CN110358852A - Reagent, kit and its application for vibrio parahaemolyticus - Google Patents

Abstract

The invention discloses a kind of reagents, kit and its application for vibrio parahaemolyticus.The detection reagent include the first primer to, the second primer pair, third primer pair and the 4th primer pair；The first primer is to including the sequence the first primer as shown in SEQ ID NO:1, SEQ ID NO:2, the second primer respectively；Second primer pair includes the sequence third primer as shown in SEQ ID NO:3, SEQ ID NO:4, the 4th primer respectively；The third primer pair includes sequence the 5th primer, the 6th primer as shown in SEQ ID NO:5, SEQ ID NO:6 respectively；4th primer pair includes sequence the 7th primer, the 8th primer as shown in SEQ ID NO:7, SEQ ID NO:8 respectively.The present invention intends the color change that substrate for enzymatic activity redox reaction generates by tetra- serobila nucleic acid of G-, judges whether contain vibrio parahaemolytious in food to be measured with direct visual perception；Detection method provided by the invention has many advantages, such as quick, visualization, hypersensitive.

Description

Reagent, kit and its application for vibrio parahaemolyticus

Technical field

Detection reagent, kit and its application that the present invention relates to a kind of for detecting vibrio parahaemolytious, in particular to one Nucleic acid of the kind for early stage vibrio parahaemolyticus intends enzyme colorimetric detection reagent, kit and its application, and it is raw to belong to molecule Object detection technique field.

Background technique

Public health problem caused by food borne pathogenic microorganism is a great problem in the world, and omission factor is up to 95% More than.To be estimated according to WHO, the whole world is no less than 2,000,000 people because of population dead caused by food-borne microbial infectious diarrhea every year, Wherein most is since diet and drinking-water receive the pollution of microorganism.Food poisoning caused by vibrio parahaemolytious, in bacterium Property food poisoning in the ratio that accounts for it is very high, harm is only second to salmonella, Escherichia coli, staphylococcus and clostridium botulinum.

Vibrio parahemolyticus pathogen is a kind of important pathogenic entero becteria, is the facultative Halophiles of Gram-negative, the world Visible human infection vibrio parahaemolytious causes acute gastroenteritis for various regions, is a kind of important food-borne pathogens.Secondary haemolysis arc Bacterium is distributed in all over the world, is typically found in bay and coastline region and marine product, and people Duo Yin is edible to pollute this bacterium again Marine product without well processed such as crab class, oyster, shrimp etc. and cause to poison by food.

Nucleic acid intends the peroxidase sample compound that enzyme is nucleic acid, and it typically is single-stranded DNA/RNA.Nucleic acid intends enzyme can be with It is folded into stable and catalytic activity tetra- serobila of G-, it is in combination in the presence of hemin to be catalyzed some chemical reactions Color change is generated, can be used for open hole detection.By nucleic acid intend enzyme combination normal PCR not only can to avoid the pollution of nucleic acid dye, The requirement to experiment equipment is reduced, simplifies the operating procedure of normal PCR detection, improves the sensitivity of detection method, it is important that Make detection naked eyes are visible can also carry out quantitative detection in conjunction with other instruments.

At present, domestic to have had corresponding national standard and professional standard, method for the detection of vibrio parahemolyticus It is roughly divided into following Cheng Qian's increasing bacterium selective enrichment of crossing and selectively cultivates biochemical identification Kahagawa phenomenon and Serologic test. Checkout procedure needs one could report positive findings.The method of inspection is cumbersome, time-consuming and laborious, not only influences the work effect of inspection body Rate, and extend the Product transport of production division and storage time, production cost increases.PCR is widely used in detection and comes from The vibrio parahaemolytious of Food and environment sample.Recently, sensitivity and specificity and quickly turnover of the real-time PCR because of its enhancing Time and be becoming increasingly popular.The fluorescent quantitation method of existing detection vibrio parahaemolytious, but the fluorescence quantitative PCR instrument valence used Value is expensive, and use cost is high, is not still able to satisfy the requirement of monitoring in base.Traditional PCR instrument needs the side of attached gel electrophoresis Method analyzes size and the brightness of band to judge, the sensitivity not only detected is not as good as quantitative fluorescent PCR, and there are gel electrophoresis behaviour Make the pollution problem of complex steps and laboratory nucleic acid dye.With the exploitation of the universal and portable instrument of traditional PCR technique, Make it possible Fields detection, but gel electrophoresis is time-consuming and laborious and have certain biohazard to grasp experiment to observe result Basic demand is high, therefore needs a kind of portable, quick, sensitive, safe, visual detection method based on normal PCR.In order to Timely and effectively cope with following outburst, it is necessary to there are enough sensitivities, special and reliable method, for quickly and easily detecting Vibrio parahaemolytious.

Summary of the invention

The main purpose of the present invention is to provide one kind being capable of sensitiveer, rapid and convenient, visual fast for early stage The nucleic acid of speed detection vibrio parahaemolytious intends enzyme colorimetric detection reagent, kit and its application, to overcome deficiency in the prior art.

For realization aforementioned invention purpose, the technical solution adopted by the present invention includes:

On the one hand the embodiment of the present invention provides a kind of detection reagent comprising the first primer to, the second primer pair, third Primer pair and the 4th primer pair；

The first primer is to including the first primer and the second primer, the sequence difference of the first primer and the second primer As shown in SEQ ID NO:1, SEQ ID NO:2；

Second primer pair includes third primer and the 4th primer, the sequence difference of the third primer and the 4th primer As shown in SEQ ID NO:3, SEQ ID NO:4；

The third primer pair includes the 5th primer and the 6th primer, the sequence difference of the 5th primer and the 6th primer As shown in SEQ ID NO:5, SEQ ID NO:6；

4th primer pair includes the 7th primer and the 8th primer, the sequence difference of the 7th primer and the 8th primer As shown in SEQ ID NO:7, SEQ ID NO:8.

