CN110433170B - Application of cardiac pumping liquid miR-28-5p in heart diseases - Google Patents

Abstract

Application of cardiac suction liquid miR-28-5p in heart diseases belongs to the field of biology and medicine, and particularly relates to application of microRNAs screened in myocardial infarction suction liquid and verified by high-throughput sequencing screening in preparation of drugs for diagnosing, relieving and/or treating myocardial infarction through experiments.

Description

Application of cardiac pumping liquid miR-28-5p in heart diseases

Technical Field

The invention belongs to the field of biology and medicine, and particularly relates to application of microRNAs (microRNAs) screened and verified in myocardial infarction aspiration fluid through high-throughput sequencing and application of microRNAs in preparation of medicines for diagnosing, relieving and/or treating myocardial infarction through experiments.

Background

Myocardial Infarction (MI) is the most common cause of cardiovascular death in economically developed countries. Myocardial infarction is caused by acute cardiac injury caused by ischemic and hypoxic conditions, accompanied by oxidative stress and inflammation of the infarcted area. Loss of normal signaling in the myocardium leads to enlargement of the infarct zone, increased Reactive Oxygen Species (ROS) production, cardiomyocyte death, and viable functional cardiomyocyte remodeling. Initially, cardiac remodeling is an adaptive response to heart damage, leading to cardiac fibrosis, dilated cardiomyopathy, and Heart Failure (HF) when the heart becomes decompensated. Post-infarction remodeling is due to inadequate blood supply to the infarcted myocardium, accompanied by pathological changes in the signal.

Prolonged ischemia results in loss of myocardial contractility due to poor proliferation of cardiomyocytes. Therefore, timely revascularization of occluded arteries is critical to the treatment of myocardial infarction. Antithrombotic agents, percutaneous coronary intervention and bypass surgery are commonly used to treat patients. However, these treatments only reduce the severity of coronary heart disease, rather than restoring contractility of the infarcted heart. Therefore, new therapeutic strategies to reduce cardiomyocyte death and/or stimulate cardiac regeneration are highly desirable for the future.

MicroRNAs (miRNAs) are small non-coding RNAs that block translation or promote degradation of mRNA, thereby controlling gene expression. Many miRNAs are reported to be involved in the process of pathophysiological consequences resulting from myocardial infarction. miRNAs can promote/inhibit the death of myocardial cells and can also regulate the neogenesis of cardiac vessels after infarction. miRNA in circulating blood can exist stably and can be easily determined by RT-PCR. mir-1, mir-208, mir-499 and mir-133 were highly expressed in the heart and were continuously increased in the plasma of patients with acute myocardial infarction. Compared with a healthy control group, the miR-208a expression level is remarkably increased in 91% of AMI patients. In addition, in the early stage of myocardial infarction, the detection result of miR-208a has more advantages than troponin. In recent years, the role of mir-92a and mir-181a in the circulation as potential new biomarkers in the diagnosis of AMI patients has also been reported. Many studies have shown that the release of antagomiR in animals can effectively reduce the corresponding microRNA level for a long time and has low toxicity. For example, injection of LNA modified oligonucleotides (antimiR-208 a) during heart failure was effective in improving cardiac function and survival in rats. Therefore, more miRNA markers can be found to provide potential targets for clinical diagnosis and treatment of myocardial infarction.

Disclosure of Invention

The technical problem to be solved is as follows: the miR-28-5p is obtained by screening microRNA of cardiac suction liquid, and the microRNA can be used for diagnosing, relieving and/or treating myocardial infarction.

The technical scheme is as follows: application of miR-28-5p shown in SEQ ID NO.1 in preparation of medicines for treating myocardial infarction.

The application of the gene of miR-28-5p coded by SEQ ID NO.2 in preparing a medicament for treating myocardial infarction.

The application of the mimics of miR-28-5p in the preparation of the medicine for treating myocardial infarction is disclosed, and the mimics primer is shown in SEQ ID NO.3 and 4.

Application of miR-28-5p shown in SEQ ID NO.1 in preparation of ischemic myocardial infarction diagnostic reagent.

The application of the gene of miR-28-5p coded by SEQ ID NO.2 in preparing a diagnostic reagent for ischemic myocardial infarction.

