CN110093402A - A kind of high-throughput quantification detection kit of food-borne pathogens - Google Patents
A kind of high-throughput quantification detection kit of food-borne pathogens Download PDFInfo
- Publication number
- CN110093402A CN110093402A CN201910090653.6A CN201910090653A CN110093402A CN 110093402 A CN110093402 A CN 110093402A CN 201910090653 A CN201910090653 A CN 201910090653A CN 110093402 A CN110093402 A CN 110093402A
- Authority
- CN
- China
- Prior art keywords
- food
- solution
- concentration
- borne pathogens
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of high-throughput quantification detection kits of food-borne pathogens, feature is the LAMP detection primer group for including 9 kinds of food-borne pathogens, feature is gene order as shown in SEQ ID NO.1~NO.36, further includes sample template, 10 × reaction buffer, MgSO4、dNTP、BstArchaeal dna polymerase and distilled water, advantage are that high specificity, high sensitivity, flux are high, highly reliable, at low cost and without false negative result.
Description
Technical field
The present invention relates to a kind of food-borne pathogens detection kits, more particularly, to a kind of high pass of food-borne pathogens
Measure immue quantitative detection reagent box.
Background technique
Food-borne pathogens are can to cause food poisoning or using food as the pathogenic bacteria of communication media.It is pathogenic thin
The direct or indirect contaminated food products of bacterium and water source, people's peroral infection can lead to generation and food poisoning and the livestock and poultry of enteric infectious disease
The prevalence of infectious disease.Food-borne pathogens are the important sources for leading to food-safety problem.It can cause food poisoning or with food
Product are that the pathogenic bacteria of communication media mainly have shigella dysenteriae, enteropathogenic E. Coli, salmonella, comma bacillus, golden yellow Portugal
Grape coccus, Listeria monocytogenes, vibrio parahaemolytious, Bacillus cereus, Shigella.Traditional Micro biological Tests method is training
Partition method is supported, cultivated, separated and biochemical identification by culture medium.RNA isolation kit: it is added in the sample well of detection device
A part of enrichment culture object, sample are flowed along detection device, easily distinguishable visible result occur.If only formed in check plot
One band, then sample is feminine gender；There is band simultaneously in check plot and detection zone, then can Preliminary Identification sample be the positive.It surveys
Test piece method: will be added the enzyme color developing agent of specificity, and load it on the middle scraps of paper in selective medium, by culture, if
Contain staphylococcus aureus in sample, the bacterium colony of aubergine can be presented on the scraps of paper.The proprietary enzyme process of microorganism: β-half is generated
Lactoside enzyme can be with the zymolyte in decomposed liq culture medium --- and 4-methyl umbelliferone-β-D- galactoside makes 4- methyl umbrella
Shape ketone is free, thus blue-fluorescence is presented under the ultraviolet lamp of 366nm.Test-paper method: test-paper is training well prepared in advance
Based system is supported, it contains standard medium, cold water soluble gel and indicator, counts convenient for bacterium colony.Bacterium total testing piece
37 DEG C of culture (48 ± 3) h after sample, it is red or pink that positive bacteria, which is fallen in testing piece, is had with testing piece background color larger anti-
Difference is easy to differentiate counting.But these methods can only Semi-qualitative or total number of bacteria.Therefore, a kind of food-borne pathogens are needed
High-throughput quantification detection kit realizes rapid quantitative detection.
Summary of the invention
Technical problem to be solved by the invention is to provide a kind of high specificity, high sensitivity, flux it is high, it is highly reliable,
The high-throughput quantification detection kit of food-borne pathogens at low cost, without false negative result.
The technical scheme of the invention to solve the technical problem is: a kind of high-throughput quantification of food-borne pathogens
Detection kit, the LAMP detection primer group including 9 kinds of food-borne pathogens, gene order are as shown in table 1 below:
Table 1
。
The LAMP reaction system of the detection kit and the final concentration of each ingredient are as follows: 1 μ L of sample template DNA,
2.5 μ 10 × reaction buffers of L, 1.5 μ L concentration are the MgSO of 100mM4, 3.5 μ L concentration are the dNTP of 10mM, 1 μ L concentration
For 8 U/ μ l Bst DNA polymerase, 1 μ L FIP/BIP primer sets solution, 1 μ L F3/B3 primer sets solution and 4 μ L glycine betaines,
Then 25 μ L are supplied with distilled water；Wherein the FIP/BIP primer sets solution be respectively Listeria monocytogenes shown in table 1,
Vibrio parahaemolytious, comma bacillus, staphylococcus aureus, bacillus cereus, proteus mirabilis, Salmonella, will are congratulated
The FIP/BIP primer sets solution of Bordetella and enteropathogenic E. Coli, each primer final concentration are 40 μM, and the F3/B3 draws
Object group solution is respectively Listeria monocytogenes shown in table 1, vibrio parahaemolytious, comma bacillus, staphylococcus aureus, waxy bud
Spore bacillus, proteus mirabilis, Salmonella, Shigella and enteropathogenic E. Coli F3/B3 primer sets solution, respectively
Primer final concentration is 5 μM.
