CN102140473A

CN102140473A - Anti-tumor nucleic acid and polypeptide and application thereof

Info

Publication number: CN102140473A
Application number: CN2010101109802A
Authority: CN
Inventors: 何明亮; 孔祥復; 董琦; 陈缨
Original assignee: Chinese University of Hong Kong CUHK
Current assignee: Chinese University of Hong Kong CUHK
Priority date: 2010-01-29
Filing date: 2010-01-29
Publication date: 2011-08-03
Anticipated expiration: 2030-01-29
Also published as: CN102140473B

Abstract

The invention provides anti-tumor polypeptide or derivatives thereof, and a nucleic acid molecule encoding the polypeptide or the derivatives thereof. The nucleotide sequence of the polypeptide is from cDNA fragments of high-expression TBX2 and TBX3 in various tumor cells. The invention also provides a method for producing the polypeptide by using an expression vector, and application of the nucleic acid molecule, the polypeptide and the vector in inhibiting tumors or blocking tumor cells from propagating.

Description

Antineoplastic nucleic acid and polypeptide and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to suppress the polypeptide drugs and the application thereof of tumour.

Background technology

Antitumor drug is for a long time by one of hot issue of extensive concern and research.To tumour or treatment for cancer, normally adopt the composite treatment of operative treatment combination with radiotherapeutic and chemotherapy at present.Radioactive rays and chemotherapeutic cause apoptosis, thus killing tumor cell.The radiation and chemotherapy medicine of high dosage can destroy or eliminate cancer cells, but also damages normal cell simultaneously, and the patient immune function is descended, and human body is caused a series of toxic side effect.

Polypeptide drugs are brand-new fields of the tool growth of present biomedicine field, and characteristics such as, safety efficient with it, high specificity are used for cancer, prevention such as transmissible disease and treatment gradually.The function of gene finally will be by its expression product---and protein realizes that all activities or the function of organism all be unable to do without proteinic basic substance.Discovery and evaluation have the protein of critical function, and the exploitation that can be new drug brings decisive influence.In the world, according to the preliminary statistics, existing about 65 peptide medicaments, market scale is about 20,000,000,000 dollars, and every year is with 15%～20% speed increase.

Aspect transmissible disease, particularly the disease of virus type has obtained progress in the control as acquired immune deficiency syndrome (AIDS) (HIV) to polypeptide drugs at present.Enfuvirtide (T20) polypeptide drugs have now been developed ¹, it can stop the fusion that contacts of immunocytes such as HIV and T cell, disturbs HIV-1 to enter the T cell, prevents that AIDS patient's immunity system from had an effect by virus damage, and now as conventional AIDS drug, the treatment works well.Our one studies have shown that, polypeptide drugs and virus envelope glycoprotein interact, and stop its conformational change, thus the fusion of blocking virus cyst membrane and host cell membrane and its genome is injected host cell duplicate, to reach the purpose of preventing and treating virus infection ²Polypeptide kind new medicine " thymopentin for injection (tp-5) " official listing by first synthetic of China in 1997, this new drug has immune two-ways regulation function.In a word, compare with other medicine, polypeptide drugs possess efficiently, the significant advantage of low toxicity and high specificity.

T-box gene family coding is the transcription factor family that plays a significant role in the growth of multiple animal.They are feature with the DNA land (T district) with high conservative, can combine with the distinguished sequence of the promotor of target gene.The T-box gene family comprises a plurality of subtribes, and wherein TBX2 and TBX3 belong to the TBX2 subtribe.At the DNA calmodulin binding domain CaM, it is identical that TBX2 and TBX3 have 90% sequence.Verified, TBX2 and TBX3 be overlapping expression in many tissues, mainly participates in signal transductions such as p19ARF-p53 (the human p14ARF of being) approach, regulates cell cycle and apoptosis.

Breadboard the discovering of many families, TBX2/TBX3 gene high expression in tumor tissues (comprising colorectal carcinoma, liver cancer, mammary cancer, ovarian cancer etc.) ^3,4,5,6, find that again its high expression level causes existing antitumor drug invalid simultaneously ⁷

Summary of the invention

First aspect, the invention provides the nucleic acid molecule of polypeptide that coding has anti-tumor activity, this nucleic acid molecule comprise the nucleotide sequence shown in the SEQ ID NO:1 or under tight hybridization conditions with the nucleotide sequence of the nucleotide sequence hybridization shown in the SEQ ID NO:1.

In preferred embodiments, described nucleic acid molecule comprises or is made up of the nucleotide sequence shown in the SEQ ID NO:1.In another embodiment preferred, described nucleic acid molecule contains structural domain relevant with tumour in TBX2 and/or the TBX3 gene or its part.

Second aspect the invention provides the polypeptide by nucleic acid molecule encoding of the present invention.In preferred embodiments, described polypeptide is that nucleic acid molecule of the present invention is expressed the polypeptide that is called TAP21 that produces.

The third aspect the invention provides the polypeptide that comprises the aminoacid sequence shown in the SEQ ID NO:2 or the variant or the derivative of identical function concrete with it, and described polypeptide, its variant or derivative have antineoplastic activity.

In preferred embodiments, described polypeptide comprises the aminoacid sequence shown in the SEQ ID NO:2 or is made up of SEQ ID NO:2.

Fourth aspect the invention provides recombinant vectors, and it comprises the carrier that can be operatively connected with nucleic acid molecule of the present invention.

In one embodiment, described carrier is the expression vector that is suitable for expressing nucleic acid molecule of the present invention.

In another embodiment, nucleic acid molecule of the present invention comprise the nucleotide sequence shown in the SEQ ID NO:1 or under tight hybridization conditions with the nucleotide sequence of the nucleotide sequence hybridization shown in the SEQ ID NO:1.

The 5th aspect the invention provides with nucleic acid molecule of the present invention or carrier transfection or host transformed.

In one embodiment, described host is with nucleic acid molecule of the present invention or carrier transfection or cell transformed.

The 6th aspect the invention provides medicine or pharmaceutical composition, and it comprises nucleic acid molecule of the present invention, polypeptide, carrier or the acceptable salt of its medicine, and vehicle or pharmaceutical carrier.

In one embodiment, described polypeptide is the polypeptide by nucleic acid molecule encoding of the present invention, or comprises polypeptide or the variant of identical function concrete with it or the derivative of the aminoacid sequence shown in the SEQ ID NO:2.Described polypeptide, its variant or derivative have antineoplastic activity.

The 7th aspect the invention provides the purposes of utilizing nucleic acid molecule of the present invention, polypeptide, carrier or host to prepare antitumor drug or pharmaceutical composition, and described medicine or pharmaceutical composition also comprise and vehicle or pharmaceutical carrier.

Eight aspect the invention provides the method that suppresses TBX2 in the cell and/or TBX3 genetic expression, comprises

According to TBX2 and/or TBX3 gene design non-coding RNA, RNA interfering (RNAi), antisense nucleic acid, and

Introduce described non-coding RNA, RNAi, antisense nucleic acid or its combination to described cell, thereby make TBX2 and/or the downward modulation of TBX3 expression of gene.

In one embodiment, described cell is a tumour cell.In another embodiment, described non-coding RNA, RNAi or antisense nucleic acid are at the structural domain relevant with tumour in TBX2 and/or the TBX3 gene.

The 9th aspect the invention provides described non-coding RNA, RNAi or antisense nucleic acid and the purposes in the preparation antitumor drug thereof.Described non-coding RNA, RNAi or antisense nucleic acid are at the structural domain relevant with tumour in TBX2 and/or the TBX3 gene.

The tenth aspect, the invention provides the tumour cell or the individual method for cancer of treatment that suppress individual, comprise the administration of described individuality being carried out nucleic acid molecule of the present invention, polypeptide, carrier, RNAi, antisense nucleic acid, host cell, medicine or the pharmaceutical composition of significant quantity.

Description of drawings

Fig. 1 has shown that the pET28a-TAT expression plasmid makes up collection of illustrative plates.

Fig. 2 has shown the diagram of four oligonucleotide sequence formation junction fragments.

Fig. 3 shows Nucleotide and the aminoacid sequence of peptide T AP21.

Fig. 4 shows the technological process of peptide T AP21 purifying.

Fig. 5 has shown the purity of peptide T AP21.First swimming lane is the TAP21 polypeptide, and second and third and four swimming lanes are bovine serum albumin (BSA) standard control (1 μ g, 2 μ g and 3 μ g).

Fig. 6 has shown the figure of TAP21 to the influence of tumor cell proliferation speed.

Fig. 7 has shown the influence of TAP21 to apoptosis of tumor cells.

Fig. 8 has shown that TAP21 is in vivo to the figure of the inhibition effect of tumour.Fig. 8 A is the influence of TAP21 to the tumour cell volume; Fig. 8 B is the influence of TAP21 to tumor weight; Fig. 8 C is the cardinal principle photo of TAP21 to the tumor growth influence, and lastrow is a control group, next behavior TAP21 treatment group, and obviously the gross tumor volume than control group is little for the gross tumor volume of visible treatment group.

Specific embodiments

The inventor filters out one section structural domain relevant with tumour from TBX2 and TBX3 gene, according to the polypeptide of this structural domain preparation can compete in conjunction with other albumen of this domain interaction, thereby the activity that suppresses TBX2 and/or TBX3 effectively reaches the purpose that suppresses or remove tumour cell.

Thus, on the one hand, the invention provides nucleic acid molecule, the nucleotide sequence that this nucleic acid molecule comprises the nucleotide sequence shown in the SEQ ID NO:1 or hybridizes with SEQ ID NO:1 under tight hybridization conditions.The polypeptide of described nucleic acid sequence encoding has the activity of the structural domain of TBX2 that anti-the present invention screens and/or TBX3 gene, thereby has the growth of antineoplastic activity or inhibition tumour cell.

" tight hybridization conditions " used herein or " stringency of hybridization " can be determined according to the composition of the characteristics of the residing envrionment conditions of nucleic acid, hybridizing method and used nucleic acid molecule and length.People such as Sambrook, Molecular Cloning:A Laboratory Manual (ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001) and Tijssen, Laboratory Techniques in Biochemistry and MolecularBiology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993) discussed to reaching specific stringency, the calculating of desired hybridization conditions.Hereinafter be one group of exemplary but nonrestrictive hybridization conditions:

High stringency (allowing at least 90% identical sequence hybridization)

Hybridization: 5 * SSC reaches 16 hours in 65 ℃

Washed twice: 2 * SSC reaches 15 minutes in room temperature (RT) at every turn

Washed twice: 0.5 * SSC reaches 20 minutes in 65 ℃ at every turn

High stringency (allowing at least 80% identical sequence hybridization)

Hybridization: 5 *-6 * SSC reaches 16-20 hour in 65 ℃-70 ℃

Washed twice: 2 * SSC reaches 5-20 minute in room temperature (RT) at every turn

Washed twice: 1 * SSC reaches 30 minutes in 55 ℃-70 ℃ at every turn

Low stringency (allowing at least 50% identical sequence hybridization)

Hybridization: 6 * SSC reaches 16-20 hour at RT to 55 ℃

At least washed twice: 2 *-3 * SSC reaches 20-30 minute at RT to 55 ℃ at every turn.