Application of miR-28-5p shown in SEQ ID No.1 in preparation of a kit for screening medicaments for treating myocardial infarction.

Has the advantages that: the high-throughput sequencing method is used for performing high-throughput sequencing on the acute myocardial infarction coronary artery suction liquid and peripheral blood, and the candidate miR-28-5p is found to be remarkably increased in the infarct area suction liquid. The mimics corresponding to the miR-28-5p can obviously improve the angiogenesis capacity of HUVECs cells. AAV9-NC and AAV9-miR-28-5p adeno-associated virus are respectively injected into tail veins of a C57BL/6J mouse, and a left anterior coronary artery induction acute myocardial infarction model is surgically ligated 2w later. The inventor discovers that the expression level of miR-28-5p is increased after myocardial infarction by an RT-PCR method, and the level of miR-28-5p in the myocardial infarction tissue is further increased after AAV9-miR-28-5p is injected. Compared with the NC group, the over-expression miR-28-5 can obviously reduce the area of the heart infarction, improve the Ejection Fraction (EF) and the short axis shortening rate (FS) of the mouse, and further improve the cardiac function of the mouse. TUNEL staining shows that miR-28-5 is over-expressed to remarkably improve the apoptosis level of myocardial cells in the infarct marginal zone. The invention provides a new prediction molecule miR-28-5 for myocardial infarction, and defines the therapeutic effects of promoting angiogenesis, reducing myocardial cell apoptosis and improving the myocardial infarction, thereby providing a new target point for the diagnosis and treatment of STEMI patients.

Drawings

FIG. 1: and detecting miRNA in the infarct area suction liquid and peripheral blood of the acute myocardial infarction patient by RT-PCR. *P < 0.05，**P < 0.01。

FIG. 2: HUVECs transfect miR-28-5p corresponding mimics, and a matrigel tube forming experiment detects the tube promoting capacity of the mimics. *P< 0.05，**P < 0.01。

FIG. 3: HUVECs transfect miR-28-5p corresponding target gene ARIH1 small interference, and matrigel tube forming experiment detects its tube forming ability. *P < 0.05，**P < 0.01。

FIG. 4: c57BL/6J mouse, male, 8-10 w, performing left coronary artery anterior descending ligation induced myocardial infarction model, and detecting mouse heart tissue infarct area miR-28-5p expression condition after 2 w. *P < 0.05，**P < 0.01。

FIG. 5C 57BL/6J mouse, male, 8-10 w, tail vein injection AAV9-NC, AAV9-miR-28-5p adeno-associated virus (titer 10)¹¹100 μ L/mouse), 2w later, left anterior descending coronary artery ligation induced myocardial infarction model, 2w laterEchocardiography was performed to examine cardiac function as well as ejection fraction and short axis contraction. *P< 0.05，**P< 0.01。

FIG. 6: c57BL/6J mouse, male, 8-10 w, tail vein injection AAV9-NC, AAV9-miR-28-5p adeno-associated virus (titer 10)¹¹100 μ L/mouse), 2w later, left coronary artery anterior descending ligation induced myocardial infarction model, 2w later, infarct marginal zone cardiac apoptosis level was determined. *P< 0.05，**P< 0.01。

Detailed Description

Example 1

1. Plasma miRNA extraction, RT-PCR

(1) The patient with ST-segment elevation myocardial infarction usually carries out thrombus suction for 2-4 times, 10-15 mL of blood sample is reserved, and 10-15 mL of peripheral blood (radial artery or femoral artery puncture part) is reserved as a control. The blood samples were collected using a vacuum anticoagulation tube (sodium citrate) and stored at 4 ℃ for treatment within 4 hours (blood samples were provided by the first hospital of Nanjing). Centrifuging at 3000 r/min for 5-10 min, collecting 500 μ L plasma, and storing in refrigerator at-80 deg.C.