Further, the first primer, third primer, the 5th primer, the 7th primer 5 ' end have tandem sequence repeats bird Purine (G) and the complementary series that the quasi- enzyme of nucleic acid can be formed.

Further, the detection reagent further includes archaeal dna polymerase and PCR general components, the PCR general components packet Include dNTP mixed liquor, the PCR reaction buffer containing magnesium ion and deionized water.

Further, the detection reagent further include hemin solution, Klorvess Liquid, HEPES buffer solution, Develop the color A liquid, colour developing B liquid and terminate liquid.

Further, the concentration of the hemin solution is 67.5 μM.

Further, the concentration of the Klorvess Liquid is 500mM.

Further, the HEPES buffer solution according to 25m M Hepes, 20m M KCl, 200m M NaCl, The reagent that 0.025% (w/v) Triton X-100,1% (v/v) DMSO are configured to 50ml is spare, the HEPES buffer solution PH is 7.4 or so.

Further, the colour developing A liquid, by the sodium acetate of 13.6g, the citric acid of 1.6g, 0.05g sodium sulfite, 30% hydrogen peroxide 0.3ml, 5 μ l polysorbas20 mix and be settled to 500ml, by the solution prepared under the conditions of 121 DEG C high pressure Sterilize 30min, and using 0.22 μm of membrane filtration, be placed in dark colored plastic bottle and saved under the conditions of 4 DEG C.

Further, the colour developing B liquid, by the EDETATE DISODIUM of 0.2g, the citric acid of 0.95g, 50ml glycerol, The L-cysteine hydrochloride of 0.05g, 0.15g TMB are dissolved in 3ml DMSO, and ddH2O is added and is settled to 500ml (all operations It is carried out in the dark), the colour developing B liquid after preparing is placed in dark glass bottle and saves under the conditions of 4 DEG C.

Further, colour developing A liquid and colour developing B liquid are that make a comparison instantly mixing uses.

Further, the detection reagent further include: dimethyl Asia haze, L-cysteine hydrochloride, citric acid, dense sulphur Acid, sodium sulfite, glycerol, hydrogen peroxide, sodium acetate, EDETATE DISODIUM；It is mainly used for improve colour reagent stability with And the sensitivity of color developing effect.

The embodiment of the invention also provides a kind of kits comprising the detection reagent.

The embodiment of the invention also provides a kind of product applied to vibrio parahaemolytious detection method, the product includes institute Detection reagent or the kit are stated, also, the detection method includes:

Using the first primer to, the second primer pair, third primer pair, the 4th primer pair, by pcr amplification reaction from The nucleic acid extracted is expanded in sample to be tested；

By after PCR amplification product and hemin solution, Klorvess Liquid, HEPES buffer solution be mixed to form the One mixed system heats constant-temperature incubation after unwinding；

The first mixed system and the colour developing A liquid after incubation and the B liquid that develops the color are mixed to form the second mixed system, and led to The color for crossing the second mixed system of observation or the OD value for detecting the second mixed system are realized to vibrio parahaemolytious in sample to be tested Qualitative or quantitative detection.

Further, the reaction system of the pcr amplification reaction are as follows: 1.25 μ L of Taq DNA Polymerase (5U/ μ l), 10 × Taq Buffer, 5 μ L, dNTP Mix (10mmol/L) 1 μ L, MgCl₂(25mmol/L) 4 μ L, 2 μ of upstream primer (10uM) L, 2 μ L of downstream primer (10uM), 2 μ L of sample template supply 32.75 μ L ddH₂O to total volume be 50 μ L.

Further, the reaction condition of the pcr amplification reaction are as follows: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30sec, 58 DEG C annealing 30sec, 72 DEG C of extensions 1min expand 30 circulations, 72 DEG C of 5min of abundant extension.

Further, the detection method includes: that first mixed system is heated unwinding under the conditions of 98 DEG C or so, Later in 37 DEG C of constant-temperature incubations.

Compared with prior art, the invention has the advantages that

1) present invention intends the color change that substrate for enzymatic activity redox reaction generates by tetra- serobila nucleic acid of G-, can be with Naked eyes directly judge whether contain vibrio parahaemolytious in food to be measured simultaneously；Detection method provided by the invention have quickly, can The advantages that depending on change, hypersensitive, also, the detection sensitivity for improving food-borne pathogens, the reality for reducing cost and convenience It is now of great significance, for carrying out quick inspection that is universal or carrying out vibrio parahaemolytious in the more insufficient laboratory of experimental situation Survey has huge help；

2) detection method provided by the invention, without complex operations, without large-scale instrument and equipment, high sensitivity, convenient, high Effect, low cost, it is not only possible to solve to be badly in need of food-borne cause in vast base, rural area, the market of farm produce and under-developed area etc. at present The place of Pathogen detection is difficult to the problem of large area carries out food-borne pathogens detection, moreover it is possible to develop, using the direct interpretation of mobile phone Software so that the detection of vibrio parahaemolytious is simpler, intuitive；

3) detection method provided by the invention and its kit can be widely used for farming and animal husbandry and food industry, food-borne pathogenic Bacterium clinical detection, customs inspection are examined, environmental monitoring, the fields such as communicable disease prevention and control, such as staphylococcus aureus, Salmonella Bacterium, enterohemorrhagic escherichia coli, Listeria Monocytogenes, Shigella, etc. common food-borne pathogens.

