CN110317766A - A kind of genetic engineering bacterium, construction method and the application of high yield L-cysteine - Google Patents
A kind of genetic engineering bacterium, construction method and the application of high yield L-cysteine Download PDFInfo
- Publication number
- CN110317766A CN110317766A CN201910435397.XA CN201910435397A CN110317766A CN 110317766 A CN110317766 A CN 110317766A CN 201910435397 A CN201910435397 A CN 201910435397A CN 110317766 A CN110317766 A CN 110317766A
- Authority
- CN
- China
- Prior art keywords
- fbr
- sera
- gene
- cyse
- trc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/12—Methionine; Cysteine; Cystine
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the application of a kind of genetic engineering bacterium of high yield L-cysteine and its construction method and the genetic engineering bacterium in microbial fermentation preparation L-cysteine.The present invention constructs the genetic engineering bacterium of high yield L-cysteine, preferably can carry out L-cysteine production using carbon source materials such as glucose compared to wild type by improved Escherichia coli, and its yield is increased to 3.0 ± 0.1g/L from nothing.The L-cysteine movement system that the present invention is further transformed can mitigate product L-cysteine to the feedback inhibition of cysE and its toxic, reach high yield L-cysteine.
Description
(1) technical field
The present invention relates to a kind of genetic engineering bacterium of high yield L-cysteine and its construction methods and the genetic engineering bacterium
Application in microbial fermentation preparation L-cysteine.
(2) background technique
Cysteine is a kind of sulfur-containing amino acid with important physiological function, in medicine, food, animal feed and change
Having wide range of applications in cosmetic industry.Preparation method mainly has reduction method, enzymatic clarification method, chemistry conjunction after hair-hydrolyzation
At method and fermentation method, however microbe fermentation method is small etc. excellent because of its, high specific low with production cost and environmental pollution
Point has wide prospects for commercial application.The biosynthesis of L-cysteine is encoded by cysM or cysK in Escherichia coli
Cysteine synthase specificity catalyze and synthesize, including the supply process of sulfur assimilation approach and O-acetylserine.?
During O-acetylserine, wherein serA gene is by the feedback inhibition and cysE gene of Serine by L-cysteine
Feedback inhibition, and Serine and O-acetylserine are all synthesis L-cysteine precursor substances, therefore obtain to resist
The mutated gene of feedback inhibition is of great significance for improving the production capacity of half Guang serine of L-.In reported document
In had to serA and cysE gene carry out feedback-inhibition resistance research, one is played to the promotion of L-cysteine yield
Determine effect.
Amino acid is according to the similitude of its chemical structure and synthesizes the difference of precursor, wherein-half Guang of Serine-Glycine
The synthesis precursor of propylhomoserin race is the 3-phoshoglyceric acid generated in glycolytic cycle.In microbial body by serA, serB and
The serine synzyme of serC gene coding can make 3-phoshoglyceric acid synthesis serine and sdaA, sdaB and tdcG base
Because Serine can be degraded into pyruvic acid and ammonia by the serine deaminase of coding, in order to enable Serine largely to accumulate
It is tired, it needs to enhance serA, serB and serC gene and knocks out sdaA, sdaB and tdcG gene.
Sulphur and O-acetylserine are the direct precursor substances of E coli synthesis L-cysteine.And Serine is O-
Unique precursor substance of acetyl serine, in order to make a large amount of conversion of serine at O-acetylserine, it is necessary to which enhancing has feedback
The cysE gene of inhibition.Reinforce sulfur assimilation approach simultaneously, wherein positive regulative transcription factor cysB is to cysU, cysP, cysW,
The gene transcription levels such as cysA, cysM, cysK have facilitation, and cysB genes amplification is needed to express.To intracellular in order to prevent
The L-cysteine of accumulation is degraded, and needs to knock out its degrading genes Tnaa and Yham. pertinent literature report L-cysteine is a small amount of
Intracellular accumulation is to the toxic effect of cell, in order to reduce the content of L-cysteine intracellular to mitigate to deleterious cellular effects
With the feedback inhibition of cysE gene, eama gene is overexpressed to realize enhancing L-cysteine outward transport system.
(3) summary of the invention
It is an object of the invention to metabolic engineerings and gene editing technology, provide the genetic engineering bacterium of high yield L-cysteine
And its application of construction method and the genetic engineering bacterium in microbial fermentation preparation L-cysteine.
A kind of genetic engineering bacterium of high yield L-cysteine, built-up by the following method:
(1) by the promoter of serA gene, serB gene and serC gene in the bacterium E.coli W3110 genome of chassis
It is changed to trc promoter, obtains E.coli W3110 serA serB serC (trc)；
(2) apply CRISPR-Cas9 gene editing by serA base in E.coli W3110 serA serB serC (trc)
Because the amino acid of coding carries out H344A/N346A/N364A point mutation, obtain to serine concentration tolerance intracellular enhancing
E.coli W3110 serAfbrserB serC；
(3) by sdaA gene, sdaB gene and the tdcG gene in E.coli serA serB serC (trc) genome
It knocks out, obtains E.coli W3110 serA serB serC (trc) Δ sdaA Δ sdaB Δ tdcG；
(4) the cysE gene of E.coli W3110 serA serB serC (trc) Δ sdaA Δ sdaB Δ tdcG is opened
Mover replaces with trc promoter, enhances cysE gene expression, obtains E.coli W3110 serA serB serC cysE
(trc) ΔsdaA ΔsdaB ΔtdcG；
(5) by cysE in E.coli W3110 serA serB serC cysE (trc) Δ sdaA Δ sdaB Δ tdcG
The amino acid of gene coding carries out T167A/G245S point mutation, obtains to semicystinol concentration tolerance intracellular enhancing
E.coli W3110 serA serB serC cysEfbr(trc)ΔsdaA ΔsdaB ΔtdcG；
(6) by E.coli W3110 serA serB serC cysEfbr(trc) Δ sdaA Δ sdaB Δ tdcG
CysB gene promoter replaces with trc promoter, enhances cysB gene expression, obtains E.coli W3110 serA serB
serC cysEfbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG；
(7) by E.coli W3110 serA serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG
Tnaa gene and Yham gene knockout in genome obtain E.coli W3110 serA serB serC cysEfbrcysB
(trc) ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham；
(8) by eama gene and utilization XbaI and PstI restriction enzyme from Escherichia coli W3110
The pTrc99A of processing is attached, and obtains pTrc99A/eama, with come from E.coli W3110 serA serB serC
cysEfbrCysE gene splicing after the point mutation of cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham, obtains
To Ptrc99A/eama/cysEfbr；
(9) by plasmid Ptrc99A/eama/cysEfbrIt is transferred to E.coli W3110 serA serB serC cysEfbrIn cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham competent cell, recombination engineering bacteria is obtained
W3110 serA serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham
Ptrc99A/eama/cysEfbr；
(10) by recombination engineering bacteria W3110 serAfbrserA serB serC cysE fbrcysB(trc)ΔsdaA
ΔsdaB ΔtdcG ΔTnaa ΔYham Ptrc99A/eama/cysEfbrYciW gene knockout in genome, obtains E.
coli W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa Δ
Yham ΔyciW Ptrc99A/eama/cysEfbr, i.e., the genetic engineering bacterium of the described high yield L-cysteine.
Preferably, the genetic engineering bacterium is Escherichia coli MCYS-7, is preserved in Chinese Typical Representative culture guarantor
Hiding center, address: Wuhan, China Wuhan University, postcode 430072, deposit number: CCTCC NO:M 2019108, preservation date
On 2 22nd, 2019.The strain fermentation L-cysteine yield is 3.0 ± 0.1g/L.
The present invention produces the recombination bacillus coli of L-cysteine, uses strong promoter P firsttrcReplace serA, serB and serC
Gene original position promoter sequence and sdaA, sdaB and tdcG gene are knocked out, to improve serine amount intracellular, and then can be with
Enhance metabolism outlet of the serine to cysteine.By knocking out Yham, Tnaa and yciW gene, to reduce target product L-
Cysteine is degraded into other by-products.Eama gene is connected, on pTrc99A plasmid to promote L-cysteine intracellular
Excretion so that the serine acetyltransferase that the cysE gene of bacterial strain encodes keeps high vigor and stability, and is turned by changing
The connection plasmid is imported in above-mentioned improved Escherichia coli and carries out inducing expression, so that L-cysteine intracellular only supplies
Needed for microorganism growth, large effect will not be generated to the serine acetyltransferase that cysE gene encodes.Pass through simultaneously
Plasmid is overexpressed the serine acetyltransferase (cysE) to desensitize to cysteine and cysteine outward transport albumen (eama),
Realize that serine acetyltransferase intracellular (cysE) turns O-acetylserine in the case where being influenced minimum situation by L-cysteine
Metaplasia is at half Guang serine of L- and secretes to extracellular.