The detection kit further includes color developing agent, and the color developing agent is calcein/manganese chloride solution or hydroxyl
Base naphthol blue solution or SYBR-Green I, wherein calcein concentration is 75 μM in calcein/manganese chloride solution, chlorination
Manganese concentration is 500 μM；The hydroxynaphthol blue solution concentration be 150 μM, the calcein/manganese chloride solution or
The additive amount of the hydroxynaphthol blue solution is 1 hole μ L/, and the additive amount of the SYBR-Green I color developing agent is 5 μ L/
Hole.
Compared with the prior art, the advantages of the present invention are as follows: a kind of high-throughput quantification inspection of food-borne pathogens of the present invention
The primer specific of test agent box design is strong, can carry out rapid amplifying, by fluorescent dye according to double-stranded DNA number determine disease
The amount of original template, to reach quantitative detection, the time just completes entire detection in 2-3h, have high specificity, high sensitivity,
The advantages of flux is high, highly reliable, at low cost, without false negative result.
Detailed description of the invention
Fig. 1 is 9 kinds of food-borne pathogens LAMP specific detections as a result, wherein left side is electrophoretogram, and right side is visualization
Detection figure, A: Listeria monocytogenes testing result；B: vibrio parahaemolytious testing result；C: comma bacillus testing result；D: golden yellow
Color staphylococcus testing result；E: bacillus cereus testing result；F: proteus mirabilis testing result；G: Salmonella
Testing result；H: Shigella testing result；I: enteropathogenic E. Coli testing result；0:DNA Marker；1: single to increase Lee
This special bacterium；2: vibrio parahaemolytious；3: comma bacillus；4: staphylococcus aureus；5: bacillus cereus；6: unusual deformed rod
Bacterium；7: Salmonella；8: Shigella；9: enteropathogenic E. Coli；10: negative control；
Fig. 2 is 9 kinds of food-borne pathogens LAMP sensitivity technique result figures；Wherein left side is electrophoretogram, and right side is visualization inspection
Mapping, A: Listeria monocytogenes testing result；B: vibrio parahaemolytious testing result；C: comma bacillus testing result；D: golden yellow
Staphylococcus testing result；E: bacillus cereus testing result；F: proteus mirabilis testing result；G: Salmonella inspection
Survey result；H: Shigella testing result；I: enteropathogenic E. Coli testing result；0:DNA Marker；1: negative control；
8-2: being respectively 10 times of diluted plasmid templates of concentration gradient；
Fig. 3 is sample detection instance graph, and wherein A is microflow controlled biochip testing result of the hydroxynaphthol blue as indicator, B
Microflow controlled biochip testing result for hydroxynaphthol blue as indicator；1: Listeria monocytogenes；2: vibrio parahaemolytious；3:
Comma bacillus；4: staphylococcus aureus；5: bacillus cereus；6: proteus mirabilis；7: Salmonella；8: shiga
Pseudomonas；9: enteropathogenic E. Coli；10: negative control.
Specific embodiment
The present invention will be described in further detail below with reference to the embodiments of the drawings.
Specific embodiment one
A kind of high-throughput quantification detection kit of food-borne pathogens, the LAMP detection primer including 9 kinds of food-borne pathogens
Group, gene order are as shown in table 1 below:
Table 1
。
Said gene target position point design: gene design primer special between seed selection, conservative in kind is because of external primers F3
Equally have an opportunity in conjunction with the F3c in template and extend, displaces the complementary single strand of complete FIP connection.At this point, on FIP
F1c can be achieved with it is complementary with this single-stranded upper Fl, pass through self base pairing formed cyclic structure.Likewise, downstream primer BIP
There is the synthesis similar to primers F IP and F3 with B3, this just provides possibility to form the single-stranded structure of dumbbell shaped.At this point, 3 '
The Fl section at end will carry out DNA synthesis using itself as template, be formed under the archaeal dna polymerase effect with strand displacement capability
Stem loop structure.