(2) Extraction of plasma sample RNA serum was slowly thawed on ice and a 1.5 mL EP tube was prepared and 5 sample volumes of QIAzol were added; after the sample was completely thawed, 200. mu.L of the sample was immediately added to the prepared QIAzol,

incubate at room temperature for 10 min. Adding 200 μ L chloroform, shaking with vortex oscillator, standing at room temperature for 5 min, centrifuging at 4 deg.C and 12000 g for 15 min, and placing the supernatant into new EP tube; adding 1.5 times of anhydrous ethanol into the supernatant, centrifuging at 10000 rpm for 15s at normal temperature, and removing the lower layer liquid; adding 700 μ L RWT, centrifuging at room temperature at 10000 rpm for 15s, and removing the lower layer liquid; adding 500 μ L RPE, centrifuging at room temperature at 10000 rpm for 15s, and discarding the lower layer liquid; placing the purification column in a new cannula and centrifuging at full speed for 2 min; transferring the purification column to a new 1.5 mL EP tube, adding 30-50 μ L DEPC water to a membrane of the purification column, standing at room temperature for 1 min, centrifuging at room temperature at 10000 rpm for 15s, removing the purification column, retaining the centrifuged sample, and taking 2 μ L to quantify with Nanodrop.

(3) RT-PCR: the reverse transcription reaction takes 5 μ L of sample, and the total reaction system is 10 μ L for reverse transcription. Taking cDNA of 1 mu L/hole as a template, adding corresponding primers, carrying out RT-PCR with a reaction system of 20 mu L and two multiple holes, and simultaneously making NTC (DEPC water is used for replacing the template) primers, and synthesizing the result of the dissolution curve to obtain a corresponding result.

Has a sequence of Has-miR-28-5 p: AAGGAGCUCACAGUCUAUUGAG SEQ ID NO.1

Has-miR-28-5p gene coding sequence: GGTCCTTGCCCTCAAGGAGCTCACAGTCTATTGAGTTACCTTTCTGACTTTCCCACTAGATTGTGAGCTCCTGGAGGCAGGCACT, respectively; SEQ ID NO.2

Reverse transcription primer sequence (synthesized by Nanjing Sipu gold Biotech Co., Ltd.):

miR-28-5p：CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTCAATAG； SEQ ID NO.5

RT-PCR primer sequences (synthesized by Nanjing Sipu gold Biotech Co., Ltd.):

miR-28-5p :

F primer: TTCTTCGCAAGGAGCTCACA； SEQ ID NO.6

R primer: TATGGTTCTTCACGACTGGTTCAC； SEQ ID NO.7

2. transfection of mimics and siRNA by Human Umbilical Vein Endothelial Cells (HUVECs)

(1) Human umbilical vein endothelial cells were extracted and the cell plates were cultured in ECM medium containing 5% fetal bovine serum.

(2) When the cells fused to about 75%, the culture solution was discarded, the cells were washed 2 times with pre-warmed PBS to remove the remaining serum in the medium, and then 800. mu.L of opti-MEM was added to each well. Transfection was performed with liposome lipo 3000.

(3) mu.L/well of lipo 3000 (gently shaken before use) was pipetted into 100. mu.L of opti-MEM. After gentle mixing, incubate at room temperature for 5 min. Pipette 2.5. mu.L of mimic (or siRNA) into 100. mu.L of opti-MEM for dilution, and mix gently. Mixing the obtained liquid in equal volume, and gently mixing. After 15 min the mixed liquid was added to the well plate.

(4) The cells are placed under standard culture conditions, and after 8 hours, the fresh normal culture medium is replaced for continuous culture.

The mic sequence is as follows (consignment of Shanghai Jima pharmaceutical technology, Inc.:

hsa-miR-28-5p mimic sequence

F : AAGGAGCUCACAGUCUAUUGAG；SEQ ID NO.3

R: CAAUAGACUGUGAGCUCCUUUU； SEQ ID NO.4

The ARIH1-siRNA sequence was as follows (the synthesis was entrusted to Shanghai Jima pharmaceutical technology Co., Ltd.):

Sense: CGAGAUAUUUCCCAAGAUU；SEQ ID NO.8

Antisense: GCUCUAUAAAGGGUUCUAA；SEQ ID NO.9

3. experiment of tubule formation

(1) Melting matrigel in a refrigerator at 4 deg.C one day in advance (note that matrigel is frozen at-20 deg.C and liquid at 4 deg.C, and can be solidified at normal temperature without re-dissolution, so the matrigel should be kept at low temperature all the time). And placing the yellow medium gun head and the 96-well plate in a refrigerator for precooling at the temperature of minus 20 ℃ to prevent the matrix glue from solidifying when in use.

