering fermentation expression.
That play cytotoxicity in LHRH- PE40 is Pseudomonas aeruginosa Exotoxin A (exotoxin A of
pseudomonas aerμginosa, PEA).Pseudomonas aeruginosa Exotoxin A is a kind of strongest toxin of virulence, energy in Pseudomonas aeruginosa
It blocks the synthesis of cell protein and causes the apoptosis of cell.Fairlead in LHRH-PE40 is that human interstital-cell-stimulating hormone's release swashs
Plain (human luteinizing hormone releasing hormone, LHRH), by with it in tumor cell surface
I receptor in conjunction with and targeting PEA imported into tumour cell play antitumor action.
The receptor of LHRH has amphitypy, i.e. I type and II type.The affinity of LHRH and I receptor is very high.Human normal situation
Under, I receptor is primarily present in anterior pituitary, hang down vitro tissue such as sexual gland, placenta and brain tissue also contain a certain amount of I type by
Body, other vitals do not express I type LHRH receptor.However certain tumor cell surfaces are then dispersed with greatly due to receptor alienation
LHRH I receptor, including reproductive system malignant tumour, melanoma, gastric cancer, liver cancer, cancer of pancreas, intestinal cancer, lung cancer of amount etc..
Due to the universal high expression in tumour cell of I type LHRH receptor, and only it is distributed in the normal tissue in limitation, therefore LHRH
It is ideal fairlead needed for design recombinant target toxin.
The II receptor of LHRH is widely present in during human body respectively organizes.The affinity of LHRH and II receptor is very low.But
Very in the case where high dose, LHRH can occur low-affinity with II receptor and combine, so that it is extensive to generate LHRH-PE40
Cytotoxicity.This is the theoretical basis that LHRH-PE40 recombinant toxin generates toxic effect to animal.LHRH-PE40 cannot be saturating
Blood-brain barrier is crossed, therefore toxic effect will not be generated to hypophysis.
Although showing good application prospect by the immunotoxin of representative of LHRH- PE40, there are still immunogenes for it
The problems such as property and non-specific cytotoxicity, hinder the application of immunotoxin clinically.Therefore, there is an urgent need in the art to open
The new immunotoxin that hair specificity is good, cytotoxicity is low.
Summary of the invention
The purpose of the invention is to overcome the deficiencies of the prior art and provide a kind of antineoplastic amalgamation protein, the fusion
Protein-specific is good, cytotoxicity is low, while providing the polynucleotides for encoding the fusion protein, while additionally providing the fusion
The application field of albumen.
The present invention is achieved through the following technical solutions:
A kind of antineoplastic amalgamation protein has structure:
D-A-B-C
Wherein,
A is GnRH protein component；
B is transmembrane transport area or the nothing of PEA albumen；
C is DNASE protein component；
D is optional signal peptide and/or leader peptide sequences；
"-" indicates to connect the peptide bond of above-mentioned each element.
Further, the amino acid sequence of antineoplastic amalgamation protein is as shown in SEQ ID NO:2.
Further, the sequence of GnRH albumen is as shown in 1-10 in SEQ ID NO.:2.
Further, the sequence of DNASE albumen is as shown in 128-520 in SEQ ID NO.:2.
Further, the length in the transmembrane transport area of PEA albumen be 100-120 amino acid, it is preferable that PEA albumen across
The length in film transit zone is that the length in the transmembrane transport area of PEA albumen is 100-115 amino acid.
Further, the sequence in the transmembrane transport area of PEA albumen is as shown in 13-127 in SEQ ID NO.:2.
Further, antineoplastic amalgamation protein one of is selected from the group or a variety of:
(a) polypeptide with amino acid sequence shown in SEQ ID NO.:2；
(b) have with amino acid sequence shown in SEQ ID NO.:2 >=80% homology, and polypeptide has and inhibits tumour cell raw
Long activity, it is preferable that≤99% homology；
(c) amino acid sequence shown in SEQ ID NO:2 is formed by 1-10 replacing, missing or adding for amino acid residue
, and retain the derived peptides for inhibiting tumor cell growth activity.
In another technical solution, provide the polynucleotides for encoding above-mentioned fusion protein, sequence such as SEQ
Shown in ID NO.:1.
In another technical solution, provide the purposes of antineoplastic amalgamation protein, purposes be preparation for treating or
The drug for preventing the tumour of expression GnRH.