It is target according to the above-mentioned specific gene segment for selecting 9 kinds of food-borne pathogens, application
The synthesis of PRIMEREXPLORER V5 software Design primers, primer is completed by Shanghai Sheng Gong bioengineering Co., Ltd.By primer
It is compared with target, carries out a large amount of screening tests and analysis, obtain special, sensitive, stable above-mentioned F3, B3, FIP, BIP
LAMP detection primer group；Will design synthesis 4 primers carry out the reaction time and temperature optimization experiment after, determine amplification efficiency and
The best reaction condition of specificity.
Specific embodiment two
The final concentration of a kind of high-throughput quantification detection kit of food-borne pathogens, LAMP reaction system and each ingredient is such as
Under: 1 μ L of sample template DNA, 2.5 μ 10 × reaction buffers of L, 1.5 μ L concentration are the MgSO of 100mM4, 3.5 μ L concentration
For the dNTP of 10mM, 1 μ L concentration is 8 U/ μ l Bst DNA polymerase, 1 μ L FIP/BIP primer sets solution, 1 μ L F3/B3
Primer sets solution and 4 μ L glycine betaines, then supply 25 μ L with distilled water；Wherein FIP/BIP primer sets solution is respectively 1 institute of table
The Listeria monocytogenes that show, vibrio parahaemolytious, comma bacillus, staphylococcus aureus, bacillus cereus, unusual deformed rod
Bacterium, Salmonella, Shigella and enteropathogenic E. Coli 9 kinds of food-borne pathogens FIP/BIP primer sets solution,
Each primer final concentration is 40 μM, F3/B3 primer sets solution be respectively Listeria monocytogenes shown in table 1, vibrio parahaemolytious,
Comma bacillus, staphylococcus aureus, bacillus cereus, proteus mirabilis, Salmonella, Shigella and cause a disease
The F3/B3 primer sets solution of 9 kinds of food-borne pathogens of property Escherichia coli, each primer final concentration is 5 μM.
Above-mentioned detection kit further includes color developing agent, and color developing agent is calcein/manganese chloride solution or hydroxynaphthol blue
Solution or SYBR-Green I, wherein calcein concentration is 75 μM in calcein/manganese chloride solution, and manganese chloride concentration is
500μM；The hydroxynaphthol blue solution concentration is 150 μM, calcein/manganese chloride solution or hydroxynaphthol blue solution
Additive amount is 1 hole μ L/, and the additive amount of SYBR-Green I color developing agent is 5 holes μ L/.Being additionally provided with negative control is water, positive right
According to the DNA for double-strand.
Specific embodiment three
A method of it is detected using the high-throughput quantification that above-mentioned two detection kit of specific embodiment carries out food-borne pathogens,
The following steps are included:
Measuring samples are taken, sample template DNA is extracted according to commercially available DNA of bacteria extracts kit, takes 1 μ L of sample template DNA, press
It is formed according to LAMP reaction system and 2.5 μ 10 × reaction buffers of L, 1.5 μ L MgSO is added4, 3.5 μ L dNTP, 1 μ L Bst DNA
Polymerase, 1 μ L FIP/BIP primer sets solution, 1 μ L F3/B3 primer sets solution and 4 μ L glycine betaines, are then supplied with distilled water
It is mixed after 25 μ L, 20 μ L of mixed liquor is taken to add to each well (wherein respectively single increasing of primer sets solution of sample detection chip
Listeria, vibrio parahaemolytious, comma bacillus, staphylococcus aureus, bacillus cereus, proteus mirabilis, Salmonella
The primer sets solution of 9 kinds of food-borne pathogens of Pseudomonas, Shigella and enteropathogenic E. Coli, each food-borne pathogenic
The primer sets solution of bacterium is accordingly added in a well, in addition adding the well of negative control, participates in the well one of reaction
Altogether it is 9), then 1 μ L color developing agent is added in each hole, power switch device is opened, is completed to screen self-test, reaction chamber is opened
Lid, chip is put into instrument reaction chamber, reaction chamber cap is covered, START button is clicked on screen, and instrument carries out automatically, is waited
Reaction terminates, and detection menu interface, selection detection are entered after instrument prompt, and instrument can read the number of colours of chip reaction chamber automatically
According to (positive is blue when using hydroxynaphthol blue as color developing agent, and feminine gender is pansy；It the use of calcein is color developing agent
When, green is the positive, and yellow is feminine gender) and concentration conversion is carried out according to rgb value, finally provide contained bacterium in each hole sample
The copy number of nucleic acid.