In a preferred embodiment of the invention, described tight hybridization conditions is a height stringency hybridization conditions, preferably high stringency hybridization conditions.In another embodiment preferred of the present invention, described nucleic acid molecule is made up of nucleotide sequence or its complementary sequence shown in the SEQ ID NO:1.

On the other hand, provide the polypeptide by nucleic acid sequence encoding of the present invention, this polypeptide has anti-tumor activity or suppresses tumor growth.In preferred embodiments, described polypeptide is the polypeptide of called after TAP21.

Again on the one hand, provide the polypeptide that has anti-tumor activity or suppress tumor growth, it comprises the aminoacid sequence shown in the SEQ ID NO:2, or the variant of its concrete identical function or derivative.

" polypeptide " of the present invention or " peptide " can be used alternatingly." polypeptide " or " peptide " is two kinds or more kinds of amino acid whose any chain, and no matter (for example, glycosylation or phosphorylation) what state comprises spontaneous generation or non-abiogenous amino acid or amino acid analogue in posttranslational modification.

In the art, can in the structure of polypeptide, carry out not changing basically the biological function of this polypeptide as everyone knows, thereby obtain the polypeptide that biology is equal to such as some modification that replaces, adds or replace and variation.

" polypeptide " of the present invention or " peptide " can include unusual connection, crosslinked and terminal cap, non-peptide bond or other modification group.These modification groups are also within the scope of the invention.Term " modification group " is meant and comprises and (for example directly be attached to described peptide structure, close by the covalency yoke) structure, and those (for example are attached to described peptide structure indirectly, by stable non-covalent connection or by amino-acid residue or its stand-in, analogue or the derivative of covalent coupling in other, it can be positioned at the flank of described core peptide structure) structure.For example, described modification group can be coupled to the N-terminal or the C-terminal of peptide structure, or is coupled to the peptide or the peptide model configuration of described core texture territory flank.Perhaps, described modification group can be coupled in the side chain of at least one amino-acid residue of peptide structure, or (for example be coupled to the peptide of described core texture territory flank or peptide simulated domain, ε amino by lysyl-residue, carboxyl by asparagicacid residue or glutaminic acid residue, by the hydroxyl of tyrosyl residue, serine residue or threonine residues, or other reactive group that is fit on amino acid side chain).Covalent coupling can be incorporated into the connectivity chemical structure by mode as known in the art and method in the modification group of described peptide structure, comprises, for example acid amides, alkylamino, carbaminate or urea bond.

In an embodiment of the invention, polypeptide of the present invention also can expand to the polypeptide that biology is equal to, or replaces the variant of the partial sequence of the peptide sequence of the present invention that obtains by conservative amino acid; Or by not influencing biological function, for example the non-conservation of described structural domain is replaced and the variant of the partial sequence of the peptide sequence of the present invention that obtains.

Term as used herein " conservative amino acid is replaced " is meant that a seed amino acid wherein can carry out described replacement to the amino acid whose replacement of another kind under the condition of not losing correlation function basically on the given position of described polypeptide.

The amino acid replacement of conservative property comprises with corresponding D-amino acid or with the amino acid of abiogenous, non-genetic coding form replaces L-amino acid, or the amino acid whose conservative property of L-is replaced.

The amino acid of the non-genetic coding of spontaneous generation comprises Beta-alanine, 3-alanine, 2,3-diaminopropionic acid, α-An Jiyidingsuan, 4-aminobutyric acid, sarcosine (sarkosine), oxyproline, ornithine, citrulline, t-butyl L-Ala, t-butyl glycine, N-methyl Isoleucine, phenylglycocoll, Cyclohexylalanine, nor-leucine, norvaline, 2-naphthyl L-Ala, the pyridyl L-Ala, 3-benzothienyl L-Ala, 4-chlorophenyl alanine, the 2-fluorophenylalanine, 3-fluorophenylalanine, 4-fluorophenylalanine, Trolovol, 1,2,3,4-tetrahydrochysene-isoquinoline 99.9-3-carboxylic acid, β-2-thienyl alanine, methionine sulfoxide, homoarginine, N-acetyllysine, the 2-aminobutyric acid, 2-aminobutyric acid, 2, the 4-DAB, p-amino-benzene L-Ala, N-methylvaline, homocysteine, homoserine, cysteic acid, epsilon-amino caproic acid, δ-aminovaleric acid or 2,3-DAB.

In certain embodiments, " guard replacement " and, material alterations can not take place thereby the technician in chemistry of peptides field will expect the secondary structure of polypeptide and wetting ability for to replace the amino acid whose replacement that another has similar characteristics with monoamino-acid.Aminoacid replacement carries out based on the similarity of polarity, electric charge, solubleness, hydrophobicity, wetting ability and/or the amphoteric character of residue usually.For example, electronegative amino acid comprises aspartic acid and L-glutamic acid; Positively charged amino acid comprises Methionin and arginine; The amino acid that has uncharged polar head group with similar hydrophilicity value comprises leucine, Isoleucine and Xie Ansuan, glycine and L-Ala, l-asparagine and glutamine, and Serine, Threonine, phenylalanine and tyrosine.On behalf of the conservative amino acid group that changes, other can comprise: (1) Ala, Pro, Gly, Glu, Asp, Gln, Asn, Ser, Thr; (2) Cys, Ser, Tyr, Thr; (3) Val, Ile, Leu, Met, Ala, Phe; (4) Lys, Arg, His; (5) Phe, Tyr, Trp, His.Variant also can maybe can contain non-conservative change with selecting.In specific embodiments, variant polypeptide is different from former sequence by 5 or still less amino acid whose replacement, disappearance or interpolation.Variant also can be modified by for example amino acid whose disappearance or interpolation (or alternatively), described amino acid whose disappearance or add the minimum that influences to immunogenicity, secondary structure and the water-based of polypeptide.

In other embodiments, the conservative property change also can comprise by for example amino acid whose sense side chain reaction, carry out chemically derived to the non-residue of deriving.Therefore, these substituting groups can comprise such compound, and its free amino is derivatized to the salt acid amide, p-tosyl group, Bian oxygen carbonyl, t-butoxy carbonyl, chloracetyl or formyl radical.Similarly, the free carboxyl formation salt of can being derived, the ester of methyl or ethyl ester or other type or hydrazine, and side chain can be derived and formed the O-acyl group or the O-alkyl derivative of free hydroxyl group, or the N-imido phenmethyl Histidine of Histidine imidazoles nitrogen.Polypeptide analog also can comprise by chemically changed; for example methylate; by such as ethamine, the alkylamine of thanomin or quadrol is to the amidation of C-end amino acid, or to the acetylize of amino acid side chain or the amino acid of methylate the acetylize of Methionin ε amino (for example to).Polypeptide derivative also can comprise with the acid amides that replaces (for example, general formula is-group of C (O)-NR, wherein R is (C ₁-C ₆) alkyl, (C ₁-C ₆) thiazolinyl, (C ₁-C ₆) alkynyl, (the C of replacement ₁-C ₆) alkyl, (the C of replacement ₁-C ₆) (the C of thiazolinyl or replacement ₁-C ₆) alkynyl) and to amido linkage replace or the isostere of amido linkage (for example ,-CH ₂NH-,-CH ₂S ,-CH ₂CH ₂-,-CH=CH-(cis and trans) ,-C (O) CH ₂-,-CH (OH) CH ₂-or-CH ₂SO-).

In one embodiment, identified polypeptide of the present invention, for example the avtive spot among the SEQ ID NO:2 with the avtive spot among the different amino acid replacement SEQ ID NO:2, for example, is replaced avtive spot 44-50's with GGGGGGG ⁴⁴L ⁴⁵F ⁴⁶P ⁴⁷Y ⁴⁸P ⁴⁹Y ⁵⁰The T aminoacid sequence, AAA replaces avtive spot ⁶⁸H ⁶⁹R ⁷⁰Obtain SEQ ID NO:17 after the H, can obtain substantially no longer to have the active variant of SEQ ID NO:2.And in another embodiment; replace or lack the amino acid in nonactive site in the SEQ ID NO:2 sequence with the amino acid of above-mentioned protection; make its secondary structure and wetting ability material alterations can not take place, thereby obtain active do not take place material change's derivative or variant.For example, at (1) Ala, Pro, Gly, Glu, Asp, Gln, Asn, Ser, Thr; (2) Cys, Ser, Tyr, Thr; (3) Val, Ile, Leu, Met, Ala, Phe; (4) Lys, Arg, His; (5) replacement between amino acid in Phe, Tyr, each group of Trp, His.Preferably, replace by conservative, replace about 1-20 amino acid in the above-mentioned avtive spot aminoacid sequence in addition, more preferably replace about 1-10 amino acid, especially preferred about 1-5 amino acid of replacing is most preferably replaced 1,2 or 3 amino acid.In an example, replace with Arg ⁵His obtains aminoacid sequence SEQ ID NO:18, and it has the identical activity with SEQ ID NO:2.In another example, replace with GG ⁵³A ⁵⁴A obtains sequence SEQ ID NO:19, and it also has the identical activity with SEQ ID NO:2.

The position of this amino acid of the digitized representation at angle in sequence on the amino acid used herein.Replace, the amino acid of specific site in the disappearance polypeptid acid sequence, thereby obtain the derivative of this polypeptide or the method for variant is well known in the art, for example, can prepare said derivative or variant by rite-directed mutagenesis such as synthetic or PCR or disappearance.Also can be referring to people such as Sambrook, the described method of Molecular Cloning:A Laboratory Manual (Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY, 2001) is carried out.

On the other hand, the invention provides recombinant vectors, it comprises the carrier that can be operatively connected with nucleic acid molecule of the present invention.In a preferred embodiment of the invention, described carrier is the expression vector that is suitable for expressing nucleic acid molecule of the present invention.

Term used herein " carrier " refers to transport the nucleic acid molecule of connected another nucleic acid.One type available support is episome (can carry out the nucleic acid of extrachromosomal replication).The available carrier is energy self-replicating and/or the carrier of expressing connected nucleic acid.Can instruct the carrier of the genetic expression that is operably connected with it to be referred to herein as " expression vector ".Usually, expression vector used in the recombinant DNA technology often adopts the form of " plasmid ", and it is often referred to circular double stranded DNA." plasmid " used herein and " carrier " can exchange use, because plasmid is the most frequently used carrier format.Yet, also comprise performance identical functions and the present expression vector of known other form in this area subsequently.