Compared with prior art, the present invention has following usefulness:
DNASE albumen efficiently can be transported to nucleus and efficiently cause Apoptosis by the fusion protein of offer, the fusion egg
It is white not only efficiently to express, it is not degradable, and polymer (the especially tetramer) is efficiently formed；In addition, of the invention
Fusion protein (monomer or polymer) extremely can efficiently pass through cell membrane and enter intracellular, and efficiently and rapidly enter thin
Karyon, to extremely efficiently induce the apoptosis of abnormal cell (such as tumour cell)；Provided polynucleotides can be efficiently
Encode out fusion protein of the invention；Also the application of the fusion protein is explored.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
Embodiment 1:
A kind of antineoplastic amalgamation protein has structure:
D-A-B-C
Wherein,
A is GnRH protein component；
B is the transmembrane transport area of PEA albumen；
C is DNASE protein component；
D is optional signal peptide and/or leader peptide sequences；
"-" indicates to connect the peptide bond of above-mentioned each element.
Preferably, the sequence of GnRH albumen is as shown in 1-10 in SEQ ID NO.:2.
Preferably, the sequence of DNASE albumen is as shown in 128-520 in SEQ ID NO.:2.
Preferably, the length in the transmembrane transport area of PEA albumen is 100-120 amino acid.
Preferably, the sequence in the transmembrane transport area of PEA albumen is as shown in 13-127 in SEQ ID NO.:2.
Preferably, antineoplastic amalgamation protein one of is selected from the group or a variety of:
(a) polypeptide with amino acid sequence shown in SEQ ID NO.:2；
(b) have with 80% homology of amino acid sequence shown in SEQ ID NO.:2, and polypeptide have inhibit growth of tumour cell
Activity；
(c) amino acid sequence shown in SEQ ID NO:2 is formed by 1 replacing, missing or adding for amino acid residue,
And retain the derived peptides for inhibiting tumor cell growth activity.
Embodiment 2:
In addition to the following contents, remaining is same as Example 1, specific different are as follows:
Preferably, B is nothing.
Preferably, it is 100-115 that the length in the transmembrane transport area of PEA albumen, which is the length in the transmembrane transport area of PEA albumen,
A amino acid.
Preferably, antineoplastic amalgamation protein one of is selected from the group or a variety of:
(a) polypeptide with amino acid sequence shown in SEQ ID N.:2；
(b) have with 90% homology of amino acid sequence shown in SEQ ID NO.:2, and polypeptide have inhibit growth of tumour cell
Activity；
(c) amino acid sequence shown in SEQ ID NO:2 is formed by 5 replacing, missing or adding for amino acid residue,
And retain the derived peptides for inhibiting tumor cell growth activity.
Embodiment 3:
In addition to the following contents, remaining is same as Example 1, specific different are as follows:
(a) polypeptide with amino acid sequence shown in SEQ ID NO.:2；
(b) have with 99% homology of amino acid sequence shown in SEQ ID NO.:2, and polypeptide have inhibit growth of tumour cell
Activity；
(c) amino acid sequence shown in SEQ ID NO:2 is formed by 10 replacing, missing or adding for amino acid residue
, and retain the derived peptides for inhibiting tumor cell growth activity.
Embodiment 4:
Provide the polynucleotides for encoding above-mentioned fusion protein, sequence as shown in SEQ ID NO.:1.
Embodiment 5:
The purposes of antineoplastic amalgamation protein is provided, purposes is the medicine of tumour of the preparation for treating or preventing expression GnRH
Object.
Preferably, tumour is selected from one of type or a variety of, specifically: breast cancer, lung cancer, colorectal cancer, pancreas
Cancer, oophoroma, prostate cancer, kidney, liver cancer, the cancer of the brain, melanoma, Huppert's disease, head and neck neoplasm.
In above-described embodiment, term " fusion protein ", " GnRH+PEA+DNASE " are used interchangeably, and refer to that the present invention mentions
The fusion protein of confession；
Wherein,
PEA is by the single-stranded toxin protein of 613 Amino acid profiles, molecular weight 66kD.It is made of three structure function areas: I
Area, the area II and the area III.The area I PEA molecule N-terminal, in antiparallel beta structure.The area I is divided into the area Ia and the area Ib again, and this two
Dividing on DNA sequence dna is separation, but is closely packed together in a three-dimensional structure.The area Ia amino acids containing 1-252, responsible and target
Cell surface receptor combination-cell combination function；The area Ib amino acids containing 365-399, big portion (the 365-380 ammonia in this area
Base acid) lack the biological activity for having no effect on PEA.The area II is central area, including 253-364 amino acids, have 6 it is continuous
α spiral, it is responsible for cross-film indexing function, when the area II missing when, although its cell combination function and ADP ribosylation activity are still
It deposits, but cytotoxicity is lost, and illustrates that the area II is required for toxin indexing function.The area III includes 400-613 amino acids, it has
Two functions: one is the ADP ribosylation effect of catalysis EF-2；The second is its C-terminal specific amino acid sequence mediates poison
Plain piece is disconnected to be carried out into endoplasmic reticulum, this specific set is by (the i.e. REDLK of Arg609 Glu610 Asp611 Leu612 Lys613)
Five amino acid residue segment is constituted, its missing loses the cytotoxicity of PE, and is carried out sequence adjustment, Neng Gouming
The aobvious ADP ribosylation efficiency for promoting toxin.