If when using SYBR-Green I developing solution, 20 μ L of mixed liquor is taken to add to each sample-adding of sample detection chip
Hole.Power switch device is opened, is completed to screen self-test, reaction chamber cap is opened, chip is put into instrument reaction chamber, is covered anti-
Chamber cap is answered, START button is clicked on screen, instrument carries out automatically, and reaction is waited to terminate, and takes out chip, and each well adds 5
The working solution of the SYBR-Green I of μ L.Menu interface, selection detection are detected into instrument, instrument can read chip reaction automatically
The color data (green is the positive, orange for feminine gender) of room simultaneously carries out concentration conversion according to rgb value, finally provides in each sample
The copy number of contained bacterial nucleic acid.
Fig. 1 is the electrophorogram after the LAMP reaction that left side is 9 kinds of food-borne pathogens, and right side is to be made using the above method
It is green for the positive with the LAMP reaction result of 9 kinds of food-borne pathogens after SYBR-Green I dyestuff, it is orange for yin
Property.As shown in Figure 1, there was only corresponding food-borne pathogens LAMP detection primer in sample detection chip is the positive, blank control
And remaining non-purpose bacterium testing result is feminine gender.
Specific embodiment four
Sensitivity test: by 10 times of gradient dilutions of plasmid respectively containing 9 kinds of food-borne pathogens specific fragments, each dilution is taken
LAMP amplified reaction is carried out, the detection of 9 kinds of pathogenic microorganism LAMP methods is limited to 10-70 copies/μ L.As shown in Fig. 2,
8 be original concentration in figure, and 8-2 is respectively 10 times of diluted templates, after carrying out LAMP reaction, uses electrophoresis respectively and uses SYBR-
Green I dyeing observes result.Initial concentration A: 3.75 × 107Copies/μ L, B:2.44 × 107 copies /μ
L, C:5.98 × 107Copies/μ L, D:3.07 × 107Copies/μ L, E:1.55 × 107Copies/μ L, F:3.41
×107Copies/μ L, G:3.98 × 107Copies/μ L, H:4.01 × 107Copies/μ L, I:6.22 × 107
copies /μL。
Specific embodiment five
Sample pre-treatments are carried out according to related national standard method by doubtful foodstuff samples 2 to be measured, prepare DNA profiling, sample warp
After LAMP reacts (centrifugal type microfludic biochip) detection, A sample is shown that B passes through SYBR- using hydroxynaphthol blue
Green I dyeing.As shown in figure 3, contain Listeria monocytogenes and comma bacillus in sample A as the result is shown, in B sample,
Contain comma bacillus and proteus mirabilis.It is verified through physiological and biochemical test, the pathogenic bacteria containing detection in two above sample.
Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common
Within the essential scope of the present invention, the variations, modifications, additions or substitutions made also should belong to protection of the invention to technical staff
Range.