The invention further relates to the methods for constructing the genetic engineering bacterium, which comprises
(1) apply CRISPR-Cas9 gene editing by serA gene, the serB in the bacterium E.coli W3110 genome of chassis
The promoter of gene and serC gene is changed to trc promoter, obtains E.coli W3110 serA serB serC (trc)；
(2) apply CRISPR-Cas9 gene editing by serA base in E.coli W3110 serA serB serC (trc)
Because the amino acid of coding carries out H344A/N346A/N364A point mutation, obtain to serine concentration tolerance intracellular enhancing
E.coli W3110 serAfbrserB serC；
(3) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbrIn serB serC genome
SdaA gene, sdaB gene and tdcG gene knockout obtain E.coli W3110 serAfbr serB serC(trc) Δ
sdaA ΔsdaB ΔtdcG；
(4) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbr serB serC(trc)ΔsdaA
The cysE gene promoter of Δ sdaB Δ tdcG replaces with trc promoter, enhances cysE gene expression, obtains E.coli
W3110 serAfbrserB serC cysE(trc)ΔsdaA ΔsdaB ΔtdcG；
(5) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbrserB serC cysE(trc)Δ
The amino acid that cysE gene encodes in sdaA Δ sdaB Δ tdcG carries out T167A/G245S point mutation, obtains to half Guang intracellular
The E.coli W3110 serA of propylhomoserin concentration tolerance enhancingfbrserB serC cysEfbr(trc)ΔsdaA ΔsdaB Δ
tdcG；
(6) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbrserB serC cysEfbr(trc)
The cysB gene promoter of Δ sdaA Δ sdaB Δ tdcG replaces with trc promoter, enhances cysB gene expression, obtains
E.coli W3110 serAfbrserB serC cysEfbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG；
(7) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbr serB serC cysEfbr cysB
(trc) the Tnaa gene and Yham gene knockout in Δ sdaA Δ sdaB Δ tdcG genome, obtains E.coli W3110
serAfbr serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham；
(8) by eama gene and utilization XbaI and PstI restriction enzyme from Escherichia coli W3110
The pTrc99A of processing is attached, and obtains pTrc99A/eama, with come from E.coli W3110 serAfbr serB serC
cysE fbrCysE gene splicing after the point mutation of cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham,
Obtain Ptrc99A/eama/cysEfbr；
(9) by plasmid Ptrc99A/eama/cysEfbrIt is transferred to E.coli W3110 serAfbr serB serC cysEfbrIn cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham competent cell, recombination engineering bacteria is obtained
W3110 serAfbr serB serC cysEfbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham
Ptrc99A/eama/cysEfbr；
(10) by recombination engineering bacteria W3110 serAfbrserA serB serC cysE fbrcysB(trc)ΔsdaA
ΔsdaB ΔtdcG ΔTnaa ΔYham Ptrc99A/eama/cysEfbrYciW gene knockout in genome, obtains E.
coli W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa Δ
Yham ΔyciW Ptrc99A/eama/cysEfbr, i.e., the genetic engineering bacterium of the described high yield L-cysteine.
The trc promoter nucleotide sequence is as shown in SEQ ID NO.1.
The invention further relates to application of the genetic engineering bacterium in microbial fermentation preparation L-cysteine.Escherichia coli
L-cysteine anabolism figure is referring to Fig. 1 in W3110.Specifically, the application are as follows: connect the genetic engineering bacteria strain
Kind into fermentation medium, 30~37 DEG C, carry out fermented and cultured 48h or more under the conditions of 100~200rpm, take after fermentation
Fermented liquid supernatant isolates and purifies to obtain L-cysteine.
The fermentation medium composition is as follows: glucose 20g/L, (NH4)2SO4 16g/L、KH2PO41g/L, yeast mention
Take object 2g/L, CaCO310g/L, 1ml/L trace element solution, solvent are water, and pH value is natural；Wherein trace element solution group
Become: 0.15g/L Na2MoO4·2H2O、2.5g/L Na3BO3、0.7g/L CoCl2·6H2O、 0.25g/L CuSO4·
5H2O、1.6g/L MnCl2·4H2O、0.3g/L ZnSO47H2O, solvent are water, pH value 7.0.
In general, be first seeded in LB culture medium before the engineering bacteria fermentation, 37 DEG C of Yu Wendu, 200 rpm of revolving speed
Then shaker overnight culture is inoculated into fermentation medium with 3~5% inoculum concentration of volumetric concentration and is cultivated.
Term " feedback inhibition " refers to that serine acetyltransferase activity is inhibited by L-cysteine in the present invention.
The present invention relates to the recombinant vectors containing the L-cysteine transportation system eama encoding gene.The recombinant vector include with
The polynucleotides that the control sequence for being suitble to guidance to express in host cell is operably connected.It is preferred that the expression vector is
pTrc99A.Term " enhancing " refers to increasing the activity of the enzyme by corresponding polynucleotide encoding.The mistake of gene can be passed through
The expression regulation sequence (promoter replacement) etc. of the gene in expression or replacement gene group.
Carrier used in the present invention can not be limited specifically, if carrier be in host it is reproducible, can make
With any carrier as known in the art.
The expression of polypeptide can will include the recombinant vector for the gene for encoding the polypeptide by way of conversion in the present invention
Or in the insertion chromosome of the polynucleotides by that will encode the polypeptide, but method is without being limited thereto.
The beneficial effects are mainly reflected as follows: the present invention constructs the genetic engineering bacterium of high yield L-cysteine, warp
Crossing improved Escherichia coli preferably can carry out L-cysteine life using carbon source materials such as glucose compared to wild type
It produces, and its yield is increased to 3.0 ± 0.1g/L from nothing.The L-cysteine movement system that the present invention is further transformed can be with
Mitigate the substrate of L-cysteine to the feedback inhibition of cysE and its toxic, reaches high yield L-cysteine.
(4) Detailed description of the invention
Fig. 1 is L-cysteine anabolism figure in Escherichia coli W3110.
Fig. 2 is to strengthen Serine route of synthesis in embodiment 1 to include three enzymes: phosphoglycerate dehydrogenase coding
SerA gene, the serB gene and Phosphoserine aminotransferase serC gene of phosphoserine phosphatase coding.
Fig. 3 is that Serine degrading genes are knocked out in embodiment 2.
Fig. 4 is to strengthen L-cysteine route of synthesis in embodiment 3 to include two enzymes: serine acetyltransferase coding
CysEfbrGene and thio thank to positive regulative transcription factor cysB gene.
Fig. 5 is that L-cysteine degradation pathway is blocked in embodiment 4.
Fig. 6 is the outer movement system of enhancing L-cysteine in embodiment 5.
Fig. 7 is the mutated gene cysE that building is overexpressed serine acetyltransferase coding in embodiment 6fbrRecombination matter
Grain.
Fig. 8 is that yciW gene is knocked out in embodiment 7.
Fig. 9 is pTrc99A/eama construction of recombinant vector process and map in embodiment 5.
Figure 10 is pTrc99A/eama/cysE in embodiment 6fbrConstruction of recombinant vector process and map.
Figure 11 is L-cysteine structural formula in embodiment 8.
Figure 12 is that high performance liquid chromatography (HPLC) detects L-cysteine in embodiment 8.
(5) specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This:
Experimental method in embodiment is unless otherwise specified conventional method.
Test material used in embodiment is unless otherwise specified conventional biochemical reagent.
LB culture medium composition: peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, solvent are deionized water, pH value
It is natural.
LB plate is the addition final concentration 2g/L agar in LB liquid medium.