Detailed description of the invention

Fig. 1 is a kind of testing principle and step of the quasi- enzyme colorimetric detection reagent box of nucleic acid in an exemplary embodiments of the invention Schematic diagram；

Fig. 2 a, 2b, 2c are the pcr amplification product that vibrio parahemolyticus specificity is detected in the embodiment of the present invention 1 respectively Agarose gel analysis, chrominance response, absorbance schematic diagram；

Fig. 3 is the gel electricity in the embodiment of the present invention 2 after four pairs of primer pair vibrio parahaemolytious, four kinds of virulence gene PCR amplifications Swimming result；

Fig. 4 is that nucleic acid intends enzyme after four pairs of primer pair vibrio parahaemolytious, four kinds of virulence gene PCR amplifications in the embodiment of the present invention 2 Colorimetric results；

Fig. 5 is that 2 amplifying nucleic acid of the embodiment of the present invention intends the absorption value measured after enzymic colorimetric colour developing in 450nm.

Specific embodiment

In view of deficiency in the prior art, inventor is studied for a long period of time and is largely practiced, and is able to propose of the invention Technical solution.The technical solution, its implementation process and principle etc. will be further explained as follows.

Explanation of technical terms used in description of the invention:

Primer: the starting material of DNA synthesis.Generally a pair of of single-stranded oligonucleotide, after hybridizing with template, DNA synthesis from Its 3 ' end starts.

PCR: polymerase chain reaction (PCR) is a kind of for amplifying the molecular biology skill for expanding specific DNA fragmentation Art, it is considered as the special DNA replication dna of in vitro, and the maximum feature of PCR is that micro DNA can be significantly increased.

Tetra- serobila of G-: tetra- serobila of G- (G-quadruplex) is rolled over by DNA or RNA rich in tandem sequence repeats guanine (G) The folded higher structure formed.G- tetrad (G-quartet) is the structural unit of four serobilas, connects 4 by Hoogsteen hydrogen bond G forms ring plain, and two layers or more of tetrad forms four serobilas by pi-pi accumulation.

Nucleic acid: the common name of DNA (DNA) and ribonucleic acid (RNA).

Nucleic acid intends enzyme: tetra- serobilas of G-/ferroheme of the structuring formed in the presence of tetra- serobila nucleic acid of G- and Hemin is compound Object has peroxidase activity, generates blue by catalysis oxidation TMB.

Expansion: unwinding is single-stranded nucleic acid and keeps single-stranded state the PCR product through amplified reaction at high operating temperatures.

Base pair complementarity principle: base pair complementarity principle refers in DNA or certain double stranded rna molecule structures, by There is hydrogen bond between base fixed the distance between two chains of number and DNA to remain unchanged, so that base pairing is necessary Certain rule is followed, here it is A (adenine) centainly to match with T (thymidine), matches in RNA with U (uracil), G (guanine) is centainly matched with C (cytimidine), and vice versa, and this one-to-one relationship between base is called base complementrity and matches To principle.

Catalysis reaction: the chemical reaction carried out under the action of catalyst is known as being catalyzed reaction.

Redox reaction: (oxidation-reduction reaction, also makees redox to redox reaction It reaction) is chemical reaction front and back, a kind of reaction that the oxidation number of element changes.The essence of redox reaction is electronics Gain and loss or share electron pair offset.

Complex: the conjugate formed by two or more molecular specificity.

Primer dimer: during polymerase chain reaction (PCR), because between primer pair or single primer is mutually annealed The dimer molecule of formation, the dimer being made of two different primers are heterodimer, because intending enzyme with tetra- serobila nucleic acid of G- Chain and may cause and plant the combination of antibody and cause false positive.

Hepes:4- hydroxyethyl piperazineethanesulfonic acid or N- (2- ethoxy) piperazine-N'-2- ethane sulfonic acid (hepes) are a kind of Hydrogen ion buffer can control constant pH range the long period.

Enzymatic activity: the ability of enzymatic chemical reaction is enzymatic activity or enzyme activity (active unit).International enzyme in 1961 Association's view regulation: 1 enzyme activity unit refers under specified conditions (25 DEG C, other is optimum condition), and 1 can be converted in 1min The enzyme amount of the related group of 1 μm of ol in the enzyme amount or conversion of substrate of μm ol substrate.

Nucleic acid polymerase: the enzyme of nucleic acid long-chain.It is divided into archaeal dna polymerase and RNA polymerase two major classes.

Compared with routine biochemistry culture identification method, polymerase chain reaction (PCR) mentions in terms of the molecular diagnosis of nucleic acid Revolutionary progress is supplied, because the process can be used for exponentially expanding the DNA target mark of trace, usually using gel electrophoresis Or the PCR product of the real-time method detection amplification using fluorescent dye；But these technologies are very time-consuming, and usually require Using costly and complicated instrument, due to these limitations, the alternative that exploitation can be used for quick and simple identification PCR product is It is current very important.For this target effort produced it is new based on molecular beacon and nanoparticle label probe Type DNA sensing platform；However, these technologies are needed using the Thiolation program of fluorescence conjugated or probe, both expensive and consumption When；Therefore, it is still highly desirable to for the straightforward procedure of identification of dna PCR product, this method can be without using instrument In the case of quickly identified；Therefore, it is a kind of ideal vibrio parahaemolytious detection hand that the embodiment of the present invention, which provides detection method, Section.

The embodiment of the present invention mainly propose one kind can sensitiveer, rapid and convenient, visually for vibrio parahaemolytious Early detection nucleic acid intend enzyme colorimetric reagent box preparation method and its application method.

The nucleic acid proposed in the embodiment of the present invention intends the peroxidase sample compound that enzyme is nucleic acid, and it typically is single-stranded The form of DNA/RNA, in the presence of ferroheme combines, rich G sequence can be folded into stable and catalytic activity tetra- serobila of G-.

Specifically, in H₂O₂The nucleic acid generated under existence condition intends enzymatic TMB (3,3', 5,5'- tetramethyl benzidine) Oxidation cause 450nm absorption maximum and it is macroscopic blue variation.