(2) The melted matrigel and 96-well plate were placed in and on an ultraviolet-illuminated ice box.

(3) About 60. mu.L matrigel (50-60. mu.L) was added to each well, taking care not to clean the tip to avoid air bubbles. This step is rapid and prevents the glue from setting.

(4) The well plate was removed and placed in the incubator for at least 30 min.

(5) Counting: add 100. mu.L of cell suspension to each well, approximately 2-3X 10 per well⁴And (4) cells. Observing under a mirror, adjusting the cell number according to the condition, ensuring that the cell number is moderate and the monolayer cell is optimal.

(6) According to the tube forming condition observation of the cells, the tube forming is generally observed within 6-8 h, and does not exceed 12 h.

4. Establishment of mouse acute myocardial infarction model

Isoflurane (2-3% concentration for induced anesthesia and 1.5-2% concentration for maintenance) anesthetizes and fixes the body position of the mouse in the supine position, then uses surgical scissors and a knife which are disinfected in advance to cut open the neck skin of the mouse, exposes the trachea, is about 1 cm, is connected with a special breathing machine for the mouse, and adjusts the parameters of the breathing machine in advance as follows: tidal volume is 2 mL, breathing ratio is 2:3, and frequency is 120 times/min. After the successful connection of a respirator, selecting the 4 th-5 th intercostal space of the mouse to open the chest, using a chest expander to open the incision, fully exposing the heart, uniformly selecting the horizontal position which is about 2 mm away from the tip of the left auricle, ligating the anterior descending branch of the left coronary artery of the mouse, observing the color change of the myocardium at the ligation part and the following parts, and if the color is changed from red to pale, and the electrocardiogram shows that S-T is obviously continuously raised for 10-15 min, the successful molding is proved. And finally, finely sewing and cleaning the wound, after 10-20 min, separating the mouse from a breathing machine, putting the mouse on a heating pad at the temperature of 37 ℃ for waking up, putting the mouse into a mouse cage, putting the mouse in a clean animal room for feeding, wherein the mouse divided into a control group is threaded on the anterior descending branch of the left coronary artery at the same position without ligation after the chest of the mouse is opened.

5. Cardiac ultrasound

The mouse myocardial infarction model was prepared for 2 weeks (w) and the left ventricular inside diameter and function were measured with a cardiac ultrasound apparatus. Mice were immobilized under anesthesia, left chest depilated, two-dimensional ultrasound positioned, left ventricular anterior-posterior wall thickness (LVAWd and LVPWd), left ventricular end-diastolic internal diameter (LvEDd) and left ventricular end-systolic internal diameter (LVESd) were measured, and Left Ventricular Fractional Shortening (LVFS) and Left Ventricular Ejection Fraction (LVEF) were measured: LVFS (%) = [ (LVEDd (mm) -LVESd (mm))/LVEDd (mm) ] × 100%, LVEF (%) = [ (LVEDv (ml) -LVSv (ml))/LVEDv (ml) ] × 100%.

6. Mouse heart-specific overexpression of adeno-associated virus

(1) Taking C57BL/6J mice, male, 8-10 weeks, tail vein injecting AAV9-miR adeno-associated virus (AAV 9-NC and AAV9-miR-28-5p, titer is 10¹¹100 μ L/tube, available from Nanjing Gyma Biotech Co., Ltd.).

(2) The mice are fed in an SPF-grade feeding environment for 2w, so that the AAV9 of the adeno-associated virus is stably expressed in the corresponding tissues.

(3) Performing left coronary artery anterior descending ligation induced myocardial infarction model, and measuring cardiac function and histomorphology observation after 2 w.

The experimental results are as follows:

source of biological material

1. Human Umbilical Vein Endothelial Cells (HUVECs); supplied by the women and children health care institute in Nanjing.

2. C57BL/6J mice: purchased from Witonglihua laboratory animal technology, Inc.

3. Human aspirated blood and peripheral blood samples were provided by the first hospital of Nanjing.

4. AAV9-NC and AAV9-miR-28-5p adeno-associated virus: purchased from Shanghai Jima pharmaceutical technology, Inc.

In order to explore whether microRNAs in an infarct area of a heart and normal heart suction fluid participate in the regulation of the heart function, the level of miR-28-5p expression is quantitatively detected by RT-PCR (figure 1). The above experimental results suggest: miR-28-5p is obviously increased in the suction fluid particles in the area of the heart peduncles.