Cloning vector and expression vector all contain the nucleotide sequence that allows carrier to duplicate in one or more suitable organisms.In cloning vector, this sequence normally can make carrier not rely on the sequence of host's chromosome duplication, and also comprises replication orgin or autonomously replicating sequence.The replication orgin of various bacteriums and virus is known, includes but not limited to ColE1 replicon, P15A replicon, pCloDF13 replicon, pKN402 replicon, pMB1 (pUC) replicon, pSC101 replicon and SV40, polyomavirus, adenovirus, VSV and the BPV virus replication starting point in pBR322 source.

Can pass through recombinant expression vector, utilize nucleic acid molecule disclosed herein to produce polypeptide.Can use miscellaneous expression vector.For example, the carrier of plasmid, karyomit(e), episome and viral source, comprise the carrier that is derived from bacterial plasmid, bacteriophage, yeast episome, yeast chromosomal element, virus, described virus is such as baculovirus, papovavirus (such as SV40), vaccine virus, adenovirus, fowlpox virus, pseudorabies virus and retrovirus, and the carrier that is derived from aforesaid combination, such as the carrier that is derived from plasmid and bacteriophage gene element, as clay and phagemid.

In preferred embodiments, above-mentioned carrier includes but not limited to, pET, pBR322 (E.coli), pACYC177 (E.coli), pKT230 (Gram-negative bacteria), pGV1 106 (Gram-negative bacteria), pLAFR1 (Gram-negative bacteria), pME290 (non-E.coli Gram-negative bacteria), pHV14 (E.coli and subtilis), pBD9 (genus bacillus), pIJ61 (streptomycete), pUC6 (streptomycete), phage X (E.coli), Yip5 (yeast), YCp19 (yeast), adenovirus, slow virus or bovine papilloma virus (mammalian cell).

Usually, recombinant expression vector of the present invention can be transformed or is transfected into any host cell that is fit to, and produce described polypeptide of the present invention therein.Can be after determining host system, the method for selecting expression vector again and determining conversion or transfection.Can adopt multiple expression system.For example, can (for example, E.coli) or in the eucaryon host (for example, cereuisiae fermentum,, vegetable cell, seed or mammalian cell, for example, NIH3T3, HeLa or COS cell) produce polypeptide of the present invention at prokaryotic hosts such as the insect cell of Sf21 cell.Such cell can be from number of ways (for example, American type culture collection, Manassus, the U.S., or Chinese microbial preservation center).The bacterial expression system that is fit to polypeptide production comprise E.coli pET expression system (Novagen, Inc.), and pGEX expression system (Pharmacia).Preferred pET28a expression system.

Any by in the multiple known routine techniques inserts carrier with suitable nucleotide sequence.

Usually,, utilize the T4-DNA ligase enzyme that restricted fragment is linked together subsequently, nucleotide sequence to be expressed is connected in expression vector by with one or more limiting acid endo enzyme cutting nucleotide sequence and expression vector.Be used for that restricted cutting and the method that is connected be known in the art.Relevant this proper method and the proper method of utilizing the substitute technology construction of expression vector, described substitute technology also is known in this area, at Sambrook et al., Molecular Cloning:A Laboratory Manual (molecular cloning: laboratory manual), the third edition, 1-3 volume, Cold Spring Harbor, among the New York (2000), very detailed description is arranged.The limiting examples of these substitute technologies comprises, for example, incorporates nucleotide sequence into by recombinase or topoisomerase.

Synthetic, the flat terminal routine techniques that connects or connect in restriction enzyme sites of utilization such as PCR, DNA can the modification of nucleic acids sequence or connect together.If do not have suitable restriction site, then can utilize the fit or connexon (consult, for example Sambrook et al. is the same) of synthetic oligonucleotide.

It will be appreciated by those of ordinary skill in the art that many promotors can bring into play function in cell, and existing in the literature the description, comprise that composition, inducibility, growth adjusting and environment regulate promotor.Promotor (the being also referred to as transcription initiation region) particularly advantageous of use performance function in suitable host.For example, if as the host, operable exemplary promotor includes but not limited to phage PL promotor, E.coli lac, trp, trc and tac promotor, SV40 is early stage and late promoter, retrovirus LTRs promotor and CaMV 35S promoter with E.coli.If yeast saccharomyces cerevisiae is the host, then aim sequence is subjected to the regulation and control of Yeast promoter usually.The limiting examples of available Yeast promoter comprises the GAL/CYC promotor.

Do not mentioned herein, the known any suitable promotor of those of ordinary skills, can be used for the present invention as herein described at an easy rate.For example, can use other promotor of genetic expression in known regulation and control protokaryon or the eukaryotic cell.Expression vector also can contain the ribosome bind site and the Transcription Termination site of translation initiation.Carrier also can contain and can be used for the sequence that amplification gene is expressed.

In embodiments of the present invention, described promotor is operably connected to the nucleic acid encoding molecule.

Term used herein " is operably connected " and means selected nucleotide sequence (as the polypeptide as herein described of encoding) closely near promotor, regulates the expression of selected nucleic acid molecule or DNA to allow promotor.In addition, transcribing and translating on the direction, promotor is positioned at the upstream of selected nucleotide sequence.So-called " being operably connected " means, and when suitable molecule (as transcription activating protein) when being incorporated into regulating and controlling sequence, the mode of connection of nucleotide sequence and this regulating and controlling sequence makes that gene is expressed.

Also can in expression construct or carrier, provide transcription termination region.Transcription termination region can be provided by the carrier sequence of coding Ole protein sequence, or use and the natural relevant transcription termination region of transcription initiation region.Can in host organisms, stop any transcription termination region easily of transcribing, may be used in the construct disclosed herein.Expression vector and cloning vector can, and usually contain really and have structure gene or the selective marker that is used for the necessary regulatory region of expressing, so that select transformant the host.Gene can provide the resistance of pair cell toxic agents (as microbiotic, heavy metal or toxin), complementarity, virus immunity of prototroph etc. are provided for the auxotroph host.The quantity that depends on the different host species of having introduced expression construct or its component can be used one or more marks, wherein for different hosts, adopts different selection conditions.

Concrete, the limiting examples of suitable selective marker comprise the gene of giving at the resistance of following substances: bleomycin, erythromycin, gentamicin, glyphosate, Totomycin, kantlex, methotrexate, Nalidixic Acid, phleomycin, careless ammonium phosphine (phosphinotricin), spectinomycin, Streptomycin sulphate, sulfonamide, sulfonylurea, penbritin/Pyocianil, paraxin, Streptomycin sulphate/spectinomycin or tsiklomitsin.Another example of suitable selective marker is the auxotroph selectable marker gene, such as the Histidine selectable marker gene.Concrete, the limiting examples of mark include but not limited to alkaline phosphatase (AP), myc, hemagglutinin (HA), 13 glucuronidases (GUS), luciferase and green fluorescent protein (GFP).Preferably, isolating nucleic acid also comprises and nucleic acid encoding link coupled selective marker.Selective marker can be penbritin/Pyocianil resistance, kalamycin resistance, chlorampenicol resistant, erythromycin resistance, Streptomycin sulphate/spectinomycin resistance or histidine auxotroph selectable marker gene.

Another aspect of the present invention relates to non-coding RNA, RNAi, antisense nucleic acid, and it can reduce TBX2 and/or TBX3 expression of gene.

" RNAi molecule " of the present invention is general terms, refers to double stranded rna molecule, comprises siRNA (siRNA), hairpin RNA (shRNA) and other RNA molecule that cuts into siRNA in vivo.The RNAi molecule can comprise the long segment of identical with target nucleic acid sequence or essentially identical double-stranded RNA (dsRNA) molecule, or only with the identical or essentially identical dsRNA short-movie in a zone section of target nucleic acid sequence.

In one embodiment, described RNAi is siRNA.Molecule is synthetic with two strands usually, and wherein every chain length is about 19-30 Nucleotide, preferred 20-25 Nucleotide.SiRNA can be understood that the nucleic acid oligomer combined enzyme agent, and by matching with distinguished sequence described complex body is guided to said target mrna, thereby causes said target mrna by the nuclease degradation in the protein complexes.

In another embodiment, described RNAi is shRNA.ShRNA can be exogenous synthetic, or can be formed by the rna plymerase iii promoter transcription in vivo.

Preferably, described RNAi molecule or antisense nucleic acid are at the structural domain relevant with tumour in TBX2 and/or the TBX3 gene.More preferably, described RNAi molecule at structural domain identical with TBX2 and/or TBX3 gene structure territory that polypeptide of the present invention is suppressed.

Another aspect of the present invention relates to described polypeptide, nucleic acid molecule, RNAi, antisense nucleic acid or carrier (being also referred to as compound of the present invention or the active compound) purposes in preparation medicine, polypeptide drugs or pharmaceutical composition, described medicine, polypeptide drugs or pharmaceutical composition are used for the treatment of and/or prevent the tumour of individuality, preferred malignant tumour or cancer.Described polypeptide, nucleic acid molecule, RNAi, antisense nucleic acid or carrier can be formulated into medicine or pharmaceutical composition with liposome, vehicle or pharmaceutical carrier.

Another aspect of the present invention relates to the tumour that treats and/or prevents individuality, preferred malignant tumour or method for cancer, described method comprises the administration of described individuality being carried out described polypeptide, nucleic acid molecule, RNAi, antisense nucleic acid, carrier, polypeptide drugs or the composition of significant quantity.

In embodiments of the invention, described tumour or cancer be selected from liver cancer, cancer of the stomach, colorectal carcinoma, carcinoma of the pancreas, mammary cancer, such as osteosarcomatous sarcoma, leukemia, ovarian cancer, carcinoma of ureter, bladder cancer, prostate cancer, lymphoma, multiple myeloma, carcinoma of the pancreas, kidney, internal secretion gland cancer, skin carcinoma, melanoma, vascular tumor and brain or central nervous system cancer.In preferred embodiments, described cancer is liver cancer, cancer of the stomach, colorectal carcinoma, mammary cancer, lung cancer.Described cancer can primary tumo(u)r, also can be metastatic cancer.

In embodiments of the invention, described polypeptide drugs or pharmaceutical composition can be to be suitable for mammalian subject, the appropriate form of administrations such as people, monkey, pig, horse, ox, sheep, dog, rat, mouse, cavy, rabbit, cat for example, can (for example provide active compound of the present invention separately, described polypeptide, nucleic acid molecule, RNAi, antisense nucleic acid or express the carrier of described nucleic acid molecule) or provide with other compound (for example, nucleic acid molecule, small molecules, polypeptide, peptide or peptide analogs) combination.If necessary, the medicine or the means of active compound of the present invention and multiple tradition and existing treatment cancer can be united use, for example unite use with chemotherapeutics and/or radiotherapy.

In one embodiment, the antitumor and anticancer agent of uniting use with active compound of the present invention is selected from: cis-platinum; Carboplatin; Endoxan; Melphalan (alkeran); Carmustine; Methotrexate; 5 FU 5 fluorouracil; Cytosine arabinoside; Purinethol; Daunorubicin; Zorubicin; Pidorubicin; Vincaleucoblastine; Vincristine(VCR); Actinomycin; Ametycin; Taxol; Leunase; Granulocyte colony-stimulating factor G-CSF; Etoposide; Colchicine; Methylsulfonic acid; And camptothecine.