Embodiment 1: the Escherichia coli recombinant strain W3110 serA of building enhancing Serine metabolic pathway of synthesizing gene
serB serC(trc)
(1) expression of enhancing phosphoglycerate dehydrogenase is replaced by promoter
The enzyme of serA gene coding is phosphoglycerate dehydrogenase, is a key enzyme in the synthesis of Serine, because
This also will replace serA gene with trc promoter sequence (nucleotides sequence is classified as shown in SEQ ID NO.1), and (EcoCyc gene is stepped on
Mark: JW2880) in original promoter sequence with achieve the purpose that enhance serA gene expression use base on this basis
Because editing technique makes serA gene that point mutation (mutant primer is shown in Table 2) occur, serA is sportedfbr(H344A, N346A,
N364A), the vigor of the serine synzyme after mutation enhances serine concentration tolerance intracellular, referring to fig. 2.
Pass through encoding serine synzyme in CRISPR-Cas9 system editor's E.coli W3110 strain gene group
The promoter sequence of serA gene.Energy is constructed as template using primer 1 and primer 2 and pTargetF carrier by PCR
The pTarget- Δ PserA::Ptrc mutational vector PCR for enough expressing the sgRNA for targeting target gene serA promoter sequence is anti-
Answer condition as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C are continued to extend 10min.
By PCR product with DpnI in 37 DEG C of processing 3h, conversion is coated on into E. coli BL21 (DE3) recipient bacterium containing eventually after inactivation
On the LB solid plate of concentration 50mg/L spectinomycin hydrochloride resistance, 37 DEG C of culture 12h.Random picking single colonie, which is forwarded to, to be contained
In the LB liquid medium of final concentration 50mg/L spectinomycin hydrochloride resistance, 37 DEG C of culture 12h collect thallus and extract plasmid
Obtain pTarget- Δ PserA::Ptrc carrier.
Primer 3 and primer 4 are used by PCR, serA is obtained as template amplification using the genome of E.coli W3110 bacterial strain
Gene promoter sequence upstream homologous fragment, the promoter sequence information of serA gene are based on Ecocyc E.coli
(the EcoCyc gene accession number: JW2880) obtained in Database database, PCR reaction condition is as follows: 95 DEG C of 5min；95
DEG C 30s, 55 DEG C of 30s, 72 DEG C of 40s repeat 30 circulations；72 DEG C are continued to extend 10min.5 He of primer is used in the same way
The amplification of primer 6 obtains serA gene promoter sequence downstream homologous fragment, and PCR product is detected with 1.0% agarose gel electrophoresis
And gel extraction purified fragments.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine, PCR using the primer of primer 3 and primer 4
Reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min15s repeat 30 circulations；72 DEG C are continued to extend
10min, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purifies the segment, in the gene band incited somebody to action
Ptrc promoter sequence is inserted between two homologous fragments.By the DNA piece of pTarget- Δ PserA::Ptrc carrier and recycling
Duan Yitong electrotransformation is to the E.coli W3110 bacterial strain for having pCas9 carrier.
For electroporation, conversion have the E.coli W3110 bacterial strain of pCas9 carrier in the kanamycins containing 50mg/L and
It is cultivated at 30 DEG C in the LB culture medium of 10mM L-arabinose, until OD600Reach 0.6, bacterium solution obtains bacterium by centrifugation
Body.Thallus is washed twice using sterile distilled water, then washed once using 10% glycerol to use.Electroporation exists
It is carried out under 2.5KV.
Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L
On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 3 and primer 7, and passes through observation
To in 1.0% Ago-Gel, there are the original promoter sequences of the DNA band of 600bp confirmation serA gene by Ptrc
Promoter sequence replacement.By the bacterial strain confirmed by this the kanamycins containing 50mg/L and 5mM IPTG LB culture medium
In at 30 DEG C overnight incubation to remove pTarget- Δ PserA::Ptrc carrier.Then pTarget- Δ will be had been removed
The bacterial strain of PserA::Ptrc carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.Removal pCas is carried
Bacterial strain after body carries out PCR amplification using primer 3 and primer 6, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C
30s, 72 DEG C of 1min30s repeat 30 circulations；72 DEG C are continued to extend 10min, and PCR product is carried out sequence verification, sequencing knot
Fruit confirms that the promoter sequence in situ of serA gene is successfully replaced by Ptrc promoter by BLAST sequence alignment.
Table 1: primer sequence
Table 2: primer sequence
| pTarget-serAfbr1 | ATACTAGTCATCGTCGTTGGTGAAACGGGTTTTAGAGCTAGAAATAGC |
| serAfbr1-1 | GCATTCTGGCTGAATCGCTG |
| serAfbr1-2 | GGACGGTTTTCGTGGATGTGCATCAGACGACG |
| serAfbr1-3 | ATCCACGAAAACCGTCCGGGCGTGCTAACTGCGC |
| serAfbr1-4 | TGCTCCTCCCCTGAGACTG |
| pTarget-serAfbr2 | ATACTAGTGGCGTTCCGGCTCGTATTGTGTTTTAGAGCTAGAAATAGC |
| serAfbr2-1 | CGCCACTCAGGTACAGCATC |
| serAfbr2-2 | CCGCAATGCCTACACCCTGCTCCGCGAAGA |
| serAfbr2-3 | GGAGCAGGGTGTAGGCATTGCGGCGCAATATCTG |
| serAfbr2-4 | ACATCGTTGATTCTTTGACC |
(2) expression of enhancing phosphoserine phosphatase is replaced by promoter
The enzyme of serB gene coding has phosphoserine phosphatase activity, in order to make 3-phoshoglyceric acid toward L- ammonia
More carbon sources are flowed into Serine in the main path metabolic process of acid, serB gene will be replaced with trc promoter sequence
Original promoter sequence in (EcoCyc gene accession number: JW4351) is to achieve the purpose that enhance serB gene expression.
Pass through CRISPR-Cas9 system editor W3110 serAfbr(trc) phosphoserine phosphorus is encoded in strain gene group
The promoter sequence of the serB gene of sour enzyme.With example 1 (1), identical method uses primer 8 and primer 2 by PCR, and
PTargetF carrier can express the pTarget- for the sgRNA for targeting target gene serB promoter sequence as template building
Δ PserB::Ptrc mutational vector.
According to the sequence that GenBank is announced, primer 9 and primer 10 are used by PCR, with W3110 serAfbr(trc) bacterium
The genome of strain is that template amplification obtains serB gene promoter sequence upstream homologous fragment, the promoter sequence of serB gene
Information be based on (the EcoCyc gene accession number: JW4351) obtained in Ecocyc E.coli Database database and
SerB gene promoter sequence downstream homologous fragment, 1.0% agar of PCR product are obtained using primer 11 and the amplification of primer 12
Sugared detected through gel electrophoresis and gel extraction purified fragments.Two DNA fragmentations of recycling are used to the primer of primer 9 and primer 12
Fusion DNA vaccine is carried out, PCR product, which detects simultaneously gel extraction with 1.0% agarose gel electrophoresis, purifies the segment, the gene band
In Ptrc promoter sequence is inserted between two homologous fragments.By pTarget- Δ PserB::Ptrc carrier and recycling
DNA fragmentation together electrotransformation to the W3110 serA for having pCas9 carrierfbr(trc) bacterial strain is incubated overnight rear picking single colonie and makees
For template, PCR is carried out with primer 9 and primer 7, and by observing the DNA in 1.0% Ago-Gel there are 600bp
The original promoter sequence of band confirmation serB gene is replaced by Ptrc promoter sequence.The bacterial strain confirmed by this is existed
In the LB culture medium of kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ
PserB::Ptrc carrier.Then will have been removed the bacterial strain of pTarget- Δ PserB::Ptrc carrier in LB culture medium
Overnight incubation is at 37 DEG C to remove pCas carrier.Bacterial strain after removal pCas carrier is subjected to PCR using primer 9 and primer 12
PCR product is carried out sequence verification by amplification, and sequencing result confirms the promoter in situ of serB gene by BLAST sequence alignment
Sequence is successfully replaced shown in Ptrc promoter.The bacterial strain so constructed is denoted as W3110 serAfbr serB(trc)。
Table 3: primer sequence
(3) expression of enhancing Phosphoserine aminotransferase is replaced by promoter
The enzyme of serC gene coding has Phosphoserine aminotransferase, will replace serC gene with trc promoter sequence
Original promoter sequence in (EcoCyc gene accession number: JW0890) is to achieve the purpose that enhance serC gene expression.