Table 1 shows PEA molecular structure and functional relationship.
One: PEA molecular structure of table and functional relationship
GnRH is to be equal to 1971 to isolate and purify out of animal body by Schally, illustrate it is again artificial synthesized after its structure, and with
This obtains Nobel prize in 1976.GnRH is the decapeptide for being free of free amino acid and carboxyl, molecular structure are as follows: P-
Glu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2, wherein 4-6 amino acids form β turnover, it is in hair clip
Shape is suitble in conjunction with receptor, and the 2nd and 3 is critically important to bioactivity, and the 6th plays an important role to maintenance hairpin conformation, and the 1st
Position both participates in conjunction with receptor with 4-10 amino acids, loses or if replacing the above amino acid residue and can lead to vigor in geometry grade
Enhancing.
Natural GnRH is easy to by proteolytic degradation in vivo, therefore its half-life period only 4-8min.Its hydrolase peptase
Main function position be Gly6-Leu7 and Pro9-Gly10-NH2.To seek efficient and lasting GnRH analog, pass through
Pickup or replacement to amino acid in its peptide chain structure have synthesized more than 3000 kinds of GnRH analogs.Since the GnRH of synthesis partly declines
Phase is long, and effect is stronger, so being more suitable for the treatment of patient than natural GnRH.It is steady for synthesizing the requirement of long-acting GnRH agonist
Determine molecular structure, be allowed to be not easy the combination of the albumen and after birth in being increased and recycled by enzyme hydrolysis and improve to GnRH receptor
Affinity.Such as 6 analogs for D- amino acid and substitution Gly10 amide groups.This GnRH agonist not only resistant protease water
Solution effect is larger, and has higher affinity to receptor.If introduced at the 6th huge hydrophobic grouping can further increase with
The affinity of receptor.
Such replace stabilizes " activity " configuration of releasing hormone analog, improve and recycle in albumen combination,
To extend half-life period.
Gonadotropin releasing hormone (GnRH) receptor of normal person is primarily present in anterior pituitary, and hang down vitro tissue such as sexual gland
There is a small amount of GnRH receptor to be distributed in placenta tissue, although also can detecte out one in vitals such as liver, kidney, the heart and skeletal muscle
The mRNA of fixed horizontal GnRH receptor.But these are detected using method-Hepatocellular carcinoma (RLA) of receptor quantitative analysis
Organ-tissue can only then obtain negative findings.
It is current studies have shown that GnRH is substantially segmented into two kinds, i.e.,
GnRH I, primary structure is as follows:
pGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2
GnRH II, primary structure is as follows:
pGlu-His-Trp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH2
Its corresponding receptor is also classified into two kinds i.e. I type GnRH receptor and II type GnRH receptor.The main distinction of amphitypy GnRH receptor
It is:
1, there are position differences for gene: I type GnRH acceptor gene is present on No. 8 chromosomes, and II type GnRH acceptor gene exists
In on No. 20 chromosomes.
2, genetic transcription direction is different: I type GnRH acceptor gene transcriptional orientation is just direction progress, and II type GnRH
Acceptor gene transcriptional orientation is that antisense orientation carries out, therefore the difference of RNA shearing and termination site is caused also to have very big difference.
3, amino acid composition is different: amino acid expressed by II type GnRH acceptor gene exon 2 and 3 and I receptor
Same area amino acid identity is respectively 45% and 41%.
4, molecular structure is different: having a C-terminal cytoplasmic domain tail portion on II type GnRH receptor structure.And I type GnRH receptor
Then without.
5, the selectivity in conjunction with aglucon is different: the aglucon binding specificity carried out on functioning cell is experiments have shown that two kinds
Receptor has explicitly with based selective, and II receptor is very high to the respond of II type GnRH, and to the reaction energy of I type GnRH
Power is then very low, more than 420 times of the two difference.
6, distribution is different in the tissue: being detected using RT-PCR, the mRNA of GnRHR I is mainly distributed in hypophysis and minority
In genital system tissue, and the mRNA of GnRHR II is then widely distributed in almost all of organ-tissue.II type GnRH receptor
Extensive and abundant existing meaning is not still fully aware of so far in people's tissue.