Thereby can use conventional pharmaceutical methods to provide suitable pharmaceutical preparation or composition to suffering from the individuality of cancer, preferred people carries out the administration of described compound or described medicine.Can adopt be fit to arbitrarily, for example in parenteral, vein, subcutaneous, muscle, encephalic, the socket of the eye, eye, intraventricular, the capsule, in the backbone, in the brain pond, endoperitoneal, nose is interior, aerosol or oral administration method.Pharmaceutical preparation or prescription can be liquor or suspension; Tablet or capsule; Powder, nasal drop or aerosol form.

The method for preparing described preparation is well known in the art.The prescription that is suitable for parenterai administration can contain, for example, excipient, aqua sterilisa, or salt solution, such as the polyalkylene glycol of polyoxyethylene glycol, the oil of plant origin, or hydrogenant naphthalene.Also can adopt biological coupling, biodegradable lactide polymer, lactide/co-glycolide polymers or polyoxyethylene-polyoxypropylene multipolymer control the release of described compound.The system that other potential is used to regulate the non-enteron aisle transmission of compound comprises ethylene-vinyl acetate copolymer particle, osmotic pump, implantable filling system and liposome.The prescription that is suitable for sucking can comprise excipient, and for example lactose maybe can be to contain for example aqueous solution of polyoxyethylene-9-laurate, glycocholate and deoxycholate salt, maybe can be with the oily solution of nasal drop form administration or as gel.For therapeutic or prophylactic compositions, can be enough to end or the amount that delays tumor cell proliferation to the described compound of individual administration.

Term used herein " significant quantity " comprises treatment significant quantity or prevention significant quantity." treatment or prevention significant quantity " is meant the significant quantity on dosage, and in essential time phase, reaches needed treatment or prevention result.Under normal conditions, phrase " treatment significant quantity " is to be enough to realize expected response or to improve for example transfer or primary tumo(u)r progress, size or the symptom of growth or the amount of indication.Treatment significant quantity at particular individual can be according to individual morbid state, holistic health, medication, approach and dosage and the factors vary such as severity of side effect of for example receiving treatment.When in combination, the treatment significant quantity is that the ratio and the effect of relative combination of components is not limited to one-component.

The treatment significant quantity of nucleic acid molecule of the present invention, polypeptide, antisense nucleic acid, RNAi, medicine or pharmaceutical composition can be improved cancer symptoms usually at least about 10%; Usually at least about 20%; Preferably at least about 30%; Or more preferably at least about 50%.The inhibition of cancer metastasis refers to that the migration of tumour cell or transfer are affected or suppress.This will cause the statistics of influenced cell number for example significant or can quantitatively change, for example, and the minimizing of affected target cell number in for some time or in the target region.Can also monitor speed, size, diffusion or the growth of primary tumo(u)r progress.

The preferred therapeutic of activeconstituents of the present invention or compound or prevention significant quantity scope can be 0.1nM-0.1M, 0.1nM-0.05M, 0.5nM-15 μ M, 1nM-10 μ M or 10nM-1 μ M and arbitrary integer wherein.

Further specify embodiment of the present invention with the following example, but going up the qualification that all should not be construed as its scope in all senses.

Embodiment

The structure of embodiment 1 expression plasmid

(Novagen Inc.) on the basis, inserts and is convenient to the HA label of immunohistochemical experiment and is convenient to the TAT signal peptide that polypeptide expressed is passed cytolemma at expression vector pET28a.

At first design a connecting piece section.For producing this junction fragment, earlier synthetic 4 groups of oligonucleotide connect (mode of connection is referring to Fig. 2) in the mode of joining end to end then.Concrete Connection Step comprises: mix 4 groups of oligonucleotide chains by equal proportion,

1.TATGTATCCATATGACGTCCCAGAC(SEQ?ID?NO：7)

2.TATGCCGGCGGCAGGAAGAAGCGGAGACAGCGACGAAGAG(SEQ?ID?NO：8)

3.GATCCTCTTCGTCGCTGTCTCCGCTTC(SEQ?ID?NO：9)

4.TTCCTGCCGCCGGCATAGTCTGGGACGTCATATGGATACA(SEQ?ID?NO：10)；

95 ℃ of sex change 10min slowly cooled to room temperature through 6 hours then, formed the two ends that have two restriction enzyme sites (NdeI and BamHI) at last and were sticking terminal double-stranded joint:

The forward sequence:

5’-tatgtatcca?tatgacgtcc?cagactatgc?cggcggcagg?aagaagcggagacagcgacg?aagag-3’(SEQ?ID?NO：13)

Reverse sequence:

5’-gatcctcttc?gtcgctgtct?ccgcttcttc?ctgccgccgg?catagtctgg?gacgtcatatggataca-3’(SEQ?ID?NO：14)。

This two strands joint and is connected with pET28a carrier after the BamHI enzyme is cut through NdeI, and called after pET28a-TAT (referring to: Fig. 1).

In order to clone the gene fragment from TBX2 and TBX3, (SEQ ID NO:1) at first prepares the PCR primer according to disclosed nucleotide sequence:

5’-CGCGGATCCCTGTTCCCTTACCCCTAC-3’(SEQ?ID?NO：11)

5’-CCGCTCGAGTTAGCGCAGCCGCGGGCGCAT-3’(SEQ?IDNO：12)

Then, the cDNA (SEQ ID NO:3 and SEQID NO:4) that utilizes existing TBX3 or TBX2 carries out the PCR reaction as template, amplifies the product (SEQ IDNO:15) of 141bp.Cut fragment and the carrier that digestion is increased through BamHI and XhoI enzyme, with enzyme cut, fragment (SEQ ID NO:16) behind the purifying is inserted carrier (referring to: Fig. 3), form recombinant expression vector, called after pET28a-TAT-TAP21.According to the nucleotide sequence that this carrier desire is expressed, the polypeptide of its generation is in advance in respect of 83 amino acid, and molecular weight is 9kDa.

The fragment sequence of amplification is as follows:

5’CGCGGATCCCTGTTCCCTTACCCCTACACGTACATGGCCGCAGCGGCGGCCGCCTCCTCTGCGGCAGCCTCCAGCTCGGTGCACCGCCACCCCTTCCTCAATCTGAACACCATGCGCCCGCGGCTGCGCTAACTCGAGCGG3’(SEQ?ID?NO：15)

Fragment was as follows after enzyme was cut:

5’ GATCCCTGTTCCCTTACCCCTACACGTACATGGCCGCAGCGGCGGCCGCCTCCTCTGCGGCAGCCTCCAGCTCGGTGCACCGCCACCCCTTCCTCAATCTGAACACCATGCGCCCGCGGCTGCGC TAA C3’(SEQ?ID?NO：16)

Embodiment 2 is at expression in escherichia coli recombinant polypeptide TAP21

Expression vector pET28a-TAT-TAP21 is imported intestinal bacteria BL-21 (DE3), cultivate described transformant, come express polypeptide TAP21 and obtain endosome with the 3L volume.The endosome that is obtained is dissolved in 50 milliliters lysis buffer (8M urea, 20mMNaH ₂PO ₄, 500mM NaCl), centrifugal acquisition supernatant liquor.Then, utilize the peptide T AP21 (referring to Fig. 4) of the chromatography purification His label of Ni post (Qiagen) and PD10 post (GE).Coomassie blue dyeing shows that this polypeptide molecular weight is about 9kDa, and purity is about 95% (referring to Fig. 5).

The inhibition growth of tumour cell of embodiment 3 peptide T AP21

Biological activity at vitro detection peptide T AP21.Adopt MTT (USB) detection method to detect the cell proliferation situation, earlier with 3X10 ³Tumor cell of liver BEL7404 and HepG2 (ATCC) are inoculated into 96 well culture plates, cultivate after one day, add the TAP21 polypeptide of different concns (concrete concentration is shown in Fig. 6 A and 6B) and the TAP21 (TAPm, SEQ IDNO:17) of inactivation sudden change, and with PBS (control) in contrast.After one day, in treating gaging hole, add MTT, select the 490nm wavelength to detect light absorption value, the record result.With concentration is X-coordinate, and light absorption value is that ordinate zou is drawn cell growth curve, and the result is shown in Fig. 6 A and 6B.In another experiment, every day, replacing contained the nutrient solution of 20 μ M polypeptide (TAP21 and TAPm), and with PBS in contrast, cultivated 3 days.During this time, in treating gaging hole, add MTT every day, select the 490nm wavelength to detect light absorption value, the record result.With time is X-coordinate, and light absorption value is that ordinate zou is drawn cell growth curve, and the result is shown in Fig. 6 C and 6D.From Fig. 6 A-6D as seen, compare with control group, the level of variation is tangible (BEL7404p＜0.001; HepG2p＜0.0005).These results prove that TAP21 has the inhibition effect of intensive dosage and time-dependent manner to BEL7404 and HepG2 tumor cell proliferation.According to same experimental technique, (DLD-1 also detects on SW620), has all obtained the effect of identical inhibition tumour cell at colon-cancer cell.

Annexin V-FITC (Invitrogen) apoptosis detection method is a kind of detection method that appears at the phosphatidyl serine of surface of cell membrane when being used for detecting apoptosis.Method is as follows: above-mentioned tumor cell inoculation to 12 porocyte culture plates, is cultivated after one day, added 10 μ MTAP21 and cultivate after 6 hours, handle with pancreatin, collecting cell, PBS cleans once, with cell and Annexin V-FITC, the PI temperature is bathed 15min, uses flow cytometry analysis then.With HepG2 is example, and the TAPm control group data of TAP21 treatment group and same concentrations are 55% and 10% (Fig. 7 A).The experimental result of BEL7404 is shown in Fig. 7 B.Other tumour cell has also been observed similar experimental result.These experiment showed, that TAP21 can effectively promote the apoptosis of tumour cell.

Assess the biological activity of TAP21 in vivo.Promptly at NOD/SCID mouse (CUHKLASEC) back subcutaneous injection 2x10 ⁶Tumour cell BEL7404, totally ten two mouse are divided into two groups at random, and one group is control group, injection PBS; One group is the treatment group, injection TAP21.When gross tumor volume is 50mm ³About, beginning continues 10 days at tumor locus in-situ injection polypeptide or PBS, injects 100 μ g TAP21 or equal-volume PBS every day.After 10 days, after stopping to inject, continue to measure 10 days.The tumour size was measured at wherein every interval in 3 days, and the record result is an X-coordinate with time, and volume is that ordinate zou is drawn tumor growth curve.Treat after 20 days, take out tumor tissues, weigh, the record result.From Fig. 8 as seen, compare with control group, injection TAP21 group mouse, tumor size, weight obviously reduce, and change level is tangible (P＜3.3X10 ^-5).Other tumour cell has also been observed similar experimental result in the body experiment.