Pass through CRISPR-Cas9 system editor W3110 serAfbrPhosphoric acid silk ammonia is encoded in serB (trc) strain gene group
The promoter sequence of the serC gene of sour transaminase.With example 1 (1), identical method uses primer 13 and primer 2 by PCR,
And pTargetF carrier can express the sgRNA's for targeting target gene serC promoter sequence as template building
PTarget- Δ PserC::Ptrc mutational vector.
Primer 14 and primer 15 are used by PCR, with W3110 serAfbrThe genome of serB (trc) bacterial strain is template
Amplification obtains serC gene promoter sequence upstream homologous fragment, and the promoter sequence information of serC gene is based on Ecocyc
(the EcoCyc gene accession number: JW0890) and use primer 16 and primer 17 obtained in E.coli Database database
Amplification obtains serC gene promoter sequence downstream homologous fragment.Two DNA fragmentations of recycling are used into primer 14 and primer 17
Primer carry out fusion DNA vaccine.By pTarget- Δ PserC::Ptrc carrier and the DNA fragmentation of recycling together electrotransformation to having
The W3110 serA of pCas9 carrierfbrSerB (trc) bacterial strain is incubated overnight rear picking single colonie as template, with primer 14
PCR is carried out with primer 7, and there are the DNA bands of 600bp to confirm serC base in 1.0% Ago-Gel by observing
The original promoter sequence of cause is replaced by Ptrc promoter sequence.By the bacterial strain confirmed by this in the card containing 50mg/L
In the LB culture medium of that mycin and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ PserC::Ptrc carrier.
Then will have been removed the bacterial strain of pTarget- Δ PserC::Ptrc carrier in LB culture medium at 37 DEG C overnight incubation with
Remove pCas carrier.The bacterial strain after pCas carrier will be removed and carry out PCR amplification using primer 14 and primer 17, by PCR product into
Row sequence verification, sequencing result confirm that the promoter sequence in situ of serC gene has been opened by Ptrc by BLAST sequence alignment
Mover (nucleotides sequence is classified as SEQ ID NO.1) is successfully replaced.The bacterial strain so constructed is denoted as W3110 serAfbr serB
serC(trc)。
Table 4: primer sequence
Embodiment 2: building knocks out the Escherichia coli recombinant strain W3110 of Serine catabolic pathway gene
serAfbrserB serC(trc)ΔsdaAΔsdaBΔtdcG
(1) knockout of E.coli W3110 serine deaminase I encoding gene sdaA
In order to block the katabolism path of precursor substance serine, by knocking out the serine deaminase I's encoded
SdaA gene destroys serine and resolves into pyruvic acid and ammonia, to obtain the Serine of high concentration, therefore in W3110
serAfbrSdaA gene is implemented to knock out in serB serC (trc) strain, referring to Fig. 3.
Pass through CRISPR-Cas9 system editor W3110 serAfbrSilk is encoded in serB serC (trc) strain gene group
The sdaA gene of propylhomoserin deaminase.It is constructed using primer 18 and primer 2 and pTargetF carrier as template by PCR
The pTarget- Δ sdaA mutation for targeting the sgRNA of target gene sdaA (EcoCyc gene accession number: JW1803) can be expressed
Carrier.PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C of continuation
Extend 10min.PCR product is converted after inactivation into E.coli BL21 (DE3) recipient bacterium with DpnI in 37 DEG C of processing 3h,
It is coated on the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h.Random picking single bacterium
It falls in the LB liquid medium for being forwarded to the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h, collects thallus
And it extracts plasmid and obtains pTarget- Δ sdaA carrier.
Primer 19 and primer 20 are used by PCR, with W3110 serAfbrThe genome of serB serC (trc) bacterial strain
SdaA upstream region of gene homologous fragment is obtained for template amplification, PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30 s, 55 DEG C of 30s,
72 DEG C of 40s repeat 30 circulations；72 DEG C are continued to extend 10min.It is expanded in the same way using primer 21 and primer 22
To sdaA downstream of gene homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.It will
Two DNA fragmentations of recycling carry out fusion DNA vaccine using primer 19 and primer 22, and PCR reaction condition is as follows: 95 DEG C of 5min；95℃
30s, 55 DEG C of 30s, 72 DEG C of 1min15s repeat 30 circulations；72 DEG C are continued to extend 10min, 1.0% agarose of PCR product
Simultaneously gel extraction purifies the segment to detected through gel electrophoresis.By pTarget- Δ sdaA carrier and the DNA fragmentation of recycling, electricity turns together
Change to W3110 serA serB serC (trc) bacterial strain for having pCas9 carrier.
For electroporation, conversion has the W3110 serA of pCas9 carrierfbrSerB serC (trc) bacterial strain is containing
It is cultivated in the kanamycins of 50mg/L and the LB culture medium of 10mM L-arabinose at 30 DEG C, until OD600 reaches 0.6, bacterium
Liquid obtains thallus by centrifugation.Thallus is washed twice using sterile distilled water, then using 10% glycerol washed once so as to
It uses.Electroporation is carried out at 2.5KV.Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and 50mg/L
On the LB plate of spectinomycin hydrochloride resistance, 30 DEG C of overnight incubations.Picking single colonie is as template, with primer 19 and primer 22
PCR is carried out, and there are the DNA bands of 1026bp to confirm lacking for sdaA gene in 1.0% Ago-Gel by observing
It loses.The bacterial strain confirmed by this is trained at 30 DEG C in the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG
It supports overnight to remove pTarget- Δ sdaA carrier.Then the bacterial strain for having been removed pTarget- Δ sdaA carrier is trained in LB
Support base at 37 DEG C overnight incubation to remove pCas carrier.The bacterial strain so constructed is denoted as W3110 serAfbr serB
serC(trc)ΔsdaA。
Table 5: primer sequence
| Primer 18 | ATACTAGTTTATGGTTCACTGTCGCTGAGTTTTAGAGCTAGAAATAGCA |
| Primer 19 | GCGCGAAGCTGAAGAAGAGG |
| Primer 20 | TGGGCGAGTAAGAAGTATTACACGATAATACTCCTGACAA |
| Primer 21 | TTGTCAGGAGTATTATCGTGTAATACTTCTTACTCGCCCA |
| Primer 22 | GAATGTCCACGACGGGCACA |
(2) knockout of E.coli W3110 serine deaminase II encoding gene sdaB
By knocking out the sdaB gene of the serine deaminase II of coding, further destroys serine and resolve into acetone
Acid and ammonia, to obtain the Serine of high concentration, therefore in W3110 serAfbrSerB serC (trc) Δ sdaA strain
In to sdaB gene implement knock out.
Pass through CRISPR-Cas9 system editor W3110 serAfbrIn serB serC (trc) Δ sdaA strain gene group
The sdaB gene of encoding serine deaminase II.Primer 23 and primer 2 are used by PCR with example 2 (1) same procedure, with
And pTargetF carrier can express as template building and target target gene sdaB (EcoCyc gene accession number: JW2768)
SgRNA pTarget- Δ sdaB mutational vector.
According to the sequence that GenBank is announced, primer 24 and primer 25 are used by PCR, with W3110 serAfbr serB
The genome of serC (trc) Δ sdaA bacterial strain is that template amplification obtains sdaB upstream region of gene homologous fragment and uses primer 26
SdaB downstream of gene homologous fragment is obtained with the amplification of primer 27, PCR product is detected with 1.0% agarose gel electrophoresis and cuts glue
Recovery purifying segment.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using primer 24 and primer 27, PCR product is with 1.0%
Simultaneously gel extraction purifies the segment for agarose gel electrophoresis detection.By the DNA fragmentation one of pTarget- Δ sdaB carrier and recycling
With electrotransformation to the W3110 serA for having pCas9 carrierfbrSerB serC (trc) Δ sdaA bacterial strain stays overnight picking single colonie
As template, PCR is carried out with primer 24 and primer 27, and by observing that there are 1032bp in 1.0% Ago-Gel
DNA band confirmation sdaB gene missing.By the bacterial strain confirmed by this in kanamycins and 5mM containing 50mg/L
In the LB culture medium of IPTG at 30 DEG C overnight incubation to remove pTarget- Δ sdaB carrier.Then it will have been removed
The bacterial strain of pTarget- Δ sdaB carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.So building
Bacterial strain be denoted as W3110 serAfbr serB serC(trc)ΔsdaAΔsdaB。
Table 6: primer sequence
(3) knockout of E.coli W3110 serine deaminase III encoding gene tdcG
In order to accumulate Serine intracellular further, need to block the degradation pathway of Serine, therefore,
To W3110 serAfbrTdcG gene in serB serC (trc) Δ sdaA Δ sdaB bacterial strain is knocked out.
