CN110423696A - The trichoderma strain screening technique for preventing and treating notoginseng root rot - Google Patents
The trichoderma strain screening technique for preventing and treating notoginseng root rot Download PDFInfo
- Publication number
- CN110423696A CN110423696A CN201910779286.0A CN201910779286A CN110423696A CN 110423696 A CN110423696 A CN 110423696A CN 201910779286 A CN201910779286 A CN 201910779286A CN 110423696 A CN110423696 A CN 110423696A
- Authority
- CN
- China
- Prior art keywords
- trichoderma strain
- trichoderma
- root rot
- strain
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Toxicology (AREA)
Abstract
The present invention discloses a kind of trichoderma strain screening technique for preventing and treating notoginseng root rot, specifically includes the following steps: step 1, separates the trichoderma strain in Radix Notoginseng Rhizosphere Soil；Step 2, identify the trichoderma strain type of acquisition；Step 3, sensitivity of the detected trichoderma strain to saponin(e；Step 4, inhibitory effect of the detection trichoderma strain to Pathogens Causing Root Rot Disease；Step 5, inhibitory effect of the secondary metabolite to Pathogens Causing Root Rot Disease of trichoderma strain is detected；Step 6, the trichoderma strain that filters out is verified to the control efficiency of notoginseng root rot；The present invention is by obtaining trichoderma strain from Radix Notoginseng Rhizosphere Soil, reduce the workload of trichoderma strain screening, being filtered out by comprehensive systemization detection prevents the preferable trichoderma strain of effect to root rot, and the selection result is prevented and treated applied to notoginseng root rot, can obtain preferable function and effect.
Description
Technical field
The invention belongs to Chinese herbal medicine cultivation technology fields, sieve more particularly to a kind of trichoderma strain for preventing and treating notoginseng root rot
Choosing method.
Background technique
Radix Notoginseng Panax notoginseng(Burk.) F.H.Chen ] also known as pseudo-ginseng, Panax pseudoginseng, Typhonium flagelliforme (Lodd.) Blume, mountain paint
Deng being araliaceae ginseng plant, main product is clinical common traditional Chinese medicine in Yunnan, Guangxi and Sichuan and other places；Radix Notoginseng is sweet in flavor,
Slight bitter, it is warm-natured, return liver, stomach, the heart, small intestinl channel, there is hemostasis, dissipate the stasis of blood, is detumescence, analgesic, qi-restoratives, strong and other effects, cure mainly hemoptysis,
Bleeding from five sense organs or subcutaneous tissue, traumatic hemorrhage, treating swelling and pain by traumatic injury etc., in recent years for treating coronary heart disease, diabetes, antianginal, antithrombotic etc., saponins
Ingredient is the main physiologically active ingredient of Radix Notoginseng；Since the forties in last century, many scholars have carried out a series of grind to Radix Notoginseng
Study carefully, discloses its main component and Radix Notoginseng in hematological system, cardiovascular system, nervous system, immune system, metabolism system
System and various physiological activity such as anti-inflammatory, anti-aging, antitumor.
But since Radix Notoginseng large area unification is planted, so that disease occurs seriously, wherein root rot is in notoginseng planting
More serious disease, the Panax notoginseng root after catching an illness rot, and are in web rot and dry rot amphitypy, overground part Huang withers or green withered, long-term damage
5%~20% is lost, serious up to 70%, loss accounts for the 70%~85% of various Radix Notoginseng diseases.
The main pathogenic fungi of root rot is Fusarium oxysporum, Fusarium solani, become rusty rotten bacterium, Phytophthora cactorum etc., wherein rotten bacterium of becoming rusty
To the generation of root rot in extremely significant related；The generation of root rot and the variation of microbiologic population also have close relationship, pass through
High-flux sequence discovery: occurring the Rhizosphere Soil of root rot compared to the Rhizosphere Soil that do not fall ill, wherein the relative abundance of fungi bacterium
It significantly reduces, the relative abundance of trichoderma is significantly reduced, and shows that the disease incidence of trichoderma and root rot is negatively correlated.
Peasant uses agrochemicals pesticide control three root rot at present, however environment is made in the use of agricultural chemicals
At pollution, and leverage the quality of Radix Notoginseng, it is therefore desirable to which the environmental protection for finding substitution is microbe-derived to prevent phytopathy
Evil；In view of the negative correlativing relation of trichoderma and root rot, the trichoderma strain of orientation prevention and treatment notoginseng root rot is filtered out.