Sequence table
<110>University Of Ningbo
<120>the high-throughput quantification detection kit of a kind of food-borne pathogens
<130>
<160> 36
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>Listeria monocytogenes secG-F3
<400> 1
CGGTCTTACTCATCATCGTA 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>Listeria monocytogenes secG-B3
<400> 2
CAAAGTATGCCAGTGCAATT 20
<210> 3
<211> 45
<212> DNA
<213>artificial sequence
<220>
<223>Listeria monocytogenes secG-FIP
<400> 3
CTCAGCTCCACCAGAGATGGATTACAGTTATCATACTTCAACCAG 45
<210> 4
<211> 47
<212> DNA
<213>artificial sequence
<220>
<223>Listeria monocytogenes secG-BIP
<400> 4
TATTCGGTAAGCAAAAAGCAAGAGGAAGAAAACAACGGATAGAACGA 47
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>vibrio parahaemolytious norM-F3
<400> 5
GTGATGTGTCTTTGGGTATG 20
<210> 6
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>vibrio parahaemolytious norM-B3
<400> 6
AGAAAACGCTCTTGGACTT 19
<210> 7
<211> 44
<212> DNA
<213>artificial sequence
<220>
<223>vibrio parahaemolytious norM-FIP
<400> 7
CGCTACATGACAAGTAACGCCTAAGACATAAAACTGAATACGCT 44
<210> 8
<211> 42
<212> DNA
<213>artificial sequence
<220>
<223>vibrio parahaemolytious norM-BIP
<400> 8
GACAGTTCAATTTCTTGCCGTCAACTTCACCTGATTTGCTCT 42
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>comma bacillus murP-F3
<400> 9
CGCAGCAGAAAAAGCAGATG 20
<210> 10
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>comma bacillus murP-B3
<400> 10
GCCCTTTGCCAAACACTTTG 20
<210> 11
<211> 41
<212> DNA
<213>artificial sequence
<220>
<223>comma bacillus murP-FIP
<400> 11
GCGGGGTAAAAATGGTGGCAAAAGAGCAAGCAAACCAGTGC 41
<210> 12
<211> 39
<212> DNA
<213>artificial sequence
<220>
<223>comma bacillus murP-BIP
<400> 12
CAGGCTTGCTGCTGGGCATTCATAAACTCGCTCGGGGTT 39
<210> 13
<211> 23
<212> DNA
<213>artificial sequence
<220>
<223>staphylococcus aureus tnpG-F3
<400> 13
CGTCTCATTAAACAATTTGGTAA 23
<210> 14
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>staphylococcus aureus tnpG-B3
<400> 14
CATTCAATGCCTTTGAGTGTA 21
<210> 15
<211> 49
<212> DNA
<213>artificial sequence
<220>
<223>staphylococcus aureus tnpG-FIP
<400> 15
CAGTCCGGTTTAAGTTTAAAAGCTTCTCAAAAGGTAATTACAGATCAGG 49
<210> 16
<211> 49
<212> DNA
<213>artificial sequence
<220>
<223>staphylococcus aureus tnpG-BIP
<400> 16
TGAATAACCTCATTGAGCAAGATCAGTATTGATACTTTGATATCTTGTC 49
<210> 17
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>bacillus cereus glgA-F3
<400> 17
TCGCGGAATACAGTACGT 18
<210> 18
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>bacillus cereus glgA-B3
<400> 18
CGAGAAGACAATATTCTGTGTG 22
<210> 19
<211> 48
<212> DNA
<213>artificial sequence
<220>
<223>bacillus cereus glgA-FIP
<400> 19
GCGCGTTTATTTTCACTCTTTTCATGAAACGGATTCGTATATTAAGGC 48
<210> 20
<211> 44
<212> DNA
<213>artificial sequence
<220>
<223>bacillus cereus glgA-BIP
<400> 20
TTGGTTTGCCAGAAAAAGAGGAACTAAATCAAGACCTTTTTGCT 44
<210> 21
<211> 23
<212> DNA
<213>artificial sequence
<220>
<223>proteus mirabilis qnrD-F3
<400> 21
AAGACAAATCTTAGTTACGCTAA 23
<210> 22
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>proteus mirabilis qnrD-B3
<400> 22
CCCGTTAAATCACAACCAGTA 21
<210> 23
<211> 47
<212> DNA
<213>artificial sequence
<220>
<223>proteus mirabilis qnrD-FIP
<400> 23
CCAGTTATCACAGTGCCATTCCACTAGAGTCATATTAGAAAAGTGCG 47