By CRISPR-Cas9 system to W3110 serAfbrSerB serC (trc) Δ sdaA Δ sdaB strain gene
The tdcG gene of encoding serine deaminase is edited in group.With example 2 (1), identical method uses primer by PCR
28 and primer 2, using pTargetF carrier as template, building, which can be expressed, targets target gene tdcG (EcoCyc gene registration
Number: the pTarget- Δ tdcG mutational vector of sgRNA JW5520).
According to the sequence that GenBank is announced, primer 29 and primer 30 are used by PCR, with W3110 serAfbrserB
The genome of serC (trc) Δ sdaA Δ sdaB bacterial strain is that template amplification obtains tdcG upstream region of gene homologous fragment and use
Primer 31 and the amplification of primer 32 obtain tdcG downstream of gene homologous fragment, and PCR product is detected with 1.0% agarose gel electrophoresis
And gel extraction purified fragments.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine, PCR product using primer 29 and primer 32
With the detection of 0.9% agarose gel electrophoresis and gel extraction purifies the segment.By pTarget- Δ tdcG carrier and recycling
DNA fragmentation together electrotransformation to the W3110 serA for having pCas9 carrierfbrSerB serC (trc) Δ sdaA Δ sdaB bacterial strain,
It is incubated overnight picking single colonie and PCR is carried out with primer 29 and primer 32 as template, and by observing in 1.0% agar
There are the missings of the DNA band of 1003bp confirmation tdcG gene in sugared gel.The bacterial strain confirmed by this is being contained into 50mg/L
Kanamycins and 5mM IPTG LB culture medium at 30 DEG C overnight incubation to remove pTarget- Δ tdcG carrier.So
By the bacterial strain for having been removed pTarget- Δ tdcG carrier, overnight incubation is carried at 37 DEG C with removing pCas in LB culture medium afterwards
Body.The bacterial strain so constructed is denoted as W3110serAfbrserB serC(trc)ΔsdaAΔsdaBΔtdcG。
6 primer sequence of table
The building of embodiment 3:L- cysteine route of synthesis is to obtain L-cysteine-producing bacteria strain W3110 serAfbr
serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG。
(1) Escherichia coli recombinant strain of mutation serine acetyltransferase encoding gene is strengthened in preparation
The cysE gene of encoding serine transacetylase, in order to make Serine constantly be converted to O-acetylserine,
So that more carbon sources is flowed to L-cysteine, will with trc promoter sequence replacement cysE gene (EcoCyc gene accession number:
JW3582 the original promoter sequence in) is to reach enhancing cysE gene expression
Pass through CRISPR-Cas9 system editor W3110 serAfbrserA serB serC(trc)ΔsdaA ΔsdaB
The promoter sequence of positive regulative transcription factor cysE gene passes through with example 1 (1) same procedure in Δ tdcG strain gene group
PCR is constructed to express as template using primer 33 and primer 2 and pTargetF carrier and is targeted target gene cysE and open
The pTarget- Δ PcysE::Ptrc mutational vector of the sgRNA of promoter sequences.Primer 34 and primer are used by PCR simultaneously
35, with W3110 serAfbrThe genome of serB serC (trc) Δ sdaA Δ sdaB Δ tdcG bacterial strain obtains for template amplification
To cysE gene promoter sequence upstream homologous fragment, cysE is obtained using primer 36 and the amplification of primer 37 in the same way
Gene promoter sequence downstream homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purifies piece
Section, Ptrc promoter sequence is inserted between two homologous fragments in the gene band.By pTarget- Δ PcysE::
Ptrc carrier and the DNA fragmentation of recycling together electrotransformation to the bacterial strain for having pCas9 carrier.Rear picking single colonie is incubated overnight to make
For template, PCR is carried out with primer 34 and primer 7, and by observing that there are 600bp's in 1.0% Ago-Gel
The original promoter sequence of DNA band confirmation cysE gene is replaced by Ptrc promoter sequence, and PCR product is surveyed
Sequence verifying, sequencing result by BLAST sequence alignment confirm cysE gene promoter sequence in situ by Ptrc promoter at
Function replacement.The bacterial strain of building is denoted as W3110 serAfbrSerB serC cysE (trc) Δ sdaA Δ sdaB Δ tdcG,
On the basis of this, makes cysE gene that point mutation (mutant primer is shown in Table 7) occur using gene editing technology, sport cysEfbr
The vigor of (T167A, G245S), the serine acetyltransferase after mutation enhance semicystinol concentration tolerance intracellular,
Referring to fig. 4.The bacterial strain of building is denoted as W3110 serAfbr serB serC cysEfbr(trc)ΔsdaA ΔsdaB Δ
tdcG。
Table 6: primer sequence
Table 7: primer sequence
(2) the thio Escherichia coli recombinant strain for thanking to positive regulative transcription factor encoding gene is strengthened in preparation
In order to make positive regulative transcription factor cysB to cysU, cysP, cysW, cysA, cysM, the genetic transcriptions water such as cysK
It is flat to have facilitation, therefore to W3110 serAfbr serB serC cysEfbr(trc) Δ sdaA Δ sdaB Δ tdcG bacterial strain
In gene carried out cysB genes amplification expression.
Pass through CRISPR-Cas9 system editor W3110 serAfbr serB serC cysEfbr(trc)ΔsdaA Δ
The promoter sequence of positive regulative transcription factor cysB gene in sdaB Δ tdcG strain gene group.With example 1 (1) same procedure
It can be expressed using primer 38 and primer 2 and pTargetF carrier as template building by PCR and target target gene
The pTarget- Δ PcysB::Ptrc mutational vector of the sgRNA of cysB promoter sequence；
According to the sequence that GenBank is announced, primer 39 and primer 40 are used by PCR, with W3110 serAfbr serB
serC cysEfbr(trc) genome of Δ sdaA Δ sdaB Δ tdcG bacterial strain is that template amplification obtains cysB gene promoter
Sequences upstream homologous fragment and using primer 41 and primer 42 amplification obtain homologous of cysB gene promoter sequence downstream
Section, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.Two DNA segments of recycling are made
Fusion DNA vaccine is carried out with the primer of primer 39 and primer 42, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction
The segment is purified, Ptrc promoter sequence is inserted between two homologous fragments in the gene band.By pTarget- Δ
Electrotransformation is to the bacterial strain for having pCas9 carrier together for PcysB::Ptrc carrier and the DNA fragmentation of recycling, and picking single colonie is as mould
Plate carries out PCR with primer 39 and primer 7, and by observing the DNA item in 1.0% Ago-Gel there are 600bp
Original promoter sequence with confirmation cysB gene has been replaced by Ptrc promoter sequence.The bacterial strain confirmed by this is being contained
There is in the kanamycins of 50mg/L and the LB culture medium of 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ
PcysB::Ptrc carrier.Then will have been removed the bacterial strain of pTarget- Δ PcysB::Ptrc carrier in LB culture medium
Overnight incubation is at 37 DEG C to remove pCas carrier.Bacterial strain after removal pCas carrier is subjected to PCR using primer 39 and primer 42
Amplification, then carries out sequence verification for PCR product, and sequencing result confirms that the original position of cysB gene is opened by BLAST sequence alignment
Promoter sequences are successfully replaced by Ptrc promoter.The bacterial strain of building is denoted as W3110 serAfbr serB serC cysEfbr
cysB(trc)ΔsdaA ΔsdaB ΔtdcG。
Table 8: primer sequence
Embodiment 4: building knocks out the Escherichia coli recombinant strain W3110 of L-cysteine catabolic pathway gene
serAfbrserB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaaΔYham
(1) cysteine for knocking out Escherichia coli W3110 takes off the gene (Tnaa) of mercapto enzyme coding
In order to block the katabolism path of L-cysteine intracellular, the cysteine by knocking out coding takes off mercapto enzyme
Tnaa gene destroys the process (referring to Fig. 5) of L-cysteine catabolism synthesis pyruvic acid, therefore in W3110 serAfbr
serB serC cysEfbrTnaa gene is implemented to knock out in cysB (trc) Δ sdaA Δ sdaB Δ tdcG strain.