7, generated signal is different after different aglucons are in conjunction with not isoacceptor.
DNAse
DNase I, i.e. Deoxyribonuclease I, Chinese are deoxyribonuclease I, are that one kind can digest list
Chain or double-stranded DNA generate the endonuclease of monodeoxyribonucleotide or single-stranded or double-stranded oligodeoxynucleotide.DNase I hydrolysis
Product after single-stranded or double-stranded DNA, the end 5' are phosphate group, and the end 3' is hydroxyl.
DNase I activity depends on calcium ion, and can be activated by magnesium ion or divalent manganesetion.Magnesium ion existence condition
Under, DNase I can random shearing double-stranded DNA any site；Under divalent manganesetion existence condition, DNase I can be in same position
Point shearing DNA double chain, forms flat end or 1-2 nucleotide viscous end outstanding.
DNASE albumen efficiently can be transported to nucleus and efficiently cause cell by fusion protein provided by the above embodiment
Apoptosis, which not only can efficiently express, not degradable, and polymer is efficiently formed (especially four is poly-
Body)；In addition, fusion protein (monomer or polymer) of the invention can extremely efficiently pass through cell membrane enter it is intracellular, and
Efficiently and rapidly enter nucleus, to extremely efficiently induce the apoptosis of abnormal cell (such as tumour cell)；It is provided
Polynucleotides can efficiently encode out fusion protein of the invention；Also the application of the fusion protein is explored, specially
Fusion protein can be applied to breast cancer, lung cancer, colorectal cancer, cancer of pancreas, oophoroma, prostate cancer, kidney, liver cancer, and the cancer of the brain is black
Melanoma, Huppert's disease, one of head and neck neoplasm or a variety of.
Finally, it is stated that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although referring to compared with
Good embodiment describes the invention in detail, those skilled in the art should understand that, it can be to skill of the invention
Art scheme is modified or replaced equivalently, and without departing from the objective and range of technical solution of the present invention, should all be covered at this
In the scope of the claims of invention.
Sequence table
SEQ ID NO.: 1
CAGCAAGAAACCTGTGCTTACAGAAAGAAACACGTGCTAGCAACCCACCTATGCGGAAAGCCACACAGAG
CCATTGTTTTCTGCACTCTCAGCAAAAGGAGAAAATTGTCATCAAAGGATATTCCAGATTCTTGACAGCA
TTCTCGTCATCTCTGAGGACATCACCATCATCTCAGGATGAGGGGCATGAAGCTGCTGGGGGCGCTGCTG
GCACTGGCGGCCCTACTGCAGGGGGCCGTGTCCCTGAAGATCGCAGCCTTCAACATCCAGACATTTGGGG
AGACCAAGATGTCCAATGCCACCCTCGTCAGCTACATTGTGCAGATCCTGAGCCGCTATGACATCGCCCT
GGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACAACCTCAATCAGGATGCA
CCAGACACCTATCACTACGTGGTCAGTGAGCCACTGGGACGGAACAGCTATAAGGAGCGCTACCTGTTCG