Nucleic acid is intended enzyme in conjunction with conventional PCR amplification and answered by the detection method of vibrio parahaemolytious provided in an embodiment of the present invention With the use of virulence gene toxR, trh, tlh and tdh sequence design for vibrio parahaemolytious including complementary tetra- serobila core of G- The primer of the quasi- enzyme sequence of acid, the double-stranded products of generation include that the tetra- serobila nucleic acid of G- of amplification intends enzyme sequence, in tetra- serobila nucleic acid of G- With formation tetra- serobilas of G-/ferroheme compound in the presence of hemin, there is the tetra- serobila nucleic acid structure of G- of amplification The activity of peroxidase generates blue by the TMB aoxidized, and then realizes to the sensitive special, quick of vibrio parahaemolytious Convenient, visual detection.

A kind of nucleic acid provided in an embodiment of the present invention intend enzymic colorimetric vibrio parahaemolyticus method mainly include；

1) test sample containing vibrio parahaemolytious target gene and the control without vibrio parahaemolytious target gene are provided Group sample provides four pairs of specific primer sequences (i.e. aforementioned for vibrio parahaemolytious virulence gene toxR, trh, tlh and tdh One primer pair, the second primer pair, third primer pair and the 4th primer pair), wherein upstream primer (draw by aforementioned the first primer, third Object, the 5th primer and the 7th primer be upstream primer) 5 ' end have nucleic acid intend enzyme reverse sequence；Expanded using aforementioned primer Purpose nucleic acid segment (i.e. pcr amplification product) is amplified under the conditions of increasing；If without be detected it is nucleic acid-templated in the presence of, without specific core Acid fragment amplified production；

2) it the preparation of hemin (Hemin) solution: weighs 0.04g Hemin powder and is added in the DMSO of 1ml, match It is set to the storing liquid of 67.5mM, minus 20 degree is placed in and is kept in dark place, when use uses ddH₂O is diluted to 67.5 μm of working concentration It is spare；

3) it the preparation of Klorvess Liquid: weighs 3.73g potassium chloride and is added to ddH₂It is settled to 100ml in 0, is configured to The concentration of 500mM, 0.22 μm of membrane filtration are spare；

4) HEPES buffer solution is by 25m M Hepes, 20m M KCl, 200m M NaCl, 0.025% (w/v) Triton The reagent of X-100,1% (v/v) DMSO form, and it is spare to 7.4 to adjust pH value；

5) preparation of developing solution includes colour developing A liquid and colour developing two parts of B liquid；Wherein develop the color A liquid: by the acetic acid of 13.6g Sodium, the citric acid of 1.6g, 30% hydrogen peroxide 0.3ml mixing, and use ddH₂O is settled to 500ml, by the solution prepared in 121 DEG C of high pressure sterilization 30min are placed in dark colored plastic bottle and are saved in 4 DEG C using 0.22 μm of membrane filtration；Develop the color B liquid group: will The EDETATE DISODIUM of 0.2g, the citric acid of 0.95g, the glycerol of 50ml, 0.15g TMB are dissolved in 3ml DMSO, add ddH₂O constant volume To 500ml (all operations will be carried out in the dark), the colour developing B liquid after preparing is placed in dark glass bottle and saves in 4 DEG C；

6) preparation of terminate liquid: taking the 10.9ml concentrated sulfuric acid, is diluted with water to 100ml, and the concentrated sulfuric acid that configuration forms 2M terminates Liquid；

7) take 10 μ l that the chlorination blood that step 2), step 3) and step 4) are prepared is added the PCR product obtained in step 1) Red pigment (Hemin) solution, Klorvess Liquid mix in HEPES buffer solution and form the first mixed system, by the first mixed system In 98 DEG C or so heating unwindings, fast cooling to 37 DEG C or so incubation 15min later；

8) it will develop the color after A liquid respectively takes 90 μ l to mix with the B liquid that develops the color and be added to the first mixed system after being incubated in step 7) It is middle to be mixed to form the second mixed system, and developing the color after five minutes, use camera to shoot the colour developing of the second mixed system； Absorption value is measured at 450 nm using microplate reader；By the color of acquisition and absorption value and blank control group (for deionization water sample Product) comparison, if apparent blue variation occur is judged as positive, alternatively, comparing blank in the absorption value that 450nm is measured in microplate reader Group height is judged as the vibrio parahaemolytious positive；

9) in the absence of specific amplification products, it is quasi- that tetra- serobila nucleic acid of G- cannot be formed during step 7) is incubated for Multienzyme complex, and then be unable to catalyzed coloration liquid and generate blue variation, macroscopic blue variation cannot be also generated, and then not It can be distinguished with blank group, alternatively, being judged as secondary molten if the absorption value measured at 450 nm and blank control group do not have difference Blood vibrios is negative.

10) reaction can be terminated by the terminate liquid that step 6) is prepared being added.

Wherein, four pairs of primer sequences provided by the present invention are respectively as follows:

ToxR-F (corresponding the first primer):

5’-AAAAAATTTACCCAACCCGCCCTACCCAAAAAATTTACCCAACCCGCCCTACCCAAAAAAGTCTT CTGACGCAATCGTTG-3'；

ToxR-R (corresponding second primer): 5 '-ATACGAGTGGTTGCTGTCATG-3 '；

Trh-F (corresponding third primer):

5’-AAAAAATTTACCCAACCCGCCCTACCCAAAAAATTTACCCAACCCGCCCTACCCAAAAAATTGGC TTCGATATTTTCAGTATCT-3'；

Trh-R (corresponding 4th primer) 5 '-CATAACAAACATATGCCCATTTCCG-3 '；

Tlh-F (corresponding 5th primer):

5’-AAAAAATTTACCCAACCCGCCCTACCCAAAAAATTTACCCAACCCGCCCTACCCAAAAAAAAAGC GGATTATGCAGAAGCACTG-3'；

Tlh-R (corresponding 6th primer): 5 '-GCTACTTTCTAGCATTTTCTCTGC-3 '；

Tdh-F (corresponding 7th primer):

5’-AAAAAATTTACCCAACCCGCCCTACCCAAAAAATTTACCCAACCCGCCCTACCCAAAAAAGTAAA GGTCTCTGACTTTTGGAC-3'；

Tdh-R (corresponding 8th primer): 5 '-TGGAATAGAACCTTCATCTTCACC-3 '.