Pass through CRISPR-Cas9 system editor W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA
Encoding aminothiopropionic acid takes off the Tnaa gene of mercapto enzyme in Δ sdaB Δ tdcG strain gene group.With example 2 (1), identical method is logical
It crosses PCR and constructs to express as template using primer 43 and primer 2 and pTargetF carrier and target target gene Tnaa
The pTarget- Δ Tnaa mutational vector of the sgRNA of (EcoCyc gene accession number: JM3686)；
According to the sequence that GenBank is announced, primer 44 and primer 45 are used by PCR, with W3110 serAfbr serB
serC cysEfbrThe genome of cysB (trc) Δ sdaA Δ sdaB Δ tdcG bacterial strain is that template amplification obtains Tnaa gene
Upstream homologous fragment, and Tnaa downstream of gene homologous fragment is obtained using primer 46 and the amplification of primer 47, PCR product is used
The detection of 1.0% agarose gel electrophoresis and gel extraction purified fragments.Two DNA fragmentations of recycling using primer 44 and are drawn
Object 47 carries out fusion DNA vaccine, and PCR product, which detects simultaneously gel extraction with 1.0% agarose gel electrophoresis, purifies the segment.It will
PTarget- Δ Tnaa carrier and the DNA fragmentation of recycling together electrotransformation to the W3110 serA for having pCas9 carrierfbr serB
serC cysEfbrCysB (trc) Δ sdaA Δ sdaB Δ tdcG bacterial strain, is incubated overnight rear picking single colonie as template,
PCR is carried out with primer 44 and primer 47, and by observing the DNA band in 1.0% Ago-Gel there are 1196bp
Confirm the missing of Tnaa gene.The bacterial strain confirmed by this is trained in the LB of the kanamycins containing 50mg/L and 5mM IPTG
Support base at 30 DEG C overnight incubation to remove pTarget- Δ Tnaa carrier.Then pTarget- Δ Tnaa will be had been removed
The bacterial strain of carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.The bacterial strain so constructed is denoted as W3110
serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa。
9 primer sequence of table
(2) preparation of the bacterial strain W3110 (Δ Yham) of Yham gene is knocked out
By knock out Yham gene, destroy L-cysteine catabolism synthesis pyruvic acid process, therefore
W3110 serAfbrserA serB serC cysEfbrIn cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa strain
Yham gene is implemented to knock out.
Pass through CRISPR-Cas9 system editor W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA
Encoding aminothiopropionic acid takes off the Yham gene of mercapto enzyme in Δ sdaB Δ tdcG Δ Tnaa strain gene group.It is identical with example 2 (1)
Method construct to express as template using primer 48 and primer 2 and pTargetF carrier by PCR and target purpose
The pTarget- Δ Yham mutational vector of the sgRNA of gene Yham (EcoCyc gene accession number: JM5518).
According to the sequence that GenBank is announced, primer 49 and primer 50 are used by PCR, with W3110 serAfbr serB
serC cysEfbrThe genome of cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa bacterial strain obtains for template amplification
Yham upstream region of gene homologous fragment and using primer 51 and primer 52 amplification obtain Yham downstream of gene homologous fragment, PCR
Product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.Two DNA fragmentations of recycling are used into primer
49 and primer 52 carry out fusion DNA vaccine, PCR product, which detects simultaneously gel extraction with 1.0% agarose gel electrophoresis, purifies the segment.
By pTarget- Δ Yham carrier and the DNA fragmentation of recycling together electrotransformation to the W3110 serA for having pCas9 carrierfbr
serB serC cysEfbrCysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa bacterial strain, is incubated overnight rear picking single bacterium
It falls as template, PCR is carried out with primer 49 and primer 52, and by observing exist in 1.0% Ago-Gel
The missing of the DNA band confirmation Yham gene of 1028bp.By the bacterial strain confirmed by this in the kanamycins containing 50mg/L and
In the LB culture medium of 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ Yham carrier.Then it will have been removed
The bacterial strain of pTarget- Δ Yham carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.So building
Bacterial strain be denoted as W3110 serAfbr serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa
ΔYham。
10 primer sequence of table
Embodiment 5: the recombinant plasmid of the outer transport protein encoding gene of building expression L-cysteine
With wild-type e. coli Escherichia coli W3110 (Escherichia coli genetic breeding center The Coli
Genetic Stock Center) genome is as template, together with primer 53 and the progress PCR amplification of primer 54.PCR reacts item
Part: initial denaturation 95 DEG C of 5min, 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, totally 30 recycle, last 72 DEG C of extensions 10min.PCR
Product is detected with 1.0% agarose gel electrophoresis and gel extraction purifies the segment, limits by the segment and using XbaI and PstI
The pTrc99A of property inscribe enzymatic treatment processed is attached (referring to Fig. 6), construction of expression vector pTrc99A/eama (building process and
Map is referring to Fig. 9).
11 primer sequence of table
Embodiment 6: the recombinant plasmid of building expression mutation serine acetyltransferase encoding gene
With recombination bacillus coli Escherichia coli W3110 serAfbrserB serC cysE fbrcysB(trc)
Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham genome carries out PCR expansion as template, together with primer 55 and primer 56
Increase.PCR reaction condition: initial denaturation 95 DEG C of 5min, 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, totally 30 recycle, and last 72 DEG C
Extend 10min.PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purifies the segment.Using pstI and
HindIII restriction enzyme carries out digestion processing to amplified fragments, with identical restriction enzyme under one-step cloning enzyme effect
The pTrc99A/eama of enzymatic treatment is attached, and obtains cloning recombinant plasmids pTrc99A/eama/cysEfbr(building process and
Map is referring to Figure 10).In pTrc99A/eama/cysEfbrIt is prominent that cysE gene (T167A, G245S) on plasmid carries out fixed point
Become, the 167th threonine is replaced with into alanine and the 245th glycine is substituted for serine (referring to Fig. 7).
Table 12: primer sequence
Embodiment 7: the gene (yciW) of the oxidoreducing enzyme coding of Escherichia coli W3110 is knocked out
By knocking out yciW gene, transforms cysteine intracellular is reduced into by-products such as methionine, therefore in W3110
serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham pTrc99A/
eama/cysEfbrYciW gene is implemented to knock out in strain.
Pass through CRISPR-Cas9 system editor W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA
ΔsdaB ΔtdcG ΔTnaa ΔYham pTrc99A/eama/cysEfbrYciW gene in strain gene group.With example 2
(1) identical method can express target as template building using primer 57 and primer 2 and pTargetF carrier by PCR
Determine the pTarget- Δ yciW mutational vector of the sgRNA of target gene yciW (EcoCyc gene accession number: JW5200).
According to the sequence that GenBank is announced, primer 58 and primer 59 are used by PCR, with W3110 serAfbr serB
serC cysEfbr cysB(trc)ΔsdaAΔsdaBΔtdcGΔTnaaΔYham pTrc99A/eama/cysEfbrBacterial strain
Genome is that template amplification obtains yciW upstream region of gene homologous fragment and obtains yciW base using primer 60 and the amplification of primer 61
Because of downstream homologous fragment.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using primer 58 and primer 61.By pTarget- Δ
YciW carrier and the DNA fragmentation of recycling together electrotransformation to the W3110 serA for having pCas9 carrierfbr serB serC cysEfbr
cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaaΔYham pTrc99A/eama/cysEfbrBacterial strain, after being incubated overnight
Picking single colonie carries out PCR as template, with primer 58 and primer 61, and by observing in 1.0% Ago-Gel
There are the missings of the DNA band of bp confirmation yciW gene.By the bacterial strain confirmed by this in the kanamycins containing 50mg/L and
In the LB culture medium of 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ yciW carrier.Then it will have been removed
The bacterial strain of pTarget- Δ yciW carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.So building
Bacterial strain be denoted as W3110 serAfbr serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa
ΔYham ΔyciW pTrc99A/eama/cysEfb(i.e. CCTCC NO:M 2019108)r。
Table 13: primer sequence
Embodiment 8: recombinant bacterium W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB Δ
tdcG ΔYham ΔTnaa ΔyciW Ptrc99A/eama/cysEfbrShake flask fermentation produces L-cysteine
Fermenting experiment test is carried out in shaking flask to the thallus of aforementioned building, to produce between more each genotype strain
The ability of L-cysteine.Shake flask fermentation experiment is carried out by following scheme: each bacterial strain streak inoculation is being contained 50 μ g/mL
On the LB plate of ampicillin sodium resistance, the overnight incubation in 37 DEG C of incubators, picking single colonie is seeded to the LB training of 5ml
Support base in, and with the revolving speed of 200rpm in 37 DEG C of incubators overnight incubation.