Summary of the invention
The purpose of the present invention is to provide a kind of trichoderma strain screening techniques for preventing and treating notoginseng root rot, pass through tier testing
Progressive to filter out to the good trichoderma strain of notoginseng root rot control efficiency, which considers trichoderma strain in Roots of Panax Notoginseng
The fertility in portion, trichoderma strain are to the fungistatic effect and trichoderma strain secondary metabolite of notoginseng root rot pathogen to three
The control efficiency of seven root rot, screening process is simple, easy to operate, and the trichoderma strain filtered out can effectively prevent notoginseng root rot,
Prevention and treatment can be oriented to notoginseng root rot.
The technical scheme adopted by the invention is that preventing and treating the trichoderma strain screening technique of notoginseng root rot, including following step
It is rapid:
Step 1, trichoderma strain is separated from the Rhizosphere Soil of Radix Notoginseng plant；
Fresh Radix Notoginseng plant is acquired, the rhizosphere soil of Radix Notoginseng plant is shrugged off, using the Rhizosphere Soil of Radix Notoginseng plant root under hairbrush brush,
1g Rhizosphere Soil is weighed to be dissolved in 10mL sterile distilled water, 2 will be rocked on solution is placed in 37 DEG C, revolving speed is 180rpm shaking table~
3min obtains stoste, and it is respectively 10 that stoste, which is diluted to mass concentration,-2g/mL、10-3g/mL、10-4g/mL、10-5The dilution of g/mL
Liquid, the dilution for measuring each mass concentration of 0.2mL is coated in rose bengal medium plate ware, in triplicate, by Bangladesh
Red culture medium flat plate ware is placed in culture 5d~7d in 25 DEG C~28 DEG C of incubator, after bacterium colony is grown, separates bacterium with transfer needle
It falls, and the single colonie of acquisition is forwarded to potato dextrose agar plate and carries out purifying culture, by the bacterial strain of purifying
It is transferred to the preservation at 4 DEG C of the inclined-plane PDA；
Step 2, PCR amplification is carried out using rDNA-ITS area of fungi universal primer ITS1, the ITS4 to trichoderma strain, amplification is produced
Object carries out DNA sequence dna sequencing, carries out BLAST alignment and homology analysis to sequencing result, determines purifying trichoderma strain
Type；
Step 3, detection trichoderma strain filters out to the sensitivity of saponin(e and is colonized good Trichoderma in Radix Notoginseng Rhizosphere Soil
Strain；
Step 4, detection trichoderma strain filters out the good trichoderma strain of fungistatic effect to the inhibitory effect of pathogen；
Step 5, the secondary metabolite fungistatic effect for the trichoderma strain that detecting step 3 and step 4 filter out jointly filters out secondary
The raw good trichoderma strain of metabolite fungistatic effect；
Step 6, the trichoderma strain filtered out is used to bottle carry in the root rot prevention and treatment of Radix Notoginseng, verifies the trichoderma strain of screening to three
The control efficiency of seven plant root rot.
Further, PCR amplification system in the step 2 are as follows: 10 μ L of MIX enzyme, the ITS1 that molar concentration is 10pmol/ μ L
1 μ L of primer, 1 μ L of ITS4 primer, the ddH that molar concentration is 10pmol/ μ L210 μ L of O and purifying 3 μ L of bacterial strain DNA profiling.
Further, PCR amplification process is as follows in the step 2: (1) 95 DEG C of initial denaturations 5min, (2) 95 DEG C of denaturation 30s,
(3) 50 DEG C of annealing 30s, (4) 72 DEG C of extensions 30s, (5) 72 DEG C of extension 10min, wherein (2)~(4) recycle 35 periods.
Further, it is as follows to the process of saponin(e sensitivity that trichoderma strain is detected in the step 3:
Step 31, Radix Notoginseng root tuber is pulverized and is soaked in 12h in the water and methanol that volume ratio is 3:7, collected supernatant and be placed in
Rotary evaporation obtains liquid solution in Rotary Evaporators, and liquid solution is dried in vacuo to obtain saponin(e dry matter；
Step 32, saponin(e dry matter is added in PDA culture medium, by PDA culture medium high-temperature sterilization 45min, pours out band medicine plate；
Step 33, each trichoderma strain is seeded on the band medicine plate containing saponin(e and forms each processing group, the band medicine of saponin(e is not added
Plate is CK group, observes the trichoderma strain of each processing group with the growing state on medicine plate, grows extremely to CK group area of colony
When 2/3, colony diameter is measured using crossing method, calculates saponin(e to the inhibiting rate of each trichoderma strain, inhibiting rate=(CK group
Colony diameter-processing group colony diameter)/CK group colony diameter.