In FIG. 1, circulating represents a patient's circulating blood sample, and circulating represents a patient's aspirate fluid blood sample.

To explore the effect of miR-28-5p on endothelial cell tubulointing phenotype. Negative Control (NC) and miR-28-5p mimics are transfected into HUVECs by lipo 3000 transfection reagent respectively, and tube formation experiments are carried out after 48h, and the transfected miR-28-5p mimics are found to increase the angiogenesis capacity compared with the Negative Control (NC) (figure 2). The above experimental results suggest: miR-28-5p can increase endothelial cell angiogenesis.

In fig. 2 NC represents a nonsense sequence.

In order to explore the influence of miR-28-5p downstream target genes on the vascular phenotype of the inner cells. Negative Control (NC) and si-ARIH1 were transfected into HUVECs with lipo 3000 transfection reagent, respectively, and tube formation experiments were performed 48h later, and it was found that transfection of si-ARIH1 increased its angiogenic potential compared to Negative Control (NC) (FIG. 3). The above experimental results suggest: interference with the miR-28-5p downstream target gene ARIH1 can increase the angiogenesis promotion phenotype of endothelial cells.

In fig. 3 NC represents a nonsense sequence.

To verify miR-28-5p expression levels at the animal level. C57BL/6J mouse is ligated with mouse left coronary artery anterior descending induced myocardial infarction model, and myocardial tissue miRNAs at infarct position of mouse are extracted after 2w and RT-PCR experiment is carried out. Compared with the sham group, the miR-28-5p expression level of the infarcted region of the model group is increased. The above experimental results suggest: the expression level of miR-28-5p in the infarct area after myocardial infarction of the mice is increased (figure 4).

In FIG. 4, sham represents the sham-operated group, MI represents the mouse model of ligation-induced myocardial infarction of left anterior descending coronary artery, and NC represents the nonsense sequence group.

To verify the effect of miR-28-5p on myocardial post-infarction heart function at the animal in vivo level, the mouse left anterior coronary descending induced myocardial infarction model was ligated after first overexpressing AAV9-miR-28-5p in C57BL/6J mice, 2 w. 2w later, cardiac ultrasonic detection is carried out on the cardiac function. The echocardiography results of the heart show that compared with the NC group, the mouse heart function can be improved by over-expressing miR-28-5p, and the ejection fraction and the short axis shrinkage rate are obviously improved (figure 5). To verify the level of apoptosis of myocardium, TUNEL staining was performed on the infarcted border zone of heart, and miR-28-5p overexpression could decrease the level of apoptosis of infarcted border zone of mice compared to NC group (fig. 6). The above experimental results suggest: in an animal level, miR-28-5p can improve the cardiac function of a mouse in a mouse left coronary artery anterior descending induced myocardial infarction model.

In FIG. 5, sham represents the sham group, MI represents the mouse model of left anterior descending coronary artery ligation induced myocardial infarction, NC represents nonsense sequence, EF represents ejection fraction, and FS represents short axis contraction rate.

The above examples are only for illustrating the technical idea and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the content of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.

Sequence listing

<110> Nanjing university of medical science

<120> application of cardiac pumping fluid miR-28-5p in heart diseases

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaggagcuca cagucuauug ag 22

<210> 2

<211> 85

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggtccttgcc ctcaaggagc tcacagtcta ttgagttacc tttctgactt tcccactaga 60

ttgtgagctc ctggaggcag gcact 85

<210> 3

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaggagcuca cagucuauug ag 22

<210> 4

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

caauagacug ugagcuccuu uu 22

<210> 5

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctcaactggt gtcgtggagt cggcaattca gttgagctca atag 44

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttcttcgcaa ggagctcaca 20

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tatggttctt cacgactggt tcac 24

<210> 8

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgagauauuu cccaagauu 19

<210> 9

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcucuauaaa ggguucuaa 19

Claims (1)

1. The application of miR-28-5p shown in SEQ ID No.1 in preparing a medicament for treating myocardial infarction by increasing angiogenesis of human umbilical vein endothelial cells.

Images