The fermentation medium of 20ml is added in the shaking flask of 500ml, and the seed liquor of every kind of bacterial strain of 1ml is seeded to and is shaken
In the culture medium of bottle.Then shaking flask is cultivated 48 hours in 30 DEG C of incubator with the revolving speed of 180rpm, and 1ml is taken from shaking flask
Liquid dilutes 100 times with ultrapure water, analyzes the content of L-cysteine in fermentation liquid after filter membrane by HPLC, final to compare
Every kind of bacterial strain for carrying plasmid obtains the amount of L-cysteine, as a result referring to Fig. 8.Fermentation medium composition: glucose 20g/L,
(NH4)2SO4 16g/L、KH2PO41g/L, yeast extract 2g/L, CaCO310g/L, 1ml/L trace element solution, solvent
For water, pH value nature；Wherein trace element solution forms are as follows: 0.15g/L Na2MoO4·2H2O、2.5g/L Na3BO3、0.7g/
L CoCl2·6H2O、0.25g/L CuSO4·5H2O、1.6g/L MnCl2·4H2O、0.3g/L ZnSO4·7H2O, solvent are
Water, pH value 7.0.
W3110 serA after fermentedfbrBC cysEfbr cysBΔsdaA ΔsdaB ΔtdcG、W3110
serAfbrBC cysEfbr cysB ΔsdaA ΔsdaB ΔtdcG Δyham Δtnaa、W3110 serAfbr serB
serC cysE fbrcysB(trc) ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham Ptrc99A/eama、W3110
serAfbr serB serC cysE fbrcysB (trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham Ptrc99A/
eama/cysEfbrWith W3110 serAfbr serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG Δ
Tnaa ΔYham ΔyciW Ptrc99A/eama/cysEfbr(i.e. CCTCC NO:M 2019108) bacterial strain has production L- half
The ability of cystine, and apparent shadow is not caused to the growth of bacterial strain to the transformation of the part of L-cysteine transportation system
It rings, by the control to bacterial strain L-cysteine intracellular (structural formula is referring to Figure 11) content, it can be weakened to cysE gene
Feedback inhibition, to play the good activity of the enzyme.The bacterial strain of best performance is in half Guang of fermenting and producing L- after transformation
The horizontal bacterial strain compared to wild type of propylhomoserin is increased to 3.0 ± 0.1g/L from 0g/L (referring to Figure 12).Other are after transformation
Bacterial strain production L-cysteine level have different degrees of raising compared to original strain.
Sequence table
<110>Zhejiang Polytechnical University
<120>a kind of genetic engineering bacterium, construction method and the application of high yield L-cysteine
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 74
<212> DNA
<213>unknown (Unknown)
<400> 1
ttgacaatta atcatccggc tcgtataatg tgtggaattg tgagcggata acaatttcac 60
acaggaaaca gacc 74
Claims (7)
1. a kind of genetic engineering bacterium of high yield L-cysteine, built-up by the following method:
(1) by the promoter replacement of serA gene, serB gene and serC gene in the bacterium E.coli W3110 genome of chassis
For trc promoter, E.coli W3110 serA serB serC (trc) is obtained；
(2) serA gene in E.coli W3110 serA serB serC (trc) is compiled using CRISPR-Cas9 gene editing
The amino acid of code carries out H344A/N346A/N364A point mutation, obtains the E.coli enhanced serine concentration tolerance intracellular
W3110 serAfbrserB serC；
(3) by E.coli serAfbrSdaA gene, sdaB gene and tdcG clpp gene in serB serC (trc) genome
It removes, obtains E.coli W3110 serAfbrserB serC(trc)ΔsdaA ΔsdaB ΔtdcG；
(4) by E.coli W3110 serAfbrThe cysE gene promoter of serB serC (trc) Δ sdaA Δ sdaB Δ tdcG
Son replaces with trc promoter, enhances cysE gene expression, obtains E.coli W3110 serAfbr serB serC cysE
(trc)ΔsdaA ΔsdaB ΔtdcG；
(5) by E.coli W3110 serAfbrCysE gene in serB serC cysE (trc) Δ sdaA Δ sdaB Δ tdcG
The amino acid of coding carries out T167A/G245S point mutation, obtains the E.coli enhanced semicystinol concentration tolerance intracellular
W3110 serAfbr serB serC cysEfbr(trc)ΔsdaA ΔsdaB ΔtdcG；
(6) by E.coli W3110 serAfbrserA serB serC cysEfbr(trc) Δ sdaA Δ sdaB Δ tdcG
CysB gene promoter replaces with trc promoter, enhances cysB gene expression, obtains E.coli W3110 serAfbr serB
serC cysEfbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG；
(7) by E.coli W3110 serAfbr serB serC cysEfbrCysB (trc) Δ sdaA Δ sdaB Δ tdcG base
Because of the Tnaa gene and Yham gene knockout in group, E.coli W3110 serA is obtainedfbrserA serB serC
cysEfbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham；
(8) by eama gene and utilization XbaI and PstI restriction enzyme enzymatic treatment from Escherichia coli W3110
PTrc99A be attached, obtain pTrc99A/eama, with come from E.coli W3110 serAfbrserA serB serC
cysE fbrCysE gene splicing after the point mutation of cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham, obtains
To Ptrc99A/eama/cysEfbr；
(9) by plasmid Ptrc99A/eama/cysEfbrIt is transferred to E.coli W3110 serAfbr serB serC cysE fbrcysB
(trc) in Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham competent cell, recombination engineering bacteria W3110 is obtained
serAfbrserA serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham
Ptrc99A/eama/cysEfbr；
(10) by recombination engineering bacteria W3110 serAfbrserA serB serC cysE fbrcysB(trc)ΔsdaA Δ
sdaB ΔtdcG ΔTnaa ΔYham Ptrc99A/eama/cysEfbrYciW gene knockout in genome, obtains
E.coli W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa Δ
Yham ΔyciW Ptrc99A/eama/cysEfbr, i.e., the genetic engineering bacterium of the described high yield L-cysteine.
2. genetic engineering bacterium as described in claim 1, it is characterised in that the genetic engineering bacterium is Escherichia coli
MCYS-7 is preserved in China typical culture collection center, address: Wuhan, China Wuhan University, postcode 430072, and preservation is compiled
Number: CCTCC NO:M 2019108, preservation date on 2 22nd, 2019.