The invention provides a segment structure territory and the thus obtained polypeptide relevant in coding TBX2 and the TBX3 gene as above experiment showed, with tumour.This peptide T AP21 has 83 amino acid, and molecular weight is 9kDa.Successfully expressed described polypeptide intestinal bacteria, and found that polypeptide expressed can suppress tumour cell propagation in vitro and in vivo effectively.Therefore, determine to utilize peptide T AP21 as the effective antitumour medicine.

Embodiment 4

Prepare SEQ ID NO:18 and SEQ ID NO:19 by the method that waits point mutation, and replace TAP21, repeat above-mentioned experiment, also the similar experimental result of Huo Deing with SEQ ID NO:18 or SEQ ID NO:19.

It will be understood by those skilled in the art that can arbitrary combination various embodiments mentioned above, so that other embodiment is provided.And, under the prerequisite of spirit of the present invention, can make suitable modification and replacement to element, step, the feature of above-mentioned embodiment, obtain its equivalent embodiments.

Reference:

1.Carmona?etal.，2005，Natural?resistance-associated?mutations?to?Enfuvirtide(T20)and?polymorphisms?in?the?gp41?region?of?different?HIV-1?genetic?forms?from?T20?naivepatients.J?Clin?Virol?32，248-253.

2.Bo-Jian?Zheng，Yi?Guan，Ming-Liang?He，Hongzhe?Sun，Lanying?Du，YingZheng，Kin-Ling?Wong，Honglin?Chen，Ying?Chen，Linyu?Lu，Julian?A?Tanner，Rory?MWatt，Neri?Niccolai，Andrea?Bernini，Ottavia?Spiga，Patrick?CY?Woo，Hsiang-fu?Kung，Kwok-Yung?Yuen，Jian-Dong?Huang(2005)Synthetic?peptides?outside?the?spikeprotein?hepted?repeat?regions?as?potent?inhibitors?of?SARS-associated?coronavirus.AtiviralTherapy?10：375-385.

3.Fan?etal.，2004，TBX3?and?its?isoform?TBX3+2a?are?functionally?distinctive?ininhibition?of?senescence?and?are?overexpressed?in?a?subset?of?breast?cancer?cell?lines.Cancer?Res.2004?Aug?1；64(15)：5132-9.

4.Vance?etal.，2005，Tbx2?is?overexpressed?and?plays?an?important?role?inmaintaining?proliferation?and?suppression?of?senescence?in?melanomas.Cancer?Res.2005Mar?15；65(6)：2260-8.

5.Ito?etal.，2005，Tbx3?expression?is?related?to?apoptosis?and?cell?proliferation?in?ratbladder?both?hyperplastic?epithelial?cells?and?carcinoma?cells.Cancer?Lett.2005?Feb28；219(1)：105-12.

6.Davis?etal.，2008，Ectopic?Tbx2?expression?results?in?polyploidy?and?cisplatinresistance.Oncogene?27，976-984.

Sequence table

＜110〉Hong Kong Chinese University

＜120〉antineoplastic nucleic acid and polypeptide and application thereof

<130>09C11055CN

<160>19

<170>PatentIn?version?3.3

<210>1

<211>249

<212>DNA

<213>cDNA?of?TBX2/TBX3?domain

<400>1

atgggcagca?gccatcatca?tcatcatcac?agcagcggcc?tggtgccgcg?cggcagccat 60

atgtatccat?atgacgtccc?agactatgcc?ggcggcagga?agaagcggag?acagcgacga 120

agaggatccc?tgttccctta?cccctacacg?tacatggccg?cagcggcggc?cgcctcctct 180

gcggcagcct?ccagctcggt?gcaccgccac?cccttcctta?atctgaacac?catgcgcccg 240

cgcctgcgc 249

<210>2

<211>83

<212>PRT

<213>peptide?encoded?by?TBX2/TBX3?domain?cDNA(TAP21)

<400>2

Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro

1 5 10 15

Arg?Gly?Ser?His?Met?Tyr?Pro?Tyr?Asp?Val?Pro?Asp?Tyr?Ala?Gly?Gly

20 25 30

Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Gly?Ser?Leu?Phe?Pro?Tyr?Pro

35 40 45

Tyr?Thr?Tyr?Met?Ala?Ala?Ala?Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser

50 55 60

Ser?Ser?Val?His?Arg?His?Pro?Phe?Leu?Asn?Leu?Asn?Thr?Met?Arg?Pro

65 70 75 80

Arg?Leu?Arg

<210>3

<211>4754

<212>DNA

<213>TBX3

<400>3

gaattctaga?ggcggcggag?ggtggcgagg?agctctcgct?ttctctcgct?ccctccctct 60

ccgactccgt?ctctctctct?ctctctctct?ctcccctccc?tctctttccc?tctgttccat 120

tttttccccc?tctaaatcct?ccctgccctg?cgcgcctgga?cacagattta?ggaagcgaat 180

tcgctcacgt?tttaggacaa?ggaagagaga?gaggcacggg?agaagagccc?agcaagattt 240

ggattgaaac?cgagacaccc?tccggaggct?cggagcagag?gaaggaggag?gagggcggcg 300

aacggaagcc?agtttgcaat?tcaagttttg?atagcgctgg?tagaaggggg?tttaaatcag 360

attttttttt?ttttaaagga?gagagacttt?ttccgctctc?tcgctccctg?ttaaagccgg 420

gtctagcaca?gctgcagacg?ccaccagcga?gaaagaggga?gaggaagaca?gatagggggc 480

gggggaagaa?gaaaaagaaa?ggtaaaaagt?cttctaggag?aacctttcac?atttgcaaca 540

aaagacctag?gggctggaga?gagattcctg?ggacgcaggg?ctggagtgtc?tatttcgagc 600

tcagcggcag?ggctcgggcg?cgagtcgaga?ccctgctcgc?tcctctcgct?tctgaaaccg 660

acgttcagga?gcggcttttt?aaaaacgcaa?ggcacaagga?cggtcacccg?cgcgactatg 720

tttgctgatt?tttcgccttg?ccctctttaa?aagcggcctc?ccattctcca?aaagacactt 780

cccctcctcc?ctttgaagtg?cattagttgt?gatttctgcc?tccttttctt?ttttctttct 840

tttttgtttt?gctttttccc?cccttttgaa?ttatgtgctg?ctgttaaaca?acaacaaaaa 900

aacaacaaaa?cacagcagct?gcggacttgt?ccccggctgg?agcccagcgc?cccgcctgga 960

gtggatgagc?ctctccatga?gagatccggt?cattcctggg?acaagcatgg?cctaccatcc 1020

gttcctacct?caccgggcgc?cggacttcgc?catgagcgcg?gtgctgggtc?accagccgcc 1080

gttcttcccc?gcgctgacgc?tgcctcccaa?cggcgcggcg?gcgctctcgc?tgccgggcgc 1140

cctggccaag?ccgatcatgg?atcaattggt?gggggcggcc?gagaccggca?tcccgttctc 1200

ctccctgggg?ccccaggcgc?atctgaggcc?tttgaagacc?atggagcccg?aagaagaggt 1260

ggaggacgac?cccaaggtgc?acctggaggc?taaagaactt?tgggatcagt?ttcacaagcg 1320

gggcaccgag?atggtcatta?ccaagtcggg?aaggcgaatg?tttcctccat?ttaaagtgag 1380

atgttctggg?ctggataaaa?aagccaaata?cattttattg?atggacatta?tagctgctga 1440

tgactgtcgt?tataaatttc?acaattctcg?gtggatggtg?gctggtaagg?ccgaccccga 1500

aatgccaaag?aggatgtaca?ttcacccgga?cagccccgct?actggggaac?agtggatgtc 1560

caaagtcgtc?actttccaca?aactgaaact?caccaacaac?atttcagaca?aacatggatt 1620

tactatattg?aactccatgc?acaaatacca?gccccggttc?cacattgtaa?gagccaatga 1680

catcttgaaa?ctcccttata?gtacatttcg?gacatacttg?ttccccgaaa?ctgaattcat 1740

cgctgtgact?gcataccaga?atgataagat?aacccagtta?aaaatagaca?acaacccttt 1800

tgcaaaaggt?ttccgggaca?ctggaaatgg?ccgaagagaa?aaaagaaaac?agctcaccct 1860

gcagtccatg?agggtgtttg?atgaaagaca?caaaaaggag?aatgggacct?ctgatgagtc 1920

ctccagtgaa?caagcagctt?tcaactgctt?cgcccaggct?tcttctccag?ccgcctccac 1980

tgtagggaca?tcgaacctca?aagatttatg?tcccagcgag?ggtgagagcg?acgccgaggc 2040

cgagagcaaa?gaggagcatg?gccccgaggc?ctgcgacgcg?gccaagatct?ccaccaccac 2100

gtcggaggag?ccctgccgtg?acaagggcag?ccccgcggtc?aaggctcacc?ttttcgctgc 2160

tgagcggccc?cgggacagcg?ggcggctgga?caaagcgtcg?cccgactcac?gccatagccc 2220

cgccaccatc?tcgtccagca?ctcgcggcct?gggcgcggag?gagcgcagga?gcccggttcg 2280

cgagggcaca?gcgccggcca?aggtggaaga?ggcgcgcgcg?ctcccgggca?aggaggcctt 2340

cgcgccgctc?acggtgcaga?cggacgcggc?cgccgcgcac?ctggcccagg?gccccctgcc 2400

tggcctcggc?ttcgccccgg?gcctggcggg?ccaacagttc?ttcaacgggc?acccgctctt 2460

cctgcacccc?agccagtttg?ccatgggggg?cgccttctcc?agcatggcgg?ccgctggcat 2520

gggtcccctc?ctggccacgg?tttctggggc?ctccaccggt?gtctcgggcc?tggattccac 2580

ggccatggcc?tctgccgctg?cggcgcaggg?actgtccggg?gcgtccgcgg?ccaccctgcc 2640

cttccacctc?cagcagcacg?tcctggcctc?tcagggcctg?gccatgtccc?ctttcggaag 2700

cctgttccct?tacccctaca?cgtacatggc?cgcagcggcg?gccgcctcct?ctgcggcagc 2760

ctccagctcg?gtgcaccgcc?accccttcct?caatctgaac?accatgcgcc?cgcggctgcg 2820

ctacagcccc?tactccatcc?cggtgccggt?cccggacggc?agcagtctgc?tcaccaccgc 2880

cctgccctcc?atggcggcgg?ccgcggggcc?cctggacggc?aaagtcgccg?ccctggccgc 2940

cagcccggcc?tcggtggcag?tggactcggg?ctctgaactc?aacagccgct?cctccacgct 3000

ctcctccagc?tccatgtcct?tgtcgcccaa?actctgcgcg?gagaaagagg?cggccaccag 3060

cgaactgcag?agcatccagc?ggttggttag?cggcttggaa?gccaagccgg?acaggtcccg 3120

cagcgcgtcc?ccgtagaccc?gtcccagaca?cgtcttttca?ttccagtcca?gttcaggctg 3180

ccgtgcactt?tgtcggatat?aaaataaacc?acgggcccgc?catggcgtta?gcccttcctt 3240

ttgcagttgc?gtctgggaag?gggccccgga?ctccctcgag?agaatgtgct?agagacagcc 3300

cctgtcttct?tggcgtggtt?tatatgtccg?ggatctggat?cagattctgg?gggctcagaa 3360

acgtcggttg?cattgagcta?ctgggggtag?gagttccaac?atttatgtcc?agagcaactt 3420

ccagcaaggc?tggtctgggt?ctctgcccac?caggcgggga?ggtgttcaaa?gacatctccc 3480

tcagtgcgga?tttatatata?tatttttcct?tcactgtgtc?aagtggaaac?aaaaacaaaa 3540

tctttcaaaa?aaaaaatcgg?gacaagtgaa?cacattaaca?tgattctgtt?tgtgcagatt 3600

aaaaacttta?tagggacttg?cattatcggt?tctcaataaa?ttactgagca?gctttgtttg 3660

gggagggaag?tccctaccat?ccttgtttag?tctatattaa?gaaaatctgt?gtctttttaa 3720

tattcttgtg?atgttttcag?agccgctgta?ggtctcttct?tgcatgtcca?cagtaatgta 3780

tttgtggttt?ttattttgaa?cgcttgcttt?tagagagaaa?acaatatagc?cccctaccct 3840

tttcccaatc?ctttgccctc?aaatcagtga?cccaagggag?ggggggattt?aaagggaagg 3900

agtgggcaaa?acacataaaa?tgaatttatt?atatctaagc?tctgtagcag?gattcatgtc 3960

gttctttgac?agttctttct?ctttcctgta?tatgcaataa?caaggtttta?aaaaaataat 4020

aaagaagtga?gactattaga?caaagtattt?atgtaattat?ttgataactc?ttgtaaatag 4080

gtggaatatg?aatgcttgga?aaattaaact?ttaatttatt?gacattgtac?atagctctgt 4140

gtaaatagaa?ttgcaactgt?caggttttgt?gttcttgttt?tcctttagtt?gggtttattt 4200

ccaggtcaca?gaattgctgt?taacactaga?aaacacactt?cctgcaccaa?caccaatacc 4260

ctttcaaaag?agttgtctgc?aacatttttg?ttttcttttt?taatgtccaa?aagtggggga 4320

aagtgctatt?tcctattttc?accaaaattg?gggaaggagt?gccactttcc?agctccactt 4380

caaattcctt?aaaatataac?tgagattgct?gtggggaggg?aggagggcag?aggctgcggt 4440

ttgacttttt?aatttttctt?ttgttatttg?tatttgctag?tctctgattt?cctcaaaacg 4500

aagtggaatt?tactactgtt?gtcagtatcg?gtgttttgaa?ttggtgcctg?cctatagaga 4560

tatattcaca?gttcaaaagt?caggtgctga?gagatggttt?aaagacaaat?tcatgaaggt 4620

atattttgtg?ttatagttgt?tgatgagttc?tttggttttc?tgtatttttc?cccctctctt 4680

taaaacatca?ctgaaatttc?aataaatttt?tattgaaatg?tctaaaaaaa?aaaaaaaaaa 4740

aaaaaaaaaa?aaaa 4754

<210>4

<211>3396

<212>DNA

<213>TBX2

<400>4

cagagatcac?gacaagatct?aaccagtcgc?gcgtggtccc?cggcgccgga?gcgggccagc 60

tcagcccggc?ccagcccggc?cccgcgcaga?gcccccgccg?cccccgcgca?cagagccggg 120

tgccccttgc?ggtgcgccgg?acgggaagcc?ccgaggagca?gctgctgcgc?ccgccacccg 180

ggtcgtccgt?ccaccgcgcg?cgccgccgcc?cgggccgggg?gtccgagccg?cgcgcccccg 240

gccccggccc?cggcccccgg?gcgcctgggc?cggatgtccc?gatgagagag?ccggcgctgg 300

cggccagcgc?catggcttac?cacccgttcc?acgcgccacg?gcccgccgac?ttccccatgt 360

ccgcctttct?ggcggcggcg?cagccctcct?tcttcccggc?actcgcgctg?ccgcccggcg 420

cgctggccaa?gccgctgccc?gacccgggcc?tggcgggggc?ggcggccgcg?gcggcggcgg 480

cggcagcagc?ggccgaggcg?gggctgcacg?tctcggcact?gggcccgcac?ccgcccgccg 540

cgcatctgcg?ctccctcaag?agcctggagc?ccgaggacga?ggtggaggac?gaccccaagg 600

tgacgctgga?ggccaaggag?ctgtgggacc?agttccacaa?gctaggcacg?gagatggtca 660

tcaccaagtc?cgggaggcgg?atgttccccc?ccttcaaggt?gcgagtcagc?ggcctggaca 720

agaaggccaa?gtatatcctg?ctgatggaca?ttgtagccgc?tgacgattgc?cgctataagt 780

tccacaactc?gcgctggatg?gtggcgggca?aggccgaccc?tgagatgccc?aaacgcatgt 840

acatccaccc?agacagccca?gccacggggg?agcagtggat?ggctaagcct?gtggccttcc 900

acaagctgaa?gctgaccaac?aacatctctg?acaagcacgg?cttcaccatc?ctaaactcca 960

tgcacaagta?ccagccgcgc?ttccacatag?tgcgagccaa?cgacatcctg?aagctgcctt 1020

acagcacctt?ccgcacctac?gtgttcccgg?agaccgactt?catcgccgtc?actgcctacc 1080

agaatgacaa?gatcacacag?ctgaagatcg?acaacaaccc?gtttgccaag?ggcttccggg 1140

acaccgggaa?cggccggcgg?gagaaaagga?agcagctgac?gctgccgtct?ctacgcttgt 1200

acgaggagca?ctgcaaaccc?gagcgcgatg?gcgcggagtc?agacgcctcg?tcgtgcgacc 1260

ctccccccgc?gcgggaacca?cccacctccc?cgggcgcagc?gcccagtccg?ctgcgcctgc 1320

accgggcccg?agctgaggag?aagtcgtgcg?ccgcggacag?cgacccggag?cctgagcggt 1380