TGTACAGGCCTGACCAGGTGTCTGCGGTGGACAGCTACTACTACGATGATGGCTGCGAGCCCTGCGGGAA
CGACACCTTCAACCGAGAGCCAGCCATTGTCAGGTTCTTCTCCCGGTTCACAGAGGTCAGGGAGTTTGCC
ATTGTTCCCCTGCATGCGGCCCCGGGGGACGCAGTAGCCGAGATCGACGCTCTCTATGACGTCTACCTGG
ATGTCCAAGAGAAATGGGGCTTGGAGGACGTCATGTTGATGGGCGACTTCAATGCGGGCTGCAGCTATGT
GAGACCCTCCCAGTGGTCATCCATCCGCCTGTGGACAAGCCCCACCTTCCAGTGGCTGATCCCCGACAGC
GCTGACACCACAGCTACACCCACGCACTGTGCCTATGACAGGATCGTGGTTGCAGGGATGCTGCTCCGAG
GCGCCGTTGTTCCCGACTCGGCTCTTCCCTTTAACTTCCAGGCTGCCTATGGCCTGAGTGACCAACTGGC
CCAAGCCATCAGTGACCACTATCCAGTGGAGGTGATGCTGAAGTGAGCAGCCCCTCCCCACACCAGTTGA
ACTGCAGGAAGAGAGGACCCATCCTGCCACAGGACCCAGAAAAAAAGCCCAACACACACTCGGGTTAAGA
AATACCTTTAAATTTAGGTAAATAAAGCTCAAGGAGGTGGGGCTGTCAAAAAAAAAAA
SEQ ID NO.:2
AATTTCTCATCTTTCTGTTCCCACTGCCCTTAAGAGTGATTTGCATATTTAACTCAATAAGCATCTACTG
AAATGAGTTGATCTGTTGATGTAAGTCTGCTCAATATGGTCTTGCTCTCAGAATATGTTTCTTGCCTTTT
TGATGCTTTAGAAGGCTTTCAAGGTAAGTCAAGCAGGGAACCTGGTGGGTAGATGAGGGAATTTTCAAAC
ACACAACTGTCTGATTTAGGATCCTACATGGACTTGGTATATAGTGTCACTTACTTGTAAATCAGATTTT
TAAAATTGGAAGCAACTCTGTGATCATCTAGTCCATCTAGTCTACACCCTTCCTTTTACAAATGAAGAAT
CCAAGAGCCAGAAGCTCCCAGACATCCTGACTCAATGTCCTATATTTGTTGTATAGCCTCCTTTGTGGAA
GTTATGTATGCATTTGACTTCACTTAATCTAAGACATCTATTTTCCTTGAACTCTTGATAGGTCTGCTGG
TTTCCTCAAGGGAATCCAATCTAGCTGGATTTTAATCTCTTTGAATTGTGTCCTCAGCTATAAAAGTTTT
AGCTGAGGTTTTAATGGCTGCACTTAAGTAAATCTAACAGATATACCAGGGGGTGTTCCAATTACATACA
CCATTAAAGGGCTTTATGTGAGGATTTTTAAAAATTACCATTAAAAAAAAAAAAGCATAGTCCATTTGCA
GTATAATTTACCAGCAGGAAAGATTTCAATGTCCTGGAAAAATTCCCTATAAAAAGGAAGATAGGAAAAC
AGAAAAGTCACAGTACTCAACCTACTTCAAGGGAAGATTGGGATCTTTTTGGCTCTCTGCCTCTAAACAG
GTAAAAGGCTTTGTATTATTTCTAGCACGAGTTTTTCTTCTTTAGATTGCATGCTATTGTATGTCTACAG
GGCATTTGACAGCCCAAGGGCTAAATCCAGGTGTGACGGTATCTAATGATGTCCTGTCCTTCACTGTCCT
TGCCATCACCAGCCACAGAGATCCAGGCTTTGGGGACTCCCACAGCTTATCGACCAGTGTTTGATTTAGT
TTTTAGCCTCTTTCCCATCAAATGAAAATTAACTTGGAGACACATTTCATTAGAAAATTAGAGGCCCCCT
TGGCTAGGAAGGCATCTGGTCTGGGACTAACTACTTTGAACAGTGTTGAGTCCTCTCTCCCACAGATGGT
TCAGCCAGCAGTAATGCTAGGAAGACTGAAGGATAAATAGAAAAATGTCATTAGTACCATGGGGTAGCCA
TGTAATGTCAAGCAATTTTATATTAGCCAGAGATTCCTAGTAGGAGCTACTTTTCTTAACAGATGACTCA
GTTCTCTTTATCTCAGGAATGAAAGAGTTGAAGACCAATCCACAACAGGGGAAATGTTAAGGCAAAATGA
TGAACTTGATAAGGGATGAATTATGGGGTTTGGATAACCAAACAATAAAAATAAAAGTATAGACTATTTT
AGTACTAAAAAGGTCCTGAACATGTGAGCTTAAGTACTCATTTTGTCCCCAGTGGCTAAGAAACTAAAGG
CAAGCCAGCAAGTGTCTCTGAGTTTCAGTGTCTGTATGTAAAAACTGACTCTGACTTCCATCTTCTGCAG
GGTTAGTGATACAGATGCTAGCTTTTTCACTAAAGAGGTCTTTTAGTTTATACTCAACCTTGTCTGGATC
TAATTTGATTGTGCATTCATGTGCCTTAGAATGAAGCCAATTCAAAAACTCCTAGCTGGCCTTATTCTAC
TGACTTGGTGCGTGGAAGGCTGCTCCAGCCAGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGA
TGCCGAAAATTTGATTGATTCTTTCCAAGAGATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGC
TTCGAATGCACCACGCACCAGCCACGTTCTCCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGATTG
AAGAGGAAACTGGGCAGAAGAAGATTTAAATCCATTGGGCCAGAAGGAATGACCATTACTAACATGACTT