<210> 24
<211> 39
<212> DNA
<213>artificial sequence
<220>
<223>proteus mirabilis qnrD-BIP
<400> 24
CGTGTTTCGTGGCTCCGATCAGCCAAAGACCAATCAAAC 39
<210> 25
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>Salmonella lcmP-F3
<400> 25
AGCTCAGCGCTTACTGAA 18
<210> 26
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>Salmonella lcmP-B3
<400> 26
TCCGTTCTGTACGTCTGG 18
<210> 27
<211> 45
<212> DNA
<213>artificial sequence
<220>
<223>Salmonella lcmP-FIP
<400> 27
TTGGTAATTTCCCCCCTTCTAAAGCAGTATCCATCTACCTTCCTG 45
<210> 28
<211> 48
<212> DNA
<213>artificial sequence
<220>
<223>Salmonella lcmP-BIP
<400> 28
TGGTTGAAAGGGATTGACAGAGGGAATAATACTTTCAATGCAAGTTCC 48
<210> 29
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>Shigella actX-F3
<400> 29
TTATCCCGGAGCGGTATC 18
<210> 30
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>Shigella actX-B3
<400> 30
CCAAAACTGACCAGTCCAT 19
<210> 31
<211> 43
<212> DNA
<213>artificial sequence
<220>
<223>Shigella actX-FIP
<400> 31
TCCCCTGTATGCACTACAGTCTTACTACAATCCAGTTATACGC 43
<210> 32
<211> 39
<212> DNA
<213>artificial sequence
<220>
<223>Shigella actX-BIP
<400> 32
ATCATGCCAATGTTTCCCGGTTTTCATCCGGGTAAAGCA 39
<210> 33
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>enteropathogenic E. Coli espP-F3
<400> 33
GATGGCTGATATTAACCAACAA 22
<210> 34
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>enteropathogenic E. Coli espP-B3
<400> 34
TTACTGTATGCTGCGTGG 18
<210> 35
<211> 47
<212> DNA
<213>artificial sequence
<220>
<223>enteropathogenic E. Coli espP-FIP
<400> 35
CATAGACGAACAGTGCTGAACCGTTTGATGAGTTTAATAACATTGCC 47
<210> 36
<211> 43
<212> DNA
<213>artificial sequence
<220>
<223>enteropathogenic E. Coli espP-BIP
<400> 36
ACCAAAAGAAAAAGTGGGTTGTCGTTTTTGCCATTGGCGTAAT 43
Claims (3)
1. a kind of high-throughput quantification detection kit of food-borne pathogens, it is characterised in that: including 9 kinds of food-borne pathogens
LAMP detection primer group, gene order are as shown in the table:
。
2. a kind of high-throughput quantification detection kit of food-borne pathogens according to claim 1, it is characterised in that: institute
The LAMP reaction system for the detection kit stated and the final concentration of each ingredient are as follows: sample template DNA 1 μ L, and 2.5 μ L 10 ×
Reaction buffer, 1.5 μ L concentration are the MgSO of 100mM4, 3.5 μ L concentration are the dNTP of 10mM, and 1 μ L concentration is 8 U/ μ lBst DNA polymerase, 1 μ L FIP/BIP primer sets solution, 1 μ L F3/B3 primer sets solution and 4 μ L glycine betaines, then with double
It steams water and supplies 25 μ L；Wherein the FIP/BIP primer sets solution is respectively Listeria monocytogenes described in claim 1, pair
Hemolysis vibrion, comma bacillus, staphylococcus aureus, bacillus cereus, proteus mirabilis, Salmonella, shiga
The FIP/BIP primer sets solution of Pseudomonas and enteropathogenic E. Coli, each primer final concentration are 40 μM, the F3/B3 primer
Group solution is respectively Listeria monocytogenes described in claim 1, vibrio parahaemolytious, comma bacillus, staphylococcus aureus, wax
Sample bacillus, proteus mirabilis, Salmonella, the F3/B3 primer sets of Shigella and enteropathogenic E. Coli are molten
Liquid, each primer final concentration are 5 μM.