Further, it is as follows to the process of pathogen inhibitory effect that trichoderma strain is detected in the step 4: being beaten using 5mm
Pathogens Causing Root Rot Disease and each trichoderma strain are seeded in PDA respectively for after Pathogens Causing Root Rot Disease and the punching of each trichoderma strain by hole device
The two sides of culture medium form each processing group, Pathogens Causing Root Rot Disease and trichoderma strain at a distance of 5.5cm, and CK group is that side is inoculated with cause of disease
Bacterium, other side seed agar block PDA culture medium, the alternation of light and darkness culture at 25 DEG C by PDA culture medium, to CK group area of colony
It is long to 2/3 when, measure the radius of bacterium colony, calculate inhibiting rate of the trichoderma strain to pathogen, the inhibiting rate=(colony radius-of CK group
The colony radius of processing group)/CK group colony radius.
Further, trichoderma strain secondary metabolite is detected in the step 5 to the process of pathogen inhibitory effect such as
Under:
Step 51, trichoderma strain is punched using 5mm punch, trichoderma strain fungus block is added in fluid nutrient medium PDB, 25
DEG C, alternation of light and darkness culture 7d under revolving speed 100rpm using 8 layers of sterile yarns filtering culture mycelia make that filtrate is extracted with ethyl acetate,
And Rotary Evaporators rotary evaporation is used, obtaining rufous grease-like substance is trichoderma strain secondary metabolite；
Step 52, trichoderma strain secondary metabolite is dissolved in methanol, lysate is injected at PDA using sterile filters and is trained
It supports and is mixed in base, fall to obtain with medicine plate；
Step 53, forming each processing group with the pathogen for being inoculated with notoginseng root rot on medicine plate, CK group in medicine plate not
Secondary metabolite containing trichoderma strain, when the pathogen area of colony of CK group it is long to 2/3 when, each band is measured using crossing method
The diameter of bacterium colony on medicine plate calculates the bacteriostasis rate of trichoderma strain secondary metabolite, inhibiting rate=(colony diameter-place of CK group
The colony diameter of reason group)/CK group colony diameter.
The beneficial effects of the present invention are: the present invention is first sorted out the trichoderma strain contained by Panax notoginseng root, pass through synthesis
The synbiosis of trichoderma strain and Radix Notoginseng, trichoderma strain are considered to bacteriostasis and trichoderma strain secondary generation of Pathogens Causing Root Rot Disease
The bacteriostasis for thanking to product, filters out that fungistatic effect is good, the orientable trichoderma strain applied to notoginseng root rot prevention and treatment, the sieve
Select process simple, easy to operate.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
Some embodiments of invention for those of ordinary skill in the art without creative efforts, can be with
It obtains other drawings based on these drawings.
Fig. 1 is flow chart of the invention.
Fig. 2 is the electrophoretogram of present invention purification trichoderma fungi.
Fig. 3 is inhibitory effect figure of the thick saponin(e to trichoderma.
Fig. 4 is opposite culture effect picture.
Fig. 5 is the inhibitory effect figure of T3-2 trichoderma strain secondary metabolism biology.
Fig. 6 is the inhibitory effect figure of T21 trichoderma strain secondary metabolism biology.
Fig. 7 is the disease incidence situation that bottle plants Radix Notoginseng.
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete
Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other
Embodiment shall fall within the protection scope of the present invention.
Embodiment
The trichoderma strain screening technique of notoginseng root rot is prevented and treated referring to Fig.1, specifically includes the following steps:
Step 1, the trichoderma strain in Radix Notoginseng Rhizosphere Soil is separated；
Fresh Radix Notoginseng plant is acquired, the rhizosphere soil of Radix Notoginseng plant is shrugged off, using Rhizosphere Soil under hairbrush brush, it is molten to weigh 1g Rhizosphere Soil
Solution in the sterile distilled water of 10mL, will be rocked on lysate is placed in 37 DEG C, revolving speed is 180rpm shaking table 2~3min obtain it is former
Liquid, it is respectively 10 that stoste, which is diluted to mass concentration,-2g/mL、10-3g/mL、10-4g/mL、10-5The dilution of g/mL measures
The dilution of each mass concentration of 0.2mL is coated in rose bengal medium plate ware, in triplicate, is then trained rose-bengal
It supports base plate ware and is placed in culture 5d~7d in 25 DEG C~28 DEG C of incubator, after bacterium colony is grown, separate different face with transfer needle
The bacterium colony of color and form, and the single colonie of acquisition is forwarded to potato dextrose agar plate and carries out purifying culture,
The bacterial strain of purifying is finally transferred to the preservation at 4 DEG C of the inclined-plane PDA；