AAGTATAATTCTGACATTGAAAATTTATAACCCATTAAATACCTGTAAATGGTATGAATTTCAGAAATCC
TTACACCAAGTTGCACATATTCCATAATAAAGTGCTGTGTTGTGAATGAAAAAAAAAAAAAAAAAA
Sequence table
<110>this Lin Ge Biotechnology Co., Ltd of Shanghai
<120>a kind of antineoplastic amalgamation protein and its coded polynucleotide and application
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
EQ ID NO.: 1
CAGCAAGAAACCTGTGCTTACAGAAAGAAACACGTGCTAGCAACCCACCTATGCGGAAAGCCACACAGAG
CCATTGTTTTCTGCACTCTCAGCAAAAGGAGAAAATTGTCATCAAAGGATATTCCAGATTCTTGACAGCA
TTCTCGTCATCTCTGAGGACATCACCATCATCTCAGGATGAGGGGCATGAAGCTGCTGGGGGCGCTGCTG
GCACTGGCGGCCCTACTGCAGGGGGCCGTGTCCCTGAAGATCGCAGCCTTCAACATCCAGACATTTGGGG
AGACCAAGATGTCCAATGCCACCCTCGTCAGCTACATTGTGCAGATCCTGAGCCGCTATGACATCGCCCT
GGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACAACCTCAATCAGGATGCA
CCAGACACCTATCACTACGTGGTCAGTGAGCCACTGGGACGGAACAGCTATAAGGAGCGCTACCTGTTCG
TGTACAGGCCTGACCAGGTGTCTGCGGTGGACAGCTACTACTACGATGATGGCTGCGAGCCCTGCGGGAA
CGACACCTTCAACCGAGAGCCAGCCATTGTCAGGTTCTTCTCCCGGTTCACAGAGGTCAGGGAGTTTGCC
ATTGTTCCCCTGCATGCGGCCCCGGGGGACGCAGTAGCCGAGATCGACGCTCTCTATGACGTCTACCTGG
ATGTCCAAGAGAAATGGGGCTTGGAGGACGTCATGTTGATGGGCGACTTCAATGCGGGCTGCAGCTATGT
GAGACCCTCCCAGTGGTCATCCATCCGCCTGTGGACAAGCCCCACCTTCCAGTGGCTGATCCCCGACAGC
GCTGACACCACAGCTACACCCACGCACTGTGCCTATGACAGGATCGTGGTTGCAGGGATGCTGCTCCGAG
GCGCCGTTGTTCCCGACTCGGCTCTTCCCTTTAACTTCCAGGCTGCCTATGGCCTGAGTGACCAACTGGC
CCAAGCCATCAGTGACCACTATCCAGTGGAGGTGATGCTGAAGTGAGCAGCCCCTCCCCACACCAGTTGA
ACTGCAGGAAGAGAGGACCCATCCTGCCACAGGACCCAGAAAAAAAGCCCAACACACACTCGGGTTAAGA
AATACCTTTAAATTTAGGTAAATAAAGCTCAAGGAGGTGGGGCTGTCAAAAAAAAAAA
SEQ ID NO.:2
AATTTCTCATCTTTCTGTTCCCACTGCCCTTAAGAGTGATTTGCATATTTAACTCAATAAGCATCTACTG
AAATGAGTTGATCTGTTGATGTAAGTCTGCTCAATATGGTCTTGCTCTCAGAATATGTTTCTTGCCTTTT
TGATGCTTTAGAAGGCTTTCAAGGTAAGTCAAGCAGGGAACCTGGTGGGTAGATGAGGGAATTTTCAAAC
ACACAACTGTCTGATTTAGGATCCTACATGGACTTGGTATATAGTGTCACTTACTTGTAAATCAGATTTT
TAAAATTGGAAGCAACTCTGTGATCATCTAGTCCATCTAGTCTACACCCTTCCTTTTACAAATGAAGAAT
CCAAGAGCCAGAAGCTCCCAGACATCCTGACTCAATGTCCTATATTTGTTGTATAGCCTCCTTTGTGGAA
GTTATGTATGCATTTGACTTCACTTAATCTAAGACATCTATTTTCCTTGAACTCTTGATAGGTCTGCTGG
TTTCCTCAAGGGAATCCAATCTAGCTGGATTTTAATCTCTTTGAATTGTGTCCTCAGCTATAAAAGTTTT
AGCTGAGGTTTTAATGGCTGCACTTAAGTAAATCTAACAGATATACCAGGGGGTGTTCCAATTACATACA
CCATTAAAGGGCTTTATGTGAGGATTTTTAAAAATTACCATTAAAAAAAAAAAAGCATAGTCCATTTGCA
GTATAATTTACCAGCAGGAAAGATTTCAATGTCCTGGAAAAATTCCCTATAAAAAGGAAGATAGGAAAAC
AGAAAAGTCACAGTACTCAACCTACTTCAAGGGAAGATTGGGATCTTTTTGGCTCTCTGCCTCTAAACAG
GTAAAAGGCTTTGTATTATTTCTAGCACGAGTTTTTCTTCTTTAGATTGCATGCTATTGTATGTCTACAG
GGCATTTGACAGCCCAAGGGCTAAATCCAGGTGTGACGGTATCTAATGATGTCCTGTCCTTCACTGTCCT
TGCCATCACCAGCCACAGAGATCCAGGCTTTGGGGACTCCCACAGCTTATCGACCAGTGTTTGATTTAGT
TTTTAGCCTCTTTCCCATCAAATGAAAATTAACTTGGAGACACATTTCATTAGAAAATTAGAGGCCCCCT
TGGCTAGGAAGGCATCTGGTCTGGGACTAACTACTTTGAACAGTGTTGAGTCCTCTCTCCCACAGATGGT