tgagcgagga?gcgtgcgggg?gcgccgctag?gccgcagccc?ggctccagac?agcgccagcc 1440

ccactcgctt?gaccgaaccc?gagcgcgccc?gggagcggcg?tagtcccgag?aggggcaagg 1500

agccggccga?gagcggcggg?gacggcccgt?tcggcctgag?gagcctggag?aaggagcgcg 1560

ccgaagctcg?gaggaaggac?gaggggcgca?aggaggcggc?cgagggcaag?gagcagggcc 1620

tggcgccgct?ggtggtgcag?acagacagtg?cgtcccccct?gggcgccgga?cacctgcccg 1680

gcctggcctt?ttccagccac?ttgcacgggc?agcagttctt?tgggccgctg?ggagccggcc 1740

agccgctctt?cctgcaccct?ggacagttca?ccatgggccc?tggcgccttc?tccgccatgg 1800

gcatgggtca?cctactggcc?tcggtggcag?gcggcggcaa?cggcggaggt?ggcgggcctg 1860

ggaccgccgc?ggggctggac?gcaggcgggc?tgggtcccgc?ggccagcgca?gcaagcaccg 1920

ccgcgccctt?cccgttccac?ctctcccagc?acatgctggc?atctcaggga?attccaatgc 1980

ccactttcgg?aggcctcttc?ccctacccct?acacctacat?ggcagcagca?gccgcagccg 2040

cctcggcttt?gcccgccact?agtgctgcag?ctgccgccgc?cgcagccgcc?ggctccctct 2100

cccggagccc?cttcctgggc?agtgcccggc?cccgactgcg?tttcagcccc?tatcagatcc 2160

cggtcaccat?cccgcctagc?actagcctcc?tcaccaccgg?gctggcctct?gagggctcca 2220

aggccgctgg?tggaaacagc?cgggagccta?gccccctgcc?cgagctggct?ctccgcaaag 2280

taggggcccc?atcccgcggt?gccctgtcgc?ccagtggctc?ggccaaggag?gcggccaatg 2340

aactgcagag?catccagaga?ctggtgagtg?ggctggagag?ccagcgagcc?ctctccccag 2400

gccgggagtc?gcccaagtga?ggggctgccc?agctgctccc?ctgccacgca?ggccacccgg 2460

gctgcctgcc?cctgctgctt?gggacgtgta?cagcacagaa?tgagtattta?tttaaataaa 2520

ggagaaaagt?gggctgcagc?agccggaata?gagcctcgtc?tggcaagtcg?gggcctggga 2580

cacttccctg?ggcctcaaca?aggatcaggc?tgctggaaac?acagtcactt?gggagctgct 2640

gggctaggtc?cagatccgct?ccagcgtcaa?ggtggcatcc?gaaggtgtct?ctggtcttcc 2700

agcgaggtgg?gagaggcctc?atccagggcc?cagcggtccc?tgcagaagcc?agaaggtgca 2760

ggggccaggg?gtgggagcat?cggagggagt?cccagagccc?tggaccttgg?gcctagaccg 2820

cgtgataaaa?ctgggttgag?ggatgctgga?accagttacg?actgaagtca?gtgtagacct 2880

gagctgggag?ggaacctgtt?agtctcccca?cctcttccct?gaagagacag?gcacccctcc 2940

cagccgtggt?caacggaggg?agtggcactt?ctgccttgag?tccccagggg?aaaaaaaaaa 3000

aagatattta?tgaaataaat?ggtaatttgt?gtaaataagc?tttaaggttc?ccagaatatg 3060

caaattggta?ttaatttatt?caaaggtgta?cattgctgtg?tacatatatt?tagagattaa 3120

ctcatacatt?taaagttttt?ttcattttac?gtgagcatct?atattgtaca?gggctggggg 3180

ggcccttggc?tgcgggagaa?ggcccagagc?cctggaggag?ccaccacccc?gccggcccct 3240

cgacccctcg?gcccctcggc?ccctccgccc?gggtttggct?cgcccggccc?gcgggctcca 3300

cctcaggttt?tcacttttcg?ctccggagcg?agaacgaaac?gacaaaaacg?caagaaaaca 3360

ataaaacgct?agaaagcgaa?aaaaaaaaaa?aaaaaa 3396

<210>5

<211>722

<212>PRT

<213>Amino?acid?sequence?of?TBX3

<400>5

Met?Ser?Leu?Ser?Met?Arg?Asp?Pro?Val?Ile?Pro?Gly?Thr?Ser?Met?Ala

1 5 10 15

Tyr?His?Pro?Phe?Leu?Pro?His?Arg?Ala?Pro?Asp?Phe?Ala?Met?Ser?Ala

20 25 30

Val?Leu?Gly?His?Gln?Pro?Pro?Phe?Phe?Pro?Ala?Leu?Thr?Leu?Pro?Pro

35 40 45

Asn?Gly?Ala?Ala?Ala?Leu?Ser?Leu?Pro?Gly?Ala?Leu?Ala?Lys?Pro?Ile

50 55 60

Met?Asp?Gln?Leu?Val?Gly?Ala?Ala?Glu?Thr?Gly?Ile?Pro?Phe?Ser?Ser

65 70 75 80

Leu?Gly?Pro?Gln?Ala?His?Leu?Arg?Pro?Leu?Lys?Thr?Met?Glu?Pro?Glu

85 90 95

Glu?Glu?Val?Glu?Asp?Asp?Pro?Lys?Val?His?Leu?Glu?Ala?Lys?Glu?Leu

100 105 110

Trp?Asp?Gln?Phe?His?Lys?Arg?Gly?Thr?Glu?Met?Val?Ile?Thr?Lys?Ser

115 120 125

Gly?Arg?Arg?Met?Phe?Pro?Pro?Phe?Lys?Val?Arg?Cys?Ser?Gly?Leu?Asp

130 135 140

Lys?Lys?Ala?Lys?Tyr?Ile?Leu?Leu?Met?Asp?Ile?Ile?Ala?Ala?Asp?Asp

145 150 155 160

Cys?Arg?Tyr?Lys?Phe?His?Asn?Ser?Arg?Trp?Met?Val?Ala?Gly?Lys?Ala

165 170 175

Asp?Pro?Glu?Met?Pro?Lys?Arg?Met?Tyr?Ile?His?Pro?Asp?Ser?Pro?Ala

180 185 190

Thr?Gly?Glu?Gln?Trp?Met?Ser?Lys?Val?Val?Thr?Phe?His?Lys?Leu?Lys

195 200 205

Leu?Thr?Asn?Asn?Ile?Ser?Asp?Lys?His?Gly?Phe?Thr?Ile?Leu?Asn?Ser

210 215 220

Met?His?Lys?Tyr?Gln?Pro?Arg?Phe?His?Ile?Val?Arg?Ala?Asn?Asp?Ile

225 230 235 240

Leu?Lys?Leu?Pro?Tyr?Ser?Thr?Phe?Arg?Thr?Tyr?Leu?Phe?Pro?Glu?Thr

245 250 255

Glu?Phe?Ile?Ala?Val?Thr?Ala?Tyr?Gln?Asn?Asp?Lys?Ile?Thr?Gln?Leu

260 265 270

Lys?Ile?Asp?Asn?Asn?Pro?Phe?Ala?Lys?Gly?Phe?Arg?Asp?Thr?Gly?Asn

275 280 285

Gly?Arg?Arg?Glu?Lys?Arg?Lys?Gln?Leu?Thr?Leu?Gln?Ser?Met?Arg?Val

290 295 300

Phe?Asp?Glu?Arg?His?Lys?Lys?Glu?Asn?Gly?Thr?Ser?Asp?Glu?Ser?Ser

305 310 315 320

Ser?Glu?Gln?Ala?Ala?Phe?Asn?Cys?Phe?Ala?Gln?Ala?Ser?Ser?Pro?Ala

325 330 335

Ala?Ser?Thr?Val?Gly?Thr?Ser?Asn?Leu?Lys?Asp?Leu?Cys?Pro?Ser?Glu

340 345 350

Gly?Glu?Ser?Asp?Ala?Glu?Ala?Glu?Ser?Lys?Glu?Glu?His?Gly?Pro?Glu

355 360 365

Ala?Cys?Asp?Ala?Ala?Lys?Ile?Ser?Thr?Thr?Thr?Ser?Glu?Glu?Pro?Cys

370 375 380

Arg?Asp?Lys?Gly?Ser?Pro?Ala?Val?Lys?Ala?His?Leu?Phe?Ala?Ala?Glu

385 390 395 400

Arg?Pro?Arg?Asp?Ser?Gly?Arg?Leu?Asp?Lys?Ala?Ser?Pro?Asp?Ser?Arg

405 410 415

His?Ser?Pro?Ala?Thr?Ile?Ser?Ser?Ser?Thr?Arg?Gly?Leu?Gly?Ala?Glu

420 425 430

Glu?Arg?Arg?Ser?Pro?Val?Arg?Glu?Gly?Thr?Ala?Pro?Ala?Lys?Val?Glu

435 440 445

Glu?Ala?Arg?Ala?Leu?Pro?Gly?Lys?Glu?Ala?Phe?Ala?Pro?Leu?Thr?Val

450 455 460

Gln?Thr?Asp?Ala?Ala?Ala?Ala?His?Leu?Ala?Gln?Gly?Pro?Leu?Pro?Gly

465 470 475 480

Leu?Gly?Phe?Ala?Pro?Gly?Leu?Ala?Gly?Gln?Gln?Phe?Phe?Asn?Gly?His

485 490 495

Pro?Leu?Phe?Leu?His?Pro?Ser?Gln?Phe?Ala?Met?Gly?Gly?Ala?Phe?Ser

500 505 510

Ser?Met?Ala?Ala?Ala?Gly?Met?Gly?Pro?Leu?Leu?Ala?Thr?Val?Ser?Gly

515 520 525

Ala?Ser?Thr?Gly?Val?Ser?Gly?Leu?Asp?Ser?Thr?Ala?Met?Ala?Ser?Ala

530 535 540

Ala?Ala?Ala?Gln?Gly?Leu?Ser?Gly?Ala?Ser?Ala?Ala?Thr?Leu?Pro?Phe

545 550 555 560

His?Leu?Gln?Gln?His?Val?Leu?Ala?Ser?Gln?Gly?Leu?Ala?Met?Ser?Pro

565 570 575

Phe?Gly?Ser?Leu?Phe?Pro?Tyr?Pro?Tyr?Thr?Tyr?Met?Ala?Ala?Ala?Ala

580 585 590

Ala?Ala?Ser?Leu?Arg?Gln?Pro?Gln?Leu?Arg?Cys?Thr?Ala?Pro?Leu?Leu

595 600 605

Asn?Leu?Asn?Thr?Met?Arg?Pro?Arg?Leu?Arg?Tyr?Ser?Pro?Tyr?Ser?Ile

610 615 620

Pro?Val?Pro?Val?Pro?Asp?Gly?Ser?Ser?Leu?Leu?Thr?Thr?Ala?Leu?Pro

625 630 635 640

Ser?Met?Ala?Ala?Ala?Ala?Gly?Pro?Leu?Asp?Gly?Lys?Ala?Ala?Ala?Leu

645 650 655

Ala?Ala?Ser?Pro?Ala?Ser?Val?Ala?Val?Asp?Ser?Gly?Ser?Glu?Pro?Asn

660 665 670

Ser?Arg?Ser?Ser?Thr?Leu?Ser?Ser?Ser?Ser?Met?Ser?Leu?Ser?Pro?Lys

675 680 685

Leu?Cys?Ala?Glu?Lys?Glu?Ala?Ala?Thr?Ser?Glu?Leu?Gln?Ser?Ile?Gln

690 695 700

Arg?Leu?Val?Ser?Gly?Leu?Glu?Ala?Lys?Pro?Asp?Arg?Ser?Arg?Ser?Ala

705 710 715 720

Ser?Pro

<210>6

<211>702

<212>PRT

<213>amino?acid?sequence?of?TBX2

<400>6

Met?Ala?Tyr?His?Pro?Phe?His?Ala?Pro?Arg?Pro?Ala?Asp?Phe?Pro?Met

1 5 10 15

Ser?Ala?Phe?Leu?Ala?Ala?Ala?Gln?Pro?Ser?Phe?Phe?Pro?Ala?Leu?Ala

20 25 30

Leu?Pro?Pro?Gly?Ala?Leu?Ala?Lys?Pro?Leu?Pro?Asp?Pro?Gly?Leu?Ala

35 40 45

Gly?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Glu?Ala?Gly

50 55 60

Leu?His?Val?Ser?Ala?Leu?Gly?Pro?His?Pro?Pro?Ala?Ala?His?Leu?Arg

65 70 75 80

Ser?Leu?Lys?Ser?Leu?Glu?Pro?Glu?Asp?Glu?Val?Glu?Asp?Asp?Pro?Lys

85 90 95

Val?Thr?Leu?Glu?Ala?Lys?Glu?Leu?Trp?Asp?Gln?Phe?His?Lys?Leu?Gly

100 105 110

Thr?Glu?Met?Val?Ile?Thr?Lys?Ser?Gly?Arg?Arg?Met?Phe?Pro?Pro?Phe

115 120 125

Lys?Val?Arg?Val?Ser?Gly?Leu?Asp?Lys?Lys?Ala?Lys?Tyr?Ile?Leu?Leu

130 135 140

Met?Asp?Ile?Val?Ala?Ala?Asp?Asp?Cys?Arg?Tyr?Lys?Phe?His?Asn?Ser

145 150 155 160

Arg?Trp?Met?Val?Ala?Gly?Lys?Ala?Asp?Pro?Glu?Met?Pro?Lys?Arg?Met

165 170 175

Tyr?Ile?His?Pro?Asp?Ser?Pro?Ala?Thr?Gly?Glu?Gln?Trp?Met?Ala?Lys

180 185 190

Pro?Val?Ala?Phe?His?Lys?Leu?Lys?Leu?Thr?Asn?Asn?Ile?Ser?Asp?Lys

195 200 205

His?Gly?Phe?Thr?Ile?Leu?Asn?Ser?Met?His?Lys?Tyr?Gln?Pro?Arg?Phe

210 215 220

His?Ile?Val?Arg?Ala?Asn?Asp?Ile?Leu?Lys?Leu?Pro?Tyr?Ser?Thr?Phe

225 230 235 240

Arg?Thr?Tyr?Val?Phe?Pro?Glu?Thr?Asp?Phe?Ile?Ala?Val?Thr?Ala?Tyr

245 250 255

Gln?Asn?Asp?Lys?Ile?Thr?Gln?Leu?Lys?Ile?Asp?Asn?Asn?Pro?Phe?Ala

260 265 270

Lys?Gly?Phe?Arg?Asp?Thr?Gly?Asn?Gly?Arg?Arg?Glu?Lys?Arg?Lys?Gln

275 280 285

Leu?Thr?Leu?Pro?Ser?Leu?Arg?Leu?Tyr?Glu?Glu?His?Cys?Lys?Pro?Glu

290 295 300