Step 2, the bacterial strain that identification separation obtains,
The DNA of extraction purification bacterial strain uses fungi universal primer ITS1(TCCGTAGGTGAACCTGCGC), ITS4
(TCCTCCGCTTATTGATATGC) PCR amplification is carried out to the area rDNA-ITS of bacterial strain；
PCR amplification system are as follows: 1 μ L of ITS1 primer that 10 μ L of MIX enzyme, molar concentration are 10pmol/ μ L, molar concentration are
1 μ L of ITS4 primer, the ddH of 10pmol/ μ L210 μ L of O and purifying 3 μ L of bacterial strain DNA profiling；
PCR amplification process is as follows: (1) 95 DEG C of initial denaturation 5min, (2) 95 DEG C of denaturation 30s, (3) 50 DEG C of annealing 30s, (4) 72 DEG C are prolonged
30s is stretched, (5) 72 DEG C of extension 10min, wherein (2)~(4) recycle 35 periods；
The expanding effect of electrophoretic process detection bacterial strain DNA is carried out to pcr amplification product, wherein DNA Marker is bacterial strain DNA piece
The ladder marker of segment length is taken pictures after electrophoresis using UV gel imaging system using 180V electrophoresis 20min or so,
Electrophoresis result is as shown in Fig. 2, Maker(M very clear by the DNA electrophoretogram of purifying bacterial strain known to electrophoretogram 2) with bacterial strain DNA
Band (1-23) reaches sequencing standard, send Kunming Shuo Qing Co., Ltd to carry out DNA sequence dna sequencing in sample, sequencing result is set
In carrying out BLAST sequence alignment and homology analysis on the website NCBI, determines the type of purifying trichoderma strain, extracted in embodiment
Trichoderma strain be T68, T7, T64, T62, T89, T70, T66, T30, T14, T69, T44, T28, T2, T21 and T3-2 respectively；
Step 3, the different trichoderma strains of Detection and Extraction are filtered out and are colonized well in Radix Notoginseng Rhizosphere Soil to the sensitivity of saponin(e
Trichoderma strain；
Step 4, different trichoderma strains are detected to the inhibitory effect of notoginseng root rot pathogen, filter out the good wood of fungistatic effect
Trichoderma strain；
Step 5, the fungistatic effect of the secondary metabolite for the trichoderma strain that detecting step 3 and step 4 are screened jointly filters out secondary
The raw good trichoderma strain of metabolite fungistatic effect；
Step 6, trichoderma strain step 5 filtered out is applied to bottle and carries in the root rot prevention and treatment of Radix Notoginseng, verifies the trichoderma of screening
The root rot control efficiency of bacterial strain.
Radix Notoginseng can secrete saponin(e during the growth process come the growth for inhibiting many beneficial bacteriums and beneficial bacterium root in soil
In field planting, so different trichoderma strains can be assessed three to the sensitivity of saponin(e by detecting different trichoderma strains in step 3
Colonization ability in seven Rhizosphere Soils, specific detection process are as follows:
Step 31, thick saponin(e is prepared,
It is soaked in 12h in the water and methanol that volume ratio is 3:7 after Radix Notoginseng root tuber is pulverized, collects supernatant in rotary evaporation
Rotary evaporation obtains liquid solution in instrument, and liquid solution vacuum freeze drying is obtained saponin(e dry matter；
Step 32, preparation band medicine plate,
Saponin(e dry matter is added in PDA culture medium, 15 groups of PDA culture mediums containing saponin(e are obtained, so that thick in every group of culture medium
The concentration of saponin(e is that 1ppm, 10ppm, 100ppm and 1000ppm train PDA wherein the PDA culture medium of not overstriking saponin(e is CK
It supports base and carries out high-temperature sterilization 45min, pouring out the culture medium with the thick saponin(e of various concentration is band medicine plate；
Step 33, it is inoculated with trichoderma strain,
15 kinds of trichoderma strains are inoculated in respectively on the band medicine plate with medicine plate and CK group of the thick saponin(e containing various concentration, to CK
When group area of colony grows to 2/3, colony diameter is measured using crossing method；
Step 34, statistical data,
Inhibiting rate=(colony diameter of CK group-processing group colony diameter)/CK group colony diameter obtains different in triplicate
Growing state of the trichoderma strain in different saponin concentrations, and then judge the influence that saponin(e is colonized trichoderma strain, assessment result
As shown in Figure 3；
From the figure 3, it may be seen that the thick saponin(e of low concentration is very low to the inhibiting effect of trichoderma strain T21, to trichoderma strain T3-2 have compared with
Good promotion mycelia growth, the thick saponin(e of high concentration has certain inhibiting effect to trichoderma strain T21, to trichoderma strain
T3-2 has the function of promotion mycelia growth, and bacterial strain T21 and bacterial strain T3-2 are insensitive to saponin(e, are conducive to trichoderma strain in soil
It is colonized in earth, saponin(e influences the field planting of trichoderma strain more obvious in other groups.