3. a kind of high-throughput quantification detection kit of food-borne pathogens according to claim 2, it is characterised in that: institute
The detection kit stated further includes color developing agent, and the color developing agent is that calcein/manganese chloride solution or hydroxynaphthol blue are molten
Liquid or SYBR-Green I, wherein calcein concentration is 75 μM in calcein/manganese chloride solution, and manganese chloride concentration is
500μM；The hydroxynaphthol blue solution concentration is 150 μM, the calcein/manganese chloride solution or the hydroxyl
The additive amount of naphthol blue solution is 1 hole μ L/, and the additive amount of the SYBR-Green I color developing agent is 5 holes μ L/.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910090653.6A CN110093402A (en) | 2019-01-30 | 2019-01-30 | A kind of high-throughput quantification detection kit of food-borne pathogens |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910090653.6A CN110093402A (en) | 2019-01-30 | 2019-01-30 | A kind of high-throughput quantification detection kit of food-borne pathogens |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110093402A true CN110093402A (en) | 2019-08-06 |
Family
ID=67443823
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910090653.6A Pending CN110093402A (en) | 2019-01-30 | 2019-01-30 | A kind of high-throughput quantification detection kit of food-borne pathogens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110093402A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110747283A (en) * | 2019-09-24 | 2020-02-04 | 天津科技大学 | Specific primer, detection method and application of quinolone antibiotic resistance gene qnrD |
| CN114214440A (en) * | 2021-12-14 | 2022-03-22 | 广州双螺旋基因技术有限公司 | LAMP detection kit for detecting proteus mirabilis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040219530A1 (en) * | 2003-04-30 | 2004-11-04 | Roland Brousseau | Array and uses thereof |
| CN107022644A (en) * | 2017-06-14 | 2017-08-08 | 山东省农业科学院农业质量标准与检测技术研究所 | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables |
| CN108220464A (en) * | 2018-04-08 | 2018-06-29 | 陈思 | A kind of 16 kinds of food-borne pathogens detection kits |
-
2019
- 2019-01-30 CN CN201910090653.6A patent/CN110093402A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040219530A1 (en) * | 2003-04-30 | 2004-11-04 | Roland Brousseau | Array and uses thereof |
| CN107022644A (en) * | 2017-06-14 | 2017-08-08 | 山东省农业科学院农业质量标准与检测技术研究所 | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables |
| CN108220464A (en) * | 2018-04-08 | 2018-06-29 | 陈思 | A kind of 16 kinds of food-borne pathogens detection kits |
Non-Patent Citations (3)
| Title |
|---|
| L. NIESSEN等: "The application of loop-mediated isothermal amplification (LAMP) in food testing for bacterial pathogens and fungal contaminants", 《FOOD MICROBIOLOGY》 * |
| 孙边成等: "10种食源性疾病病原体高通量LAMP分子鉴别检测体系的建立及应用", 《实用预防医学》 * |
| 彭乃才等: "环介导等温扩增技术检测食源性致病菌的研究进展", 《肉类工业》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110747283A (en) * | 2019-09-24 | 2020-02-04 | 天津科技大学 | Specific primer, detection method and application of quinolone antibiotic resistance gene qnrD |
| CN114214440A (en) * | 2021-12-14 | 2022-03-22 | 广州双螺旋基因技术有限公司 | LAMP detection kit for detecting proteus mirabilis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pepper et al. | Cultural methods | |
| CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN102102124A (en) | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and detection kit for typhoid/paratyphoid saimonella | |
| CN110218806A (en) | The quick detection primer group of detection of Salmonella fimW gene novel visual LAMP and kit | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN108251514A (en) | A kind of colorimetric sensing new method of dual pathogenic bacteria | |
| CN101880709B (en) | Salmonella enteritidis detection reagent kit and method based on loop-mediated isothermal amplification technology | |
| CN107338314A (en) | Stopped pipe visualization eel source Aeromonas hydrophila loop-mediated isothermal amplification detection method | |
| CN110093402A (en) | A kind of high-throughput quantification detection kit of food-borne pathogens | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN107663545A (en) | Detect primer sets and the application of yersinia enterocolitica | |
| CN107287354A (en) | A kind of method that ring mediated isothermal amplification method detects WSSV | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN108277290A (en) | The dry powdered LAMP quick detection kits of staphylococcus aureus | |
| CN108277289A (en) | Escherichia coli O157:The dry powdered LAMP quick detection kits of H7 | |
| CN110106284A (en) | It is a kind of for detecting the high-throughput quantification detection kit of animal epidemic | |
| CN109355408A (en) | A kind of primer, kit and its method of PSR detection Escherichia coli type I shiga toxin | |
| CN110093429A (en) | A kind of high-throughput quantification detection kit of diarrhoeal pathogenic bacteria | |
| Guo et al. | Development of PMA-qPCR assay to accurately and reproducible quantify viable bacteria of Paenibacillus polymyxa | |
| CN107488720A (en) | For detecting the primer sets and its detection method of Escherichia coli O 157 in feed | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| US20180258458A1 (en) | Method of enriching and detecting a target microorganism | |
| CN110093428A (en) | A kind of high-throughput quantification detection kit of kinds of pathogenic vibrio |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210120 Address after: 315040 Ningbo New Materials Innovation Center East District, Ningbo High-tech Zone, Zhejiang Province, No. 1 11-2-1 Applicant after: Zhejiang Zhenghegu Biotechnology Co.,Ltd. Address before: 315211, Fenghua Road, Jiangbei District, Zhejiang, Ningbo 818 Applicant before: Ningbo University |