TCAGCCAGCAGTAATGCTAGGAAGACTGAAGGATAAATAGAAAAATGTCATTAGTACCATGGGGTAGCCA
TGTAATGTCAAGCAATTTTATATTAGCCAGAGATTCCTAGTAGGAGCTACTTTTCTTAACAGATGACTCA
GTTCTCTTTATCTCAGGAATGAAAGAGTTGAAGACCAATCCACAACAGGGGAAATGTTAAGGCAAAATGA
TGAACTTGATAAGGGATGAATTATGGGGTTTGGATAACCAAACAATAAAAATAAAAGTATAGACTATTTT
AGTACTAAAAAGGTCCTGAACATGTGAGCTTAAGTACTCATTTTGTCCCCAGTGGCTAAGAAACTAAAGG
CAAGCCAGCAAGTGTCTCTGAGTTTCAGTGTCTGTATGTAAAAACTGACTCTGACTTCCATCTTCTGCAG
GGTTAGTGATACAGATGCTAGCTTTTTCACTAAAGAGGTCTTTTAGTTTATACTCAACCTTGTCTGGATC
TAATTTGATTGTGCATTCATGTGCCTTAGAATGAAGCCAATTCAAAAACTCCTAGCTGGCCTTATTCTAC
TGACTTGGTGCGTGGAAGGCTGCTCCAGCCAGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGA
TGCCGAAAATTTGATTGATTCTTTCCAAGAGATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGC
TTCGAATGCACCACGCACCAGCCACGTTCTCCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGATTG
AAGAGGAAACTGGGCAGAAGAAGATTTAAATCCATTGGGCCAGAAGGAATGACCATTACTAACATGACTT
AAGTATAATTCTGACATTGAAAATTTATAACCCATTAAATACCTGTAAATGGTATGAATTTCAGAAATCC
TTACACCAAGTTGCACATATTCCATAATAAAGTGCTGTGTTGTGAATGAAAAAAAAAAAAAAAAAA
Claims (10)
1. a kind of antineoplastic amalgamation protein, which is characterized in that have structure:
D-A-B-C
Wherein,
A is GnRH protein component；
B is the transmembrane transport area of PEA albumen；
C is DNASE protein component；
D is optional signal peptide and/or leader peptide sequences；
"-" indicates to connect the peptide bond of above-mentioned each element.
2. a kind of antineoplastic amalgamation protein according to claim 1, which is characterized in that B is nothing.
3. a kind of antineoplastic amalgamation protein according to claim 1, which is characterized in that the sequence of GnRH albumen such as SEQ ID
In NO.:2 shown in 1-10.
4. a kind of antineoplastic amalgamation protein according to claim 1, which is characterized in that the sequence of DNASE albumen such as SEQ
In ID NO.:2 shown in 128-520.
5. a kind of antineoplastic amalgamation protein according to claim 1, which is characterized in that the transmembrane transport area of PEA albumen
Length is 100-120 amino acid.
6. a kind of antineoplastic amalgamation protein according to claim 1, which is characterized in that the transmembrane transport area of PEA albumen
Sequence is as shown in 13-127 in SEQ ID NO.:2.
7. any a kind of antineoplastic amalgamation protein according to claim 1 ~ 6, which is characterized in that antineoplastic amalgamation protein
It one of is selected from the group or a variety of:
(a) polypeptide with amino acid sequence shown in SEQ ID NO.:2；
(b) have with amino acid sequence shown in SEQ ID NO.:2 >=80% homology, and polypeptide has and inhibits tumour cell raw
Long activity；
(c) amino acid sequence shown in SEQ ID NO:2 is formed by 1-10 replacing, missing or adding for amino acid residue
, and retain the derived peptides for inhibiting tumor cell growth activity.