It is as follows to the operating process of notoginseng root rot pathogen fungistatic effect that trichoderma strain is detected in step 4 of the present invention:
Using 5mm punch by after Pathogens Causing Root Rot Disease and different Trichoderma punchings, it is inoculated in the two of PDA culture medium respectively
Side, the two is at a distance of 5.5cm, and CK group is the PDA culture medium that side is inoculated with Pathogens Causing Root Rot Disease, other side seed agar block, by PDA
Culture medium alternation of light and darkness culture at 25 DEG C, when CK group bacterium colony growth area it is long to 2/3 when, measure the radius of bacterium colony, 3 times repeatedly
Statistical data afterwards, calculates trichoderma strain to the inhibiting rate of notoginseng root rot pathogen, inhibitory effect as shown in figure 4, inhibiting rate=
The colony radius of (colony radius of CK group-processing group colony radius)/CK group；
As shown in Figure 4, different trichoderma strains has preferable control efficiency to Pathogens Causing Root Rot Disease, wherein bacterial strain T21, bacterial strain
T3-2 and Pathogens Causing Root Rot Disease are best to pathogen inhibitory effect in opposite culture, and inhibiting rate reaches 70% or more；
Comprehensively consider the synbiosis of trichoderma strain Yu Radix Notoginseng foundation, i.e., trichoderma strain is to the quick of saponin(e secreted by Panax notoginseng Growth
Sense degree is mutually promoted with the root growth of trichoderma strain and Radix Notoginseng, improve Panax notoginseng root beneficial microorganism quantity, kill and
The pathogen quantity for forcing down notoginseng root rot is standard, is filtered out to Pathogens Causing Root Rot Disease inhibitory effect preferably and in Roots of Panax Notoginseng
Portion is colonized good trichoderma strain, is bacterial strain T21, bacterial strain T3-2 respectively.
Secondary metabolite is the antibacterial important means of trichoderma strain, is whether evaluation trichoderma strain has biological and ecological methods to prevent plant disease, pests, and erosion ability
Important indicator evaluates Trichoderma by the fungistatic effect of the secondary metabolite of detection bacterial strain T21, bacterial strain T3-2 in step 5
The biological and ecological methods to prevent plant disease, pests, and erosion ability of strain, detailed process is as follows:
Step 51, secondary metabolite is extracted,
Trichoderma strain T21 and bacterial strain T3-2 is punched using 5mm punch, respectively adds 5 bacterial strain T21 and bacterial strain T3-2 fungus block
Enter in fluid nutrient medium PDB, the alternation of light and darkness culture 7d at 25 DEG C, revolving speed 100rpm, uses 8 layers of sterile yarn filtering culture bacterium
Silk makes that filtrate is extracted with ethyl acetate, and uses Rotary Evaporators rotary evaporation, and obtaining rufous grease-like substance is trichoderma
Bacterial strain secondary metabolite；
Step 52, preparation band medicine plate,
Trichoderma strain secondary metabolite is dissolved in methanol, is trained the PDA that lysate is injected in sterilizing using sterile filters
Support base in mix, in PDA culture medium the concentration of secondary metabolite be 10ppm, 50ppm, 75ppm, 125ppm, 250ppm,
500ppm and 1000ppm, fall various concentration band medicine plate；
Step 53, pathogenic strains are inoculated with,
Pathogenic strains RS006 is inoculated on the band medicine plate without secondary metabolite concentration, in the band medicine plate of CK group not
Secondary metabolite containing trichoderma strain, when the pathogen area of colony of CK group it is long to 2/3 when, bacterium colony is measured using crossing method
Diameter is repeated 3 times, and calculates inhibiting rate of the different trichoderma strain secondary metabolites to notoginseng root rot pathogen, inhibitory effect
As shown in figures 5 and 6, inhibiting rate=(colony diameter of CK group-processing group colony diameter)/CK group colony diameter；
By Fig. 5,6 it is found that the secondary metabolite of bacterial strain T21, bacterial strain T3-2 all have good bacteriostatic activity, secondary metabolism is produced
The half-maximal effect concentration of object is 250ppm, and fungistatic effect has dependence to concentration.
It is as follows that the process that trichoderma strain plants Radix Notoginseng biocontrol effect to bottle is detected in step 6:
Soil high-temperature high pressure sterilization is placed in bottle, 3 each bottle dress 80g sterilized soil, transplanting annual Radix Notoginseng plant will
The configured pathogen RS006 spore suspension of 10mL and 10mL Trichoderma spore suspension are added in bottle simultaneously, repeat 4 groups,
10mL pathogen spore suspension is only added in CK group, and alternation of light and darkness culture 7d counts the disease incidence of Radix Notoginseng, statistics knot at 25 DEG C
Fruit is as shown in Figure 7；
As shown in Figure 7, bacterial strain T21, bacterial strain T3-2 spore suspension have the effect of protection Radix Notoginseng plant, wherein bacterial strain T3-2
Biocontrol effect it is preferable, the disease incidence of Radix Notoginseng plant is only 17% after adding bacterial strain T3-2.