Arg?Asp?Gly?Ala?Glu?Ser?Asp?Ala?Ser?Ser?Cys?Asp?Pro?Pro?Pro?Ala

305 310 315 320

Arg?Glu?Pro?Pro?Thr?Ser?Pro?Gly?Ala?Ala?Pro?Ser?Pro?Leu?Arg?Leu

325 330 335

His?Arg?Ala?Arg?Ala?Glu?Glu?Lys?Ser?Cys?Ala?Ala?Asp?Ser?Asp?Pro

340 345 350

Glu?Pro?Glu?Arg?Leu?Ser?Glu?Glu?Arg?Ala?Arg?Ala?Pro?Leu?Gly?Arg

355 360 365

Ser?Pro?Ala?Pro?Asp?Ser?Ala?Ser?Pro?Thr?Arg?Leu?Thr?Glu?Pro?Glu

370 375 380

Arg?Ala?Arg?Glu?Arg?Arg?Cys?Pro?Glu?Arg?Gly?Lys?Glu?Pro?Ala?Glu

385 390 395 400

Ser?Gly?Gly?Asp?Gly?Pro?Phe?Gly?Leu?Arg?Ser?Leu?Glu?Lys?Glu?Arg

405 410 415

Pro?Glu?Ala?Arg?Arg?Lys?Asp?Glu?Gly?Arg?Lys?Glu?Ala?Ala?Glu?Gly

420 425 430

Lys?Glu?Gln?Gly?Leu?Ala?Pro?Leu?Val?Val?Gln?Thr?Asp?Ser?Ala?Ser

435 440 445

Pro?Leu?Gly?Ala?Gly?His?Leu?Pro?Gly?Leu?Ala?Phe?Ser?Ser?His?Leu

450 455 460

His?Gly?Gln?Gln?Phe?Phe?Gly?Pro?Leu?Gly?Ala?Gly?Gln?Pro?Leu?Phe

465 470 475 480

Leu?His?Pro?Gly?Gln?Phe?Thr?Met?Gly?Pro?Gly?Ala?Phe?Ser?Ala?Met

485 490 495

Gly?Met?Gly?His?Leu?Leu?Ala?Ser?Val?Ala?Gly?Gly?Gly?Asn?Gly?Gly

500 505 510

Gly?Gly?Gly?Pro?Gly?Thr?Ala?Ala?Gly?Leu?Asp?Ala?Gly?Gly?Leu?Gly

515 520 525

Pro?Ala?Ala?Ser?Ala?Ala?Ser?Thr?Ala?Ala?Pro?Phe?Pro?Phe?His?Leu

530 535 540

Ser?Gln?His?Met?Leu?Ala?Ser?Gln?Gly?Ile?Pro?Met?Pro?Thr?Phe?Gly

545 550 555 560

Gly?Leu?Phe?Pro?Tyr?Pro?Tyr?Thr?Tyr?Met?Ala?Ala?Ala?Ala?Ala?Ala

565 570 575

Ala?Ser?Ala?Leu?Pro?Ala?Thr?Ser?Ala?Ala?Ala?Ala?Ala?Ala?Ala?Ala

580 585 590

Ala?Gly?Ser?Leu?Ser?Arg?Ser?Pro?Phe?Leu?Gly?Ser?Ala?Arg?Pro?Arg

595 600 605

Leu?Arg?Phe?Ser?Pro?Tyr?Gln?Ile?Pro?Val?ThrIle?Pro?Pro?Ser?Thr

610 615 620

Ser?Leu?Leu?Thr?Thr?Gly?Leu?Ala?Ser?Glu?Gly?Ser?Lys?Ala?Ala?Gly

625 630 635 640

Gly?Asn?Ser?Arg?Glu?Pro?Ser?Pro?Leu?Pro?Glu?Leu?Ala?Leu?Arg?Lys

645 650 655

Val?Gly?Ala?Pro?Ser?Arg?Gly?Ala?Leu?Ser?Pro?Ser?Gly?Ser?Ala?Lys

660 665 670

Glu?Ala?Ala?Asn?Glu?Leu?Leu?Ser?Ile?Gln?Arg?Leu?Val?Ser?Gly?Leu

675 680 685

Glu?Ser?Gln?Arg?Ala?Leu?Ser?Pro?Gly?Arg?Glu?Ser?Pro?Lys

690 695 700

<210>7

<211>25

<212>DNA

<213>DNA?fragment

<400>7

tatgtatcca?tatgacgtcc?cagac 25

<210>8

<211>40

<212>DNA

<213>DNA?fragment

<400>8

tatgccggcg?gcaggaagaa?gcggagacag?cgacgaagag 40

<210>9

<211>27

<212>DNA

<213>DNA?fragment

<400>9

gatcctcttc?gtcgctgtct?ccgcttc 27

<210>10

<211>40

<212>DNA

<213>DNA?fragment

<400>10

ttcctgccgc?cggcatagtc?tgggacgtca?tatggataca 40

<210>11

<211>27

<212>DNA

<213>forward?primer

<400>11

cgcggatccc?tgttccctta?cccctac 27

<210>12

<211>30

<212>DNA

<213>reverse?primer

<400>12

ccgctcgagt?tagcgcagcc?gcgggcgcat 30

<210>13

<211>65

<212>DNA

<213>DNA?fragment

<400>13

tatgtatcca?tatgacgtcc?cagactatgc?cggcggcagg?aagaagcgga?gacagcgacg 60

aagag 65

<210>14

<211>67

<212>DNA

<213>DNA?fragment

<400>14

gatcctcttc?gtcgctgtct?ccgcttcttc?ctgccgccgg?catagtctgg?gacgtcatat 60

ggataca 67

<210>15

<211>141

<212>DNA

<213>amplified?fragment

<400>15

cgcggatccc?tgttccctta?cccctacacg?tacatggccg?cagcggcggc?cgcctcctct 60

gcggcagcct?ccagctcggt?gcaccgccac?cccttcctca?atctgaacac?catgcgcccg 120

cggctgcgct?aactcgagcg?g 141

<210>16

<211>129

<212>DNA

<213>Fragment?cut?by?Restriction?Enzymes

<400>16

gatccctgtt?cccttacccc?tacacgtaca?tggccgcagc?ggcggccgcc?tcctctgcgg 60

cagcctccag?ctcggtgcac?cgccacccct?tcctcaatct?gaacaccatg?cgcccgcggc 120

tgcgctaac 129

<210>17

<211>83

<212>PRT

<213>Inactive?mutant?of?TAP21(TAPm)

<400>17

Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro

1 5 10 15

Arg?Gly?Ser?His?Met?Tyr?Pro?Tyr?Asp?Val?Pro?Asp?Tyr?Ala?Gly?Gly

20 25 30

Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Gly?Ser?Gly?Gly?Gly?Gly?Gly

35 40 45

Gly?Gly?Tyr?Met?Ala?Ala?Ala?Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser

50 55 60

Ser?Ser?Val?Ala?Ala?Ala?Pro?Phe?Leu?Asn?Leu?Asn?Thr?Met?Arg?Pro

65 70 75 80

Arg?Leu?Arg

<210>18

<211>83

<212>PRT

<213>Derivative?of?TAP21

<400>18

Met?Gly?Ser?Ser?Arg?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro

1 5 10 15

Arg?Gly?Ser?His?Met?Tyr?Pro?Tyr?Asp?Val?Pro?Asp?Tyr?Ala?Gly?Gly

20 25 30

Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Gly?Ser?Leu?Phe?Pro?Tyr?Pro

35 40 45

Tyr?Thr?Tyr?Met?Ala?Ala?Ala?Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser

50 55 60

Ser?Ser?Val?His?Arg?His?Pro?Phe?Leu?Asn?Leu?Asn?Thr?Met?Arg?Pro

65 70 75 80

Arg?Leu?Arg

<210>19

<211>83

<212>PRT

<213>Derivative?of?TAP21

<400>19

Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro

1 5 10 15

Arg?Gly?Ser?His?Met?Tyr?Pro?Tyr?Asp?Val?Pro?Asp?Tyr?Ala?Gly?Gly

20 25 30

Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Gly?Ser?Leu?Phe?Pro?Tyr?Pro

35 40 45

Tyr?Thr?Tyr?Met?Gly?Gly?Ala?Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser

50 55 60

Ser?Ser?Val?His?Arg?His?Pro?Phe?Leu?Asn?Leu?Asn?Thr?Met?Arg?Pro

65 70 75 80

Arg?Leu?Arg

Claims

1. isolated nucleic acid molecule, its comprise the nucleotide sequence shown in the SEQ ID NO:1 or under tight hybridization conditions with the nucleotide sequence of the nucleotide sequence hybridization shown in the SEQ ID NO:1, described nucleic acid molecule encoding has the polypeptide that suppresses tumor promotion.

2. nucleic acid molecule according to claim 1, it is made up of the nucleotide sequence shown in the SEQ ID NO:1.

3. by the polypeptide with anti-tumor activity of claim 1 or 2 described nucleic acid molecule encodings.

4. the polypeptide that has anti-tumor activity, it comprises the variant or the derivative of the aminoacid sequence shown in the SEQ ID NO:2 or its concrete identical function.

5. polypeptide as claimed in claim 4, wherein said polypeptide is made up of the aminoacid sequence shown in the SEQ ID NO:2.

6. recombinant vectors, its comprise carrier and with its claim that can be operatively connected 1 or 2 described nucleic acid molecule.

7. recombinant vectors as claimed in claim 6, wherein said carrier is an expression vector.

8. as claim 6 or 7 described carriers, wherein said nucleic acid molecule can be operatively connected with the carrier that is selected from pET, pBR322, pACYC177, pKT230, pGV1 106, pLAFR1, pME290, pHV14, pBD9, pIJ61, pUC6, phage X, Yip5, YCp19, adenovirus, slow virus or bovine papilloma virus.

9. with each described carrier transfection or cell transformed among the claim 6-8.

10. cell as claimed in claim 9, wherein said cell is an eukaryotic cell.

11. cell as claimed in claim 9, wherein said cell is a prokaryotic cell prokaryocyte.

12. cell as claimed in claim 11, wherein said prokaryotic cell prokaryocyte is intestinal bacteria.

13. the pharmaceutical composition of treatment tumour, it comprises each described carrier among claim 1 or 2 described nucleic acid molecule, each described polypeptide of claim 3-5 or the claim 6-8, and vehicle.

14. the purposes of each described carrier in the medicine of preparation treatment individual tumors among each described polypeptide or the claim 6-8 among claim 1 or 2 described nucleic acid molecule, the claim 3-5.

15. each described carrier, the described composition of claim 13 or the described purposes of claim 14 among each described polypeptide, the claim 6-8 among nucleic acid molecule, the claim 3-5 as claimed in claim 1 or 2, wherein said tumour is selected from liver cancer, cancer of the stomach, colorectal carcinoma, carcinoma of the pancreas, mammary cancer, sarcoma, leukemia, ovarian cancer, carcinoma of ureter, bladder cancer, prostate cancer, lymphoma, multiple myeloma, carcinoma of the pancreas, kidney, internal secretion gland cancer, skin carcinoma, melanoma, vascular tumor and brain or central nervous system cancer.