The nucleic acid that the embodiment of the present invention uses intends enzyme complementary strand and does not originate the quasi- enzyme chain of introducing nucleic acid in PCR amplification, reduces The background that develops the color is low, is easy to observe, and the quasi- enzyme chain of tetra- serobila nucleic acid of G- that the quasi- enzyme complementary strand of the nucleic acid amplifies is with higher Enzymatic activity, color developing effect are good；And be conducive to be formed after nucleic acid is unlocked the embodiment of the invention provides HEPES buffer solution Single-stranded stabilization is conducive to the stabilization that tetra- serobila nucleic acid of G- intends the enzymatic activity of enzyme；Also, it is provided in an embodiment of the present invention to be used for G- Four serobila nucleic acid intend the colour developing A liquid and B liquid composition of enzymatic, and stability is good, high sensitivity, low in cost.

Detection method provided by the invention can realize that direct Visual retrieval, Visual retrieval have without complicated behaviour Make, without large-scale instrument and equipment, high sensitivity, it is convenient, efficient, inexpensive the features such as, can not only solve at present in vast base It is food-borne that the place that food-borne pathogens detection is badly in need of in layer, rural area, the market of farm produce and under-developed area etc. is difficult to large area development The problem of pathogenic bacteria detect, moreover it is possible to develop, using the software of the direct interpretation of mobile phone, allow the detection of vibrio parahaemolytious it is simpler, Intuitively.

The present invention intends the color change that substrate for enzymatic activity redox reaction generates by tetra- serobila nucleic acid of G-, can be with meat Eye directly judges whether contain vibrio parahaemolytious in food to be measured simultaneously；In order to improve the sensitivity of detection food-borne pathogens, Intend enzyme using tetra- serobila nucleic acid of G- to amplify dual strategy by introducing the amplification of enzyme cycle signal and PCR product and realize final signal Amplification, to realize the Visual retrieval to vibrio parahaemolytious.Compared to previous all kinds of methods, the method has quickly, visually Change, hypersensitive the advantages that, there is weight for the realization for improving the detection sensitivity of food-borne pathogens, reducing cost and convenience Want meaning, for the more insufficient laboratory of experimental situation carry out it is universal or carry out vibrio parahaemolytious it is quick detect have it is huge It helps.

As the general technology platform of nucleic acid amplification product detection, detection method provided by the invention and kit can It is widely used in farming and animal husbandry and food industry, food-borne pathogens clinical detection, customs inspection is examined, environmental monitoring, infectiousness disease The fields such as sick prevention and control.Such as staphylococcus aureus, salmonella, enterohemorrhagic escherichia coli, monocyte hyperplasia Listeria Bacterium, Shigella, etc. common food-borne pathogens, these be all nucleic acid of the invention intend enzyme colorimetric reagent box test object.

The nucleic acid that the present invention uses intends enzyme colorimetric detection method and enormously simplifies the detection program after nucleic acid amplification, greatly Testing cost is saved, as a result interpretation is simple and clear, intuitive (detection signal result such as attached drawing 1).

Vibrio parahaemolytious nucleic acid provided by the invention intends enzyme colorimetric Fast Detection Technique as a kind of novel nucleic acid amplification Detection technique afterwards has the advantage that

1) easy to operate: only to need the sample after nucleic acid amplification directly to press step addition and be incubated for, do not need profession Personnel's operation, not only laboratory is available, it can also be used to a line prevention and control mechanism and farm；

2) quickly: interpretation result in most fast 25 minutes of detection；

3) convenient: without electrophoresis without gel imaging system, direct visual perception can be passed through；

4) sensitive: dual signal amplification system improves detection sensitivity, and than 10 times of method based on classics culture；

5) specificity is high: using for vibrio parahaemolytious four virulence genes toxR, trh, tlh and tdh in detection process The primer of sequence design keeps result more accurate；

6) at low cost: testing cost is significantly less than gel electrophoresis and ELISA detection.

Embodiment 1

The specificity identification that test vibrio parahaemolytious pollutes in different food-borne pathogens.

1 materials and methods

1.1 material

The food-borne pathogens of different strain are separated by Agricultural University Of Nanjing animal medicine institute laboratory and identify and save.

1.2 design of primers

1.3 PCR amplification systems:

Reaction condition:

1.4 operating method

Different strain is recovered and is cultivated, using plate count clump count, extracts DNA of bacteria, with it is above-mentioned 1.3) in PCR it is anti- Answer system respectively to bacterium mixed liquor, vibrio parahaemolytious, salmonella, monokaryon Listeria, staphylococcus aureus, jejunum campylobacter Bacillus, Vibrio harveyi, vibrio mimicus and vibrio fluvialis carry out PCR amplification, use tetra- serobila core of gel electrophoresis and G- respectively later The quasi- enzymic colorimetric of acid verifies the specificity between its different strain.

50 μ LPCR products are added to comprising 4 μ LKCl (500mM), 8 μ LHEPES buffers, 3 μ L hemins The first mixed system is formed in the mixture of (67.5 μM), and the first mixed system of formation is incubated for 15 points at 37 DEG C or so Clock；Then, the freshly prepd TMB reagent of 90 μ L is rapidly joined and forms the second mixed system in above-mentioned first mixed system, and It incubates 10 minutes at room temperature；When the color of the second mixed system becomes blue, solution is shot using smart phone or camera Colour developing as a result, be added 50 μ L terminate liquids terminate reaction, measured at room temperature 450nm using microplate reader and NanoDrop N2000 Absorption value；Separately 5 μ L PCR products is taken to carry out electrophoresis, deposition condition in 1.5% agarose gel electrophoresis containing ethidium bromide are as follows: 1 × TAE buffer, voltage 110V, electrophoresis time 30min.