8. a kind of antineoplastic amalgamation protein according to claim 1, which is characterized in that the amino acid of antineoplastic amalgamation protein
Sequence is as shown in SEQ ID NO:2.
9. a kind of polynucleotides for encoding antineoplastic amalgamation protein described in claim 1, which is characterized in that the sequence of polynucleotides
Column are as shown in SEQ ID NO.:1.
10. a kind of purposes of antineoplastic amalgamation protein described in claim 1, which is characterized in that its purposes is preparation for treating
Or the drug of the tumour of prevention expression GnRH.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910401151.0A CN110452301A (en) | 2019-05-15 | 2019-05-15 | A kind of antineoplastic amalgamation protein and its coded polynucleotide and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910401151.0A CN110452301A (en) | 2019-05-15 | 2019-05-15 | A kind of antineoplastic amalgamation protein and its coded polynucleotide and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110452301A true CN110452301A (en) | 2019-11-15 |
Family
ID=68480964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910401151.0A Pending CN110452301A (en) | 2019-05-15 | 2019-05-15 | A kind of antineoplastic amalgamation protein and its coded polynucleotide and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110452301A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111484547A (en) * | 2020-04-28 | 2020-08-04 | 上海市农业科学院 | Anti-tumor protein AE L1, fusion protein, anti-tumor preparation and application |
-
2019
- 2019-05-15 CN CN201910401151.0A patent/CN110452301A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111484547A (en) * | 2020-04-28 | 2020-08-04 | 上海市农业科学院 | Anti-tumor protein AE L1, fusion protein, anti-tumor preparation and application |
| CN111484547B (en) * | 2020-04-28 | 2022-09-20 | 上海市农业科学院 | Anti-tumor protein AEL1, fusion protein, anti-tumor preparation and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jiang et al. | Targeted delivery of CXCR4-siRNA by scFv for HER2+ breast cancer therapy | |
| US11987604B2 (en) | Fusion-proteins based on human ferritin and protease-cleavable peptides and their use as chemotherapeutics carriers | |
| JP6574175B2 (en) | Cell penetrating peptide and conjugate containing the same | |
| WO2016170348A2 (en) | Sarna compositions and methods of use | |
| US11687256B2 (en) | Methods of using OX40 ligand encoding polynucleotides | |
| JP2016538829A (en) | Polynucleotide encoding low density lipoprotein receptor | |
| JP6243452B2 (en) | Pharmaceutical composition containing albumin-binding arginine deiminase fusion protein | |
| US20170260246A1 (en) | Carcinoma homing peptide (chp), its analogs, and methods of using | |
| JP2003530360A (en) | Peptide conjugates for drug delivery | |
| US20210171578A1 (en) | Cyclic peptide for treating cancer | |
| Zhang et al. | Affibody‐Conjugated RALA Polymers Delivering Oligomeric 5‐Fluorodeoxyuridine for Targeted Therapy of HER2 Overexpressing Gastric Cancer | |
| CN110452301A (en) | A kind of antineoplastic amalgamation protein and its coded polynucleotide and application | |
| CN112292402A (en) | Anti-tumor fusion protein and preparation method and application thereof | |
| US11739163B2 (en) | Therapeutic multi-targeting constructs and uses thereof | |
| CN102140473A (en) | Anti-tumor nucleic acid and polypeptide and application thereof | |
| CN102993314B (en) | Anti-tumor fusion protein, as well as preparation method and application thereof | |
| CN109400711B (en) | PDGFR beta targeting tumor necrosis factor related apoptosis inducing ligand variant and preparation method and application thereof | |
| WO2004108074A2 (en) | Vascular endothelial growth factor fusion constructs and uses thereof | |
| CN105985447B (en) | A kind of albumin mating type tumor necrosin relative death inducing ligand variant and its preparation method and application | |
| US10428132B2 (en) | Tumor necrosis factor-related apoptosis-inducing ligand variant, as well as a preparation method and use thereof | |
| WO2010114539A1 (en) | Tumor targeting peptides, therapeutic and diagnostic compositions comprising the peptides | |
| US20180237482A1 (en) | Fusion protein or conjugated protein, intracellular delivery carrier, partial peptide, cell membrane permeation enhancer, dna, and vector | |
| US8653236B2 (en) | Therapeutic agents | |
| CN102260352B (en) | Targeted interleukin fusion protein as well as preparation method thereof and application thereof | |
| US11560419B2 (en) | Targeting tumor microenvironments with recombinant prokaryotic collagen-like proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20191115 |
|
| WD01 | Invention patent application deemed withdrawn after publication |