The present invention separates the trichoderma strain in Radix Notoginseng Rhizosphere Soil first, is not sieving to magnanimity trichoderma strain for blindness
Choosing, reduces the workload of screening, and secondly the present invention has judged the synbiosis of trichoderma strain Yu Radix Notoginseng plant in screening, really
Protect trichoderma strain can be good at being colonized near the root of Radix Notoginseng plant, and comprehensively considered trichoderma strain fungistatic effect and
The fungistatic effect of trichoderma strain secondary metabolite keeps the trichoderma strain of screening preferable to the control efficiency of notoginseng root rot, and
Can be used for a long time, cost it is small.
Each embodiment in this specification is all made of relevant mode and describes, same and similar portion between each embodiment
Dividing may refer to each other, and each embodiment focuses on the differences from other embodiments.Especially for system reality
For applying example, since it is substantially similar to the method embodiment, so being described relatively simple, related place is referring to embodiment of the method
Part explanation.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the scope of the present invention.It is all
Any modification, equivalent replacement, improvement and so within the spirit and principles in the present invention, are all contained in protection scope of the present invention
It is interior.
Claims (6)
1. the trichoderma strain screening technique for preventing and treating notoginseng root rot, which comprises the following steps:
Step 1, trichoderma strain is separated from the Rhizosphere Soil of Radix Notoginseng plant；
Fresh Radix Notoginseng plant is acquired, the rhizosphere soil of Radix Notoginseng plant is shrugged off, using the Rhizosphere Soil of Radix Notoginseng plant root under hairbrush brush,
1g Rhizosphere Soil is weighed to be dissolved in 10mL sterile distilled water, 2 will be rocked on solution is placed in 37 DEG C, revolving speed is 180rpm shaking table~
3min obtains stoste, and it is respectively 10 that stoste, which is diluted to mass concentration,-2g/mL、10-3g/mL、10-4g/mL、10-5The dilution of g/mL
Liquid, the dilution for measuring each mass concentration of 0.2mL is coated in rose bengal medium plate ware, in triplicate, by Bangladesh
Red culture medium flat plate ware is placed in culture 5d~7d in 25 DEG C~28 DEG C of incubator, after bacterium colony is grown, separates bacterium with transfer needle
It falls, and the single colonie of acquisition is forwarded to potato dextrose agar plate and carries out purifying culture, by the bacterial strain of purifying
It is transferred to the preservation at 4 DEG C of the inclined-plane PDA；
Step 2, PCR amplification is carried out using rDNA-ITS area of fungi universal primer ITS1, the ITS4 to trichoderma strain, amplification is produced
Object carries out DNA sequence dna sequencing, carries out BLAST alignment and homology analysis to sequencing result, determines purifying trichoderma strain
Type；
Step 3, detection trichoderma strain filters out to the sensitivity of saponin(e and is colonized good Trichoderma in Radix Notoginseng Rhizosphere Soil
Strain；
Step 4, detection trichoderma strain filters out the good trichoderma strain of fungistatic effect to the inhibitory effect of pathogen；
Step 5, the secondary metabolite fungistatic effect for the trichoderma strain that detecting step 3 and step 4 filter out jointly filters out secondary
The raw good trichoderma strain of metabolite fungistatic effect；
Step 6, the trichoderma strain filtered out is used to bottle carry in the root rot prevention and treatment of Radix Notoginseng, verifies the trichoderma strain of screening to three
The control efficiency of seven plant root rot.
2. the trichoderma strain screening technique of prevention and treatment notoginseng root rot according to claim 1, which is characterized in that the step
PCR amplification system in 2 are as follows: 1 μ L of ITS1 primer, the molar concentration 10pmol/ that 10 μ L of MIX enzyme, molar concentration are 10pmol/ μ L
1 μ L of ITS4 primer, the ddH of μ L210 μ L of O and purifying 3 μ L of bacterial strain DNA profiling.
3. the trichoderma strain screening technique of prevention and treatment notoginseng root rot according to claim 1, which is characterized in that the step
PCR amplification process is as follows in 2: (1) 95 DEG C of initial denaturation 5min, (2) 95 DEG C of denaturation 30s, (3) 50 DEG C of annealing 30s, (4) 72 DEG C are prolonged
30s is stretched, (5) 72 DEG C of extension 10min, wherein (2)~(4) recycle 35 periods.