2 results

Colour developing result and gel electrophoresis result after nucleic acid amplification are shown in Fig. 2, it is seen that after the PCR amplification that the present invention establishes Detection method has preferable specificity to vibrio parahaemolytious, and apparent chromogenic reaction does not occur between different strain yet, has Good identification, naked eyes can be observed in the case where not by other laboratory apparatus, can be convenient grass-roots work person's It uses.

Embodiment 2

Test the sensitivity that vibrio parahaemolytious nucleic acid intends enzyme colorimetric detection method.

1 materials and methods

1.1 material

The vibrio parahaemolytious that this laboratory saves.

1.2 design of primers

1.3 PCR amplification systems:

Reaction condition:

1.4 operating method

By vibrio parahaemolytious recovery culture to logarithmic phase, plate count is used after taking bacterium solution gradient dilution, while being extracted thin Bacterium DNA is as pcr template.Gel electricity is used respectively after carrying out PCR amplification to vibrio parahaemolytious with above-mentioned (1.3) PCR reaction system Swimming and tetra- serobila nucleic acid of G- intend enzymic colorimetric and verify sensitivity.

50 μ LPCR products are added to comprising 4 μ LKCl (500mM), 8 μ LHEPES buffers, 3 μ L hemins The first mixed system is formed in the mixture of (67.5 μM), and the first mixed system is incubated for 15 minutes at 37 DEG C or so；Then, The freshly prepd TMB reagent of 90 μ L is rapidly joined in above-mentioned first mixed system and forms the second mixed system, and is warm at room temperature It educates 10 minutes；When the color of the second mixed system becomes blue, smart phone or the colour developing knot of camera shooting solution are used Fruit；50 μ L terminate liquids are added later and terminate reaction, measure absorption at room temperature 450nm using microplate reader and NanoDrop N2000 Value；Separately 5 μ L PCR products is taken to carry out electrophoresis, deposition condition in 1.5% agarose gel electrophoresis containing ethidium bromide are as follows: 1 × TAE buffer, voltage 110V, electrophoresis time 30min.

2, result

Colour developing after nucleic acid amplification as a result, gel electrophoresis result and absorbance as the result is shown in Fig. 3, Fig. 4, Fig. 5, it is seen that It is high that the nucleic acid for the detection vibrio parahaemolytious that the present invention establishes intends enzyme colorimetric detection method detection sensitivity, and best detection limit can be down to 1.3×10⁴Cfu/mL, and than 10 times of electrophoretic detection based on classics culture.

The invention discloses the preparation method and applications methods that vibrio parahaemolytious nucleic acid intends enzyme colorimetric reagent box, are also disclosed Intend enzyme complementation sequence with G- tetra- serobila nucleic acid for four pairs of vibrio parahaemolytious virulence gene toxR, trh, tlh and tdh design The tetra- serobila nucleic acid sequence of specific upstream and downstream primer and G- of column, and intend enzyme colorimetric reagent box detection PCR amplification with nucleic acid and produce The method and purposes of object.For detecting the nucleic acid sequence of vibrio parahaemolytious used in method of the invention, specificity is by four Amplimer is guaranteed.Intend enzyme using tetra- serobila nucleic acid of G- and amplifies dual plan by introducing the amplification of enzyme cycle signal and PCR product The amplification for slightly realizing final signal ensure that the sensitivity to vibrio parahaemolytious detection.

1, vibrio parahaemolytious detects

It using the DNA of vibrio parahaemolytious as template, is detected after PCR amplification, the results are shown in attached figure 2, Fig. 3, Fig. 4, Fig. 5；As a result Show that PCR detection is detected with 50ul amplified production, testing result is shown only using vibrio parahaemolytious as the inspection of template at this time It surveys result and is judged as positive, other strains and blank control are judged as negative.

2, specific detection

The DNA of vibrio parahaemolytious serotype and other strains takes 50ul amplified production to intend enzyme through nucleic acid after PCR amplification Colorimetric reagent box and gel electrophoresis detect simultaneously, and display vibrio parahaemolytious DNA profiling testing result is determined as the positive, other bacterial strains All it is determined as feminine gender, sees attached drawing 2.

3, sensitivity technique

By vibrio parahaemolytious recovery culture to logarithmic phase, plate count is used after taking bacterium solution gradient dilution, while being extracted thin Bacterium DNA is as pcr template.After PCR amplification, takes 50ul amplified production test strips and gel electrophoresis while detecting, as a result divide Not as shown in figure 3, figure 4 and figure 5, show that established detection vibrio parahaemolytious nucleic acid intends enzymic colorimetric and has higher sensitivity, 1.3×10⁴Cfu/mL, and than 10 times of electrophoretic detection based on classics culture.

Wherein, the toxR gene order (SEQ ID NO:9) involved in the present invention are as follows:

Trh gene order (SEQ ID NO:10) are as follows:

Tlh gene order (SEQ ID NO:11) are as follows:

Tdh gene order (SEQ ID NO:12) are as follows:

It should be appreciated that the technical concepts and features of above-described embodiment only to illustrate the invention, its object is to allow be familiar with this The personage of item technology cans understand the content of the present invention and implement it accordingly, and it is not intended to limit the scope of the present invention.It is all Equivalent change or modification made by Spirit Essence according to the present invention, should be covered by the protection scope of the present invention.