4. the trichoderma strain screening technique of prevention and treatment notoginseng root rot according to claim 1, which is characterized in that the step
It is as follows to the process of saponin(e sensitivity that trichoderma strain is detected in 3:
Step 31, Radix Notoginseng root tuber is pulverized and is soaked in 12h in the water and methanol that volume ratio is 3:7, collected supernatant and be placed in
Rotary evaporation obtains liquid solution in Rotary Evaporators, and liquid solution is dried in vacuo to obtain saponin(e dry matter；
Step 32, saponin(e dry matter is added in PDA culture medium, by PDA culture medium high-temperature sterilization 45min, pours out band medicine plate；
Step 33, each trichoderma strain is seeded on the band medicine plate containing saponin(e and forms each processing group, the band medicine of saponin(e is not added
Plate is CK group, observes the trichoderma strain of each processing group with the growing state on medicine plate, grows to CK group area of colony to 2/3
When, colony diameter is measured using crossing method, calculates inhibiting rate of the saponin(e to each trichoderma strain, the inhibiting rate=(bacterium colony of CK group
Diameter-processing group colony diameter)/CK group colony diameter.
5. the trichoderma strain screening technique of prevention and treatment notoginseng root rot according to claim 1, which is characterized in that the step
It is as follows to the process of pathogen inhibitory effect that trichoderma strain is detected in 4: using 5mm punch by Pathogens Causing Root Rot Disease and each trichoderma
After bacterial strain punching, the two sides that Pathogens Causing Root Rot Disease and each trichoderma strain are seeded in PDA culture medium are formed into each processing group, root respectively
At a distance of 5.5cm, CK group is the PDA culture that side is inoculated with pathogen, other side seed agar block for maize ear rot pathogen and trichoderma strain
Base, the alternation of light and darkness culture at 25 DEG C by PDA culture medium, when CK group area of colony it is long to 2/3 when, measure the radius of bacterium colony, count
Calculate inhibiting rate of the trichoderma strain to pathogen, inhibiting rate=(colony radius of CK group-processing group colony radius)/CK group bacterium
Fall radius.
6. the trichoderma strain screening technique of prevention and treatment notoginseng root rot according to claim 1, which is characterized in that the step
It is as follows to the process of pathogen inhibitory effect that trichoderma strain secondary metabolite is detected in 5:
Step 51, trichoderma strain is punched using 5mm punch, trichoderma strain fungus block is added in fluid nutrient medium PDB, 25
DEG C, alternation of light and darkness culture 7d under revolving speed 100rpm using 8 layers of sterile yarns filtering culture mycelia make that filtrate is extracted with ethyl acetate,
And Rotary Evaporators rotary evaporation is used, obtaining rufous grease-like substance is trichoderma strain secondary metabolite；
Step 52, trichoderma strain secondary metabolite is dissolved in methanol, lysate is injected at PDA using sterile filters and is trained
It supports and is mixed in base, fall to obtain with medicine plate；
Step 53, forming each processing group with the pathogen for being inoculated with notoginseng root rot on medicine plate, CK group in medicine plate not
Secondary metabolite containing trichoderma strain, when the pathogen area of colony of CK group it is long to 2/3 when, each band is measured using crossing method
The diameter of bacterium colony on medicine plate calculates the bacteriostasis rate of trichoderma strain secondary metabolite, inhibiting rate=(colony diameter-place of CK group
The colony diameter of reason group)/CK group colony diameter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910779286.0A CN110423696A (en) | 2019-08-22 | 2019-08-22 | The trichoderma strain screening technique for preventing and treating notoginseng root rot |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910779286.0A CN110423696A (en) | 2019-08-22 | 2019-08-22 | The trichoderma strain screening technique for preventing and treating notoginseng root rot |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110423696A true CN110423696A (en) | 2019-11-08 |
Family
ID=68415546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910779286.0A Pending CN110423696A (en) | 2019-08-22 | 2019-08-22 | The trichoderma strain screening technique for preventing and treating notoginseng root rot |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110423696A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699301A (en) * | 2019-11-15 | 2020-01-17 | 云南大学 | Bacterial strain and application thereof in preventing and treating root rot of panax notoginseng |
| CN114766305A (en) * | 2022-05-27 | 2022-07-22 | 苏州农业职业技术学院 | Method for adjusting composition structure of rhizosphere microbial community for panax notoginseng seedling culture |