Sequence table

<110>Agricultural University Of Nanjing

<120>reagent, kit and its application of vibrio parahaemolyticus are used for

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 80

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 1

aaaaaattta cccaacccgc cctacccaaa aaatttaccc aacccgccct acccaaaaaa 60

gtcttctgac gcaatcgttg 80

<210> 2

<211> 21

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 2

atacgagtgg ttgctgtcat g 21

<210> 3

<211> 84

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 3

aaaaaattta cccaacccgc cctacccaaa aaatttaccc aacccgccct acccaaaaaa 60

ttggcttcga tattttcagt atct 84

<210> 4

<211> 25

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 4

cataacaaac atatgcccat ttccg 25

<210> 5

<211> 84

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 5

aaaaaattta cccaacccgc cctacccaaa aaatttaccc aacccgccct acccaaaaaa 60

aaagcggatt atgcagaagc actg 84

<210> 6

<211> 24

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 6

gctactttct agcattttct ctgc 24

<210> 7

<211> 83

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 7

aaaaaattta cccaacccgc cctacccaaa aaatttaccc aacccgccct acccaaaaaa 60

gtaaaggtct ctgacttttg gac 83

<210> 8

<211> 24

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 8

tggaatagaa ccttcatctt cacc 24

<210> 9

<211> 552

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 9

atgttaagaa actacttact aggaaaccaa gtcatttttg atacgctcaa gcgtgaggtg 60

ttaaccaccg ataaaattat cagcttaggt gggcgtgaag cagcgatctt gaaattgctg 120

tgtgaaaacg ccaatactgt tattgcaaaa gaagagatca acgacaaagt gtggggtaaa 180

gtttttgtta gtgaaacatc cctgactaaa gcgatttcaa atctaagaaa atcattgcaa 240

cttattgaag gggtgatgtg tgaaataaaa actattccta aagagggata tatgttgatc 300

ttggaaggag aaaatttagg tttaatggtg gcggaggatg agccaccatt ggaggttaaa 360

cgaattgaat caaaagattt agctttgcta aaagcacctg ttggtaataa tcgattttta 420

tcaacgttag cgaaatcaga taacaaaatg aatgaaggtc acatcaaacc tagttggatg 480

ttgcttgcgg tactctcgtc tgcgtttctc tcttcagtta ccagtacggc gatgattttg 540

ttgcttaaat aa 552

<210> 10

<211> 1415

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 10

gctgttagtg agcatacctt acatatgcaa cttctagagc aaggattatt ctttatctta 60

ttgactttga atgagtctgg agtggatgtg cacaatgttt ttcacttcaa ctatgaagaa 120

ccgaaaaaag agactatcgc aagattgata acccaggatc cacaaagaaa atggcatatt 180

gatgatatcg caaaactatt atttaccaca ccatccaccc ttcgccgaca tctgcgcaaa 240

gaggggatgg tgtttagtca attgttactg gatgtcagaa tggggttagc gctaaacttt 300

cttacattta ccaactatac cgtttctcag atcagttatc ggacaggctt cggtagctct 360

gcatactttt gcgacgcttt caaacgcaaa tattcaatga cgccgttgca atttcgagtg 420

caatctagag aaaataatga cttaaaaaca ctaaaaaact tagctatgac aaataagcat 480

tgacaatata ttcgactatt tctgctttga ttgcaattat ttgaacttaa tcttcgaatc 540

tcaaacaaaa gataacccat gatcataagt gataattcgg cttttgccca gtcgttattc 600

aagtgcttta acagtgctcg aaactcgacg attgaaacat tgtcatcaaa aactaacttc 660

atcgataact aatcattaaa aggataaata aatttataac atgtcattct ctacgttctg 720

ttgaacactt ataacttctg gtaagaataa actaaatatt ttccttaaaa agccactgta 780

cacttaacca tgatagcacc ttaggcagac ctcacatttt ttcaccattc acccaaatat 840

ttcacttcaa caatttatgt ttatttgttt tcctttatct cgagcaattt tgcttaaaat 900

catataaagg attaattatg aaactaagac tctactttgc attcagtttg ctattggttt 960

caatattttc aatatctaaa tcattcgcga ttgatctgcc atcaatacct tttccttctc 1020

ctggttccga tgaactatta tttgttgtta gaaatacaac aatcaaaact gaatccccag 1080

ttaaggcaat tgtggaggac tattggacaa accgaaacat aaaaagaaaa ccatacaaag 1140

atgtatacgg tcaatcggtt ttcacaacag caggttcaaa gtggttaagc gcctatatga 1200

cagtaaacat caatggtcat aactatacga tggcagctct ttctggttat aaagatggta 1260

tttctacggt cttcacaaaa tcagagaaaa caagcctaaa ccaagacttt tattcggtaa 1320

aatcttttgt tgatgatagc gaagaatcaa taccaagtat aaattattta gatgaaacac 1380

cagaatactt tgttactgtc gaggcatatg agagc 1415

<210> 11

<211> 1257

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 11

atgatgaaaa aaacaatcac actattaact gcattactcc cgcttgcttc tgcagttgcc 60

gaagagccaa ccttatcacc agaaatggtt tcagcgtctg aagtgatcag cacgcaagaa 120

agccaaacct atacctatgt tcgctgttgg tatcgcacca gctactcgaa agatgatccg 180

gcgaccgatt gggaatgggc aaaaaacgaa gatggtagct acttcaccat tgacggctac 240

tggtggagct ccgtttcatt taaaaacatg ttctacacca acacgtcgcc aaacgttatc 300

cgtcagcgtt gtgaagcaac attagatttg gcgaacgaga acgcagacat tacgttcttc 360

gccgctgaca atcgcttctc atacaaccac acgatctgga gcaacgacgc agcaatgcag 420

ccagatcaaa tcaacaaagt ggttgcactc ggtgacagct tgtctgatac aggcaacatc 480

tttaacgcat cacaatggcg cttccctaac ccgaacagct ggttcttagg tcacttctcc 540

aacggttttg tgtggacaga atacattgcc aaagcgaaga accttccgct ctacaactgg 600

gcagttggcg gcgcggctgg tgaggaccaa tacatcgcgc taacaggggt tggtgatcaa 660

gtttcttcgt acttaaccta cgcaaaactg gcgaagaact acaaaccagc aaacaccttg 720

tttacgcttg agtttggttt gaatgacttc atgaactaca accgtggcgt tccagaagtg 780

aaagcggatt atgcagaagc actgattcgt ttgacggacg caggtgcgaa gaacttcatg 840

ttgatgacac tgccagacgc gacgaaagcg cctcagttta agtactcaac acaagaagag 900

atcgacaaaa ttcgtgcgaa agtgcttgag atgaacgagt tcatcaaggc acaagcgatg 960

tactacaaag cgcaaggtta caacatcacg ttgtttgata ctcacgcctt gttcgagacg 1020

ctaacttctg cgcccgaaga gcacggtttc gtgaacgcga gtgatccttg tttggacatc 1080

aaccgctcat cgtctgtcga ttacatgtac acccacgcat tgcgctctga gtgtgcggcg 1140

tctggtgctg agaagtttgt gttctgggat gtcacgcacc caacaacagc aactcaccgc 1200

tatgttgcag agaaaatgct agaaagtagc aacaacttag ccgagtaccg tttctaa 1257

<210> 12

<211> 564

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 12

atgaagtacc gatattttgc aaaaaaatca tttttattta tatccatgtt ggctgcattc 60

aaaacatttg cctttgagct tccatctgtc ccttttcctg cccccggttc tgatgagata 120

ttgtttgttg ttcgagatac aacttttaat accaatgcac cggtcaatgt aaaggtctct 180

gacttttgga caaaccgtaa tgtaaaaaga aaaccgtaca aagatgttta tggtcaatca 240

gtattcacaa cgtcaggtac taaatggctg acatcctaca tgactgtgaa cattaatgat 300

aaagactata caatggcagc ggtgtctggc tataagcacg gtcattctgc tgtgttcgta 360

aaatcagatc aagtacagct tcaacattcc tataattctg tagctaactt tgttggtgaa 420

gatgaagatt ctattccaag taaaatgtat ttggatgaaa ctccagaata ttttgttaat 480

gtagaagcat atgaaagtgg taatggtaat atattggtaa tgtgtatatc caacaaagaa 540

tcgttttttg aatgtaaaca tcaa 564

Claims (10)

1. a kind of detection reagent, it is characterised in that including the first primer to, the second primer pair, third primer pair and the 4th primer It is right；

The first primer is to including the first primer and the second primer, and the sequence of the first primer and the second primer is respectively such as Shown in SEQ ID NO:1, SEQ ID NO:2；

Second primer pair includes third primer and the 4th primer, and the sequence of the third primer and the 4th primer is respectively such as Shown in SEQ ID NO:3, SEQ ID NO:4；

The third primer pair includes the 5th primer and the 6th primer, and the sequence of the 5th primer and the 6th primer is respectively such as Shown in SEQ ID NO:5, SEQ ID NO:6；

4th primer pair includes the 7th primer and the 8th primer, and the sequence of the 7th primer and the 8th primer is respectively such as Shown in SEQ ID NO:7, SEQ ID NO:8.

2. detection reagent according to claim 1, it is characterised in that: the first primer, third primer, the 5th primer, 5 ' ends of the 7th primer have tandem sequence repeats guanine (G) and can form the complementary series that nucleic acid intends enzyme.

3. detection reagent according to claim 1, it is characterised in that further include archaeal dna polymerase and PCR general components.

4. detection reagent according to claim 1, it is characterised in that further include hemin solution, Klorvess Liquid, HEPES buffer solution, colour developing A liquid, colour developing B liquid and terminate liquid.

5. detection reagent according to claim 4, it is characterised in that: the HEPES buffer solution includes 25m M Hepes, 20m M KCl, 200m M NaCl, 0.025% (w/v) Triton X-100,1% (v/v) DMSO, the HEPES are slow The pH for rushing solution is 7.4 or so；And/or the colour developing A liquid includes sodium acetate, citric acid and hydrogen peroxide, and/or, the colour developing B liquid includes EDETATE DISODIUM, citric acid, glycerol and TMB.

6. detection reagent according to claim 1, it is characterised in that further include: dimethyl Asia haze, L-cysteine hydrochloric acid Salt, citric acid, the concentrated sulfuric acid, sodium sulfite, glycerol, hydrogen peroxide, sodium acetate, EDETATE DISODIUM.

7. a kind of kit, it is characterised in that including detection reagent of any of claims 1-6.

8. a kind of product applied to vibrio parahaemolytious detection method, it is characterised in that: the product includes in claim 1-4 Kit described in any one of any one detection reagent or claim 5-7, also, the detection method includes:

Using the first primer to, the second primer pair, third primer pair, the 4th primer pair, by pcr amplification reaction to The nucleic acid extracted in sample is expanded；

Product after PCR amplification is mixed to form first with hemin solution, Klorvess Liquid, HEPES buffer solution to mix Zoarium system, heats constant-temperature incubation after unwinding；

The first mixed system and the colour developing A liquid after incubation and the B liquid that develops the color are mixed to form the second mixed system, and pass through sight Examine the second mixed system color or detect the second mixed system OD value realize in sample to be tested vibrio parahaemolytious it is qualitative Or quantitative detection.

9. product according to claim 8, it is characterised in that: the reaction condition of the pcr amplification reaction are as follows: 94 DEG C of pre- changes Property 3min；94 DEG C of denaturation 30sec, 58 DEG C of annealing 30sec, 72 DEG C of extension 1min expand 30 circulations, sufficiently extend 72 DEG C 5min。

10. product according to claim 8, which is characterized in that the detection method includes: by first mixed system Unwinding is heated under the conditions of 98 DEG C or so, later in 37 DEG C or so constant-temperature incubations.