| CN117126750A (en) * | 2023-08-30 | 2023-11-28 | 云南农业大学 | Fusarium oxysporum J2 strain and application thereof in biological prevention and control and growth promotion of pseudo-ginseng |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045482A (en) * | 2011-10-11 | 2013-04-17 | 上海万力华生物科技有限公司 | Trichoderma harzianum strain |
| CN105994243A (en) * | 2016-05-18 | 2016-10-12 | 文山七麟三七科技有限公司 | Soil fumigation disinfection method for solving problem of incapability of pseudo-ginseng succession cropping |
| CN106566777A (en) * | 2016-11-09 | 2017-04-19 | 中国农业大学 | Trichoderma koningiopsis T5-1 bacterial strain and application thereof in improvement of growth of panax notoginseng and prevention and control of root rot |
-
2019
- 2019-08-22 CN CN201910779286.0A patent/CN110423696A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045482A (en) * | 2011-10-11 | 2013-04-17 | 上海万力华生物科技有限公司 | Trichoderma harzianum strain |
| CN105994243A (en) * | 2016-05-18 | 2016-10-12 | 文山七麟三七科技有限公司 | Soil fumigation disinfection method for solving problem of incapability of pseudo-ginseng succession cropping |
| CN106566777A (en) * | 2016-11-09 | 2017-04-19 | 中国农业大学 | Trichoderma koningiopsis T5-1 bacterial strain and application thereof in improvement of growth of panax notoginseng and prevention and control of root rot |
Non-Patent Citations (4)
| Title |
|---|
| XIU-HONG JIA ET AL.,: "Comparative studies of saponins in 1–3-year-old main roots,fibrous roots, and rhizomes of Panax notoginseng,and identification of different parts and growth-year samples", 《J NAT MED》 * |
| 中国科协: "《2016-2017植物保护学学科发展报告》", 31 March 2018, 中国科学技术出版社 * |
| 刘凯: "三七源的两株真菌次生代谢产物及其生物活性研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 叶云峰等: "三七主要病害生防真菌F2的抑菌作用测定及其鉴定", 《西南农业学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699301A (en) * | 2019-11-15 | 2020-01-17 | 云南大学 | Bacterial strain and application thereof in preventing and treating root rot of panax notoginseng |
| CN110699301B (en) * | 2019-11-15 | 2022-11-08 | 云南大学 | Bacterial strain and application thereof in preventing and treating root rot of panax notoginseng |
| CN114766305A (en) * | 2022-05-27 | 2022-07-22 | 苏州农业职业技术学院 | Method for adjusting composition structure of rhizosphere microbial community for panax notoginseng seedling culture |
| CN117126750A (en) * | 2023-08-30 | 2023-11-28 | 云南农业大学 | Fusarium oxysporum J2 strain and application thereof in biological prevention and control and growth promotion of pseudo-ginseng |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110423696A (en) | The trichoderma strain screening technique for preventing and treating notoginseng root rot | |
| CN106754489A (en) | Methylotrophic bacillus F7 and its application | |
| CN110982725B (en) | Bacillus for antagonizing fusarium wilt and promoting growth and application thereof | |
| CN104342388B (en) | Streptomycete bacterial strain and prevent and treat tomato wilt use in conjunction | |
| CN106701623B (en) | The atrophy bacillus of one plant of antagonism fructus lycii root rot and its application | |
| CN1994092A (en) | A biological weed killer and preparation process thereof | |
| CN106801014A (en) | A kind of endogenetic fungus and its application for improving red sage root yield and its active constituent content | |
| CN110982724A (en) | Bacillus for antagonizing phytopathogen and promoting rooting and application thereof | |
| CN106434371A (en) | Neopestalotiopsis zerumbet and method of using same to identify Alpinia zerumbet leaf diseases | |
| CN112877235A (en) | Bacillus belgii ZZBV-3 and application thereof | |
| CN104450560B (en) | One plant of nematicide Sphingobacterium bacterial strain and its application | |
| CN111733081A (en) | Biological agent formula suitable for preventing and treating tomato root-knot nematode diseases | |
| CN103194421A (en) | Alternaria alternate spore suspension liquid and application thereof | |
| CN109266559A (en) | A kind of application of Trichoderma harzianum LTR-2 | |
| Khalifa | Biological control of Fusarium wilt of peas by organic soil amendments | |
| CN105360168A (en) | Method used for preventing alien weed Alternanthera philoxeroides with pathogenic fungus | |
| CN105018393A (en) | Bacillus megaterium strain and application thereof | |
| CN107937302A (en) | A kind of bacterium D10 for improving heavy metal validity and its application | |
| CN107164233A (en) | A kind of chaetomium globosum LJ S2L1 bacterial strains and its application | |
| CN115851553A (en) | Streptomyces virginiae capable of preventing and treating clubroot and application thereof | |
| CN113999788B (en) | Actinomycetes and application thereof | |
| CN101831388B (en) | Nematophagous fungus and preparation method and application thereof | |
| CN105567569B (en) | A kind of cultural method of dendrobium candidum brown patch germ | |
| CN108148768A (en) | Tortomium globosum strain and application thereof | |
| CN104293710B (en) | Streptomycete strains and combined application thereof in prevention and treatment of pepper seedling blight |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191108 |