3. the method for constructing genetic engineering bacterium as claimed in claim 1 or 2, which comprises
(1) apply CRISPR-Cas9 gene editing by serA gene, the serB gene in the bacterium E.coli W3110 genome of chassis
It is changed to trc promoter with the promoter of serC gene, obtains E.coli W3110 serA serB serC (trc)；
(2) serA gene in E.coli W3110 serA serB serC (trc) is compiled using CRISPR-Cas9 gene editing
The amino acid of code carries out H344A/N346A/N364A point mutation, obtains the E.coli enhanced serine concentration tolerance intracellular
W3110 serAfbrserB serC；
(3) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbrIn serB serC (trc) genome
SdaA gene, sdaB gene and tdcG gene knockout obtain E.coli W3110 serAfbr serB serC(trc)ΔsdaA
ΔsdaB ΔtdcG；
(4) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbr serB serC(trc)ΔsdaA Δ
The cysE gene promoter of sdaB Δ tdcG replaces with trc promoter, enhances cysE gene expression, obtains E.coli W3110
serA serB serC cysE(trc)ΔsdaA ΔsdaB ΔtdcG；
(5) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbr serB serC(trc)ΔsdaA Δ
The amino acid that cysE gene encodes in sdaB Δ tdcG carries out T167A/G245S point mutation, obtains to semicystinol concentration intracellular
The E.coli W3110 serA of tolerance enhancingfbr serB serC cysEfbr(trc)ΔsdaA ΔsdaB ΔtdcG；
(6) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbr serB serC cysEfbr(trc)Δ
The cysB gene promoter of sdaA Δ sdaB Δ tdcG replaces with trc promoter, enhances cysB gene expression, obtains E.coli
W3110 serAfbrserB serC cysEfbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG；
(7) apply CRISPR-Cas9 gene editing by E.coli W3110 serAfbr serB serC cysEfbr cysB
(trc) the Tnaa gene and Yham gene knockout in Δ sdaA Δ sdaB Δ tdcG genome, obtains E.coli W3110
serAfbr serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham；
(8) by eama gene and utilization XbaI and PstI restriction enzyme enzymatic treatment from Escherichia coli W3110
PTrc99A be attached, obtain pTrc99A/eama, with come from E.coli W3110 serAfbr serB serC cysEfbrCysE gene splicing after the point mutation of cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham, obtains
Ptrc99A/eama/cysEfbr；
(9) by plasmid Ptrc99A/eama/cysEfbrIt is transferred to E.coli W3110 serAfbr serA serB serC cysEfbrIn cysB (trc) Δ sdaA Δ sdaB Δ tdcG Δ Tnaa Δ Yham competent cell, recombination engineering bacteria is obtained
W3110 serAfbr serB serC cysE fbrcysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa ΔYham
Ptrc99A/eama/cysEfbr；
(10) by recombination engineering bacteria W3110 serAfbrserA serB serC cysE fbrcysB(trc)ΔsdaA Δ
sdaB ΔtdcG ΔTnaa ΔYham Ptrc99A/eama/cysEfbrYciW gene knockout in genome, obtains
E.coli W3110 serAfbr serB serC cysEfbr cysB(trc)ΔsdaA ΔsdaB ΔtdcG ΔTnaa Δ
Yham ΔyciW Ptrc99A/eama/cysEfbr, i.e., the genetic engineering bacterium of the described high yield L-cysteine.
4. method as claimed in claim 3, it is characterised in that: the trc promoter nucleotide sequence such as SEQ ID NO.1 institute
Show.
5. application of the genetic engineering bacterium described in claim 1 in microbial fermentation preparation L-cysteine.
6. application as claimed in claim 5, it is characterised in that the application are as follows: by the genetic engineering bacterium strain inoculated to hair
In ferment culture medium, 30~37 DEG C, fermented and cultured 48h or more is carried out under the conditions of 100~200rpm, take on fermentation liquid after fermentation
It isolates and purifies to obtain L-cysteine clearly.
7. application as claimed in claim 6, it is characterised in that the fermentation medium composition is as follows: glucose 20g/L,
(NH4)2SO4 16g/L、KH2PO41g/L, yeast extract 2g/L, CaCO310g/L, 1ml/L trace element solution, solvent are
Water, pH value are natural；Wherein trace element solution forms are as follows: 0.15g/L Na2MoO4·2H2O、2.5g/L Na3BO3、0.7g/L
CoCl2·6H2O、0.25g/L CuSO4·5H2O、1.6g/L MnCl2·4H2O、0.3g/L ZnSO4·7H2O, solvent are water,
PH value 7.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910435397.XA CN110317766B (en) | 2019-05-23 | 2019-05-23 | Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910435397.XA CN110317766B (en) | 2019-05-23 | 2019-05-23 | Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110317766A true CN110317766A (en) | 2019-10-11 |
| CN110317766B CN110317766B (en) | 2020-08-28 |
Family
ID=68119060
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910435397.XA Active CN110317766B (en) | 2019-05-23 | 2019-05-23 | Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110317766B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111019877A (en) * | 2019-12-31 | 2020-04-17 | 浙江工业大学 | Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application |
| CN111304235A (en) * | 2020-02-27 | 2020-06-19 | 绿康生化股份有限公司 | Bacillus licheniformis for enhancing expression of cysP and preparation method and application thereof |
| CN112063572A (en) * | 2020-09-22 | 2020-12-11 | 浙江工业大学 | Recombinant escherichia coli for high yield of O-acetyl-L-homoserine and application thereof |
| CN112779203A (en) * | 2021-01-19 | 2021-05-11 | 浙江工业大学 | Genetically engineered bacterium for high yield of L-cysteine and construction and application thereof |
| CN113388630A (en) * | 2020-03-11 | 2021-09-14 | 华东理工大学 | Construction method and application of recombinant escherichia coli for synthesizing L-cysteine |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1382684B1 (en) * | 2002-07-19 | 2005-12-07 | Consortium für elektrochemische Industrie GmbH | Process for fermentative production of amino acids and amino acid derivatives of the phosphoglycerate family |
| US20100093045A1 (en) * | 2004-03-04 | 2010-04-15 | Hiroshi Takagi | L-cysteine producing microorganism and a method for producing l-cysteine |
-
2019
- 2019-05-23 CN CN201910435397.XA patent/CN110317766B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1382684B1 (en) * | 2002-07-19 | 2005-12-07 | Consortium für elektrochemische Industrie GmbH | Process for fermentative production of amino acids and amino acid derivatives of the phosphoglycerate family |
| US20100093045A1 (en) * | 2004-03-04 | 2010-04-15 | Hiroshi Takagi | L-cysteine producing microorganism and a method for producing l-cysteine |
Non-Patent Citations (5)
| Title |
|---|
| KAWANO, YUSUKE等: "Enhancement of l-cysteine production by disruption of yciW in Escherichia coli", 《JOURNAL OF BIOSCIENCE AND BIOENGINEERING》 * |
| NAKAMORI S: "Overproduction of l-Cysteine andl-Cystine by Escherichia coli Strains with a Genetically Altered Serine Acetyltransferase", 《APPL ENVIRON MICROBIOL》 * |
| SHIMADA, TOMOHIRO等: "Transcription factor DecR (YbaO) controls detoxification of L-cysteine in Escherichia coli", 《MICROBIOLOGY-SGM 》 * |
| 刘忠: "微生物酶法转化DL-ATC合成L-半胱氨酸相关酶系研究", 《万方数据知识服务平台》 * |
| 杨帆: "利用重组大肠杆菌生产l-丝氨酸的研究", 《万方数据知识服务平台》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111019877A (en) * | 2019-12-31 | 2020-04-17 | 浙江工业大学 | Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application |
| CN111019877B (en) * | 2019-12-31 | 2022-04-19 | 浙江工业大学 | Genetically engineered bacterium for producing L-cysteine, construction method and application |
| CN111304235A (en) * | 2020-02-27 | 2020-06-19 | 绿康生化股份有限公司 | Bacillus licheniformis for enhancing expression of cysP and preparation method and application thereof |
| CN111304235B (en) * | 2020-02-27 | 2023-03-31 | 绿康生化股份有限公司 | Bacillus licheniformis for enhancing expression of cysP as well as preparation method and application thereof |
| CN113388630A (en) * | 2020-03-11 | 2021-09-14 | 华东理工大学 | Construction method and application of recombinant escherichia coli for synthesizing L-cysteine |
| CN113388630B (en) * | 2020-03-11 | 2022-07-26 | 华东理工大学 | Construction method and application of recombinant escherichia coli for synthesizing L-cysteine |
| CN112063572A (en) * | 2020-09-22 | 2020-12-11 | 浙江工业大学 | Recombinant escherichia coli for high yield of O-acetyl-L-homoserine and application thereof |
| CN112779203A (en) * | 2021-01-19 | 2021-05-11 | 浙江工业大学 | Genetically engineered bacterium for high yield of L-cysteine and construction and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110317766B (en) | 2020-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110317766A (en) | A kind of genetic engineering bacterium, construction method and the application of high yield L-cysteine | |
| CN102906272B (en) | The microorganism producing O-phosphoserine and the method using this microorganism to be produced Cys or derivatives thereof by O-phosphoserine | |
| US7790424B2 (en) | L-methionine producing microorganism and method of producing L-methionine using the microorganism | |
| JP6100370B2 (en) | Recombinant microorganism for fermentative production of methionine | |
| EP3517607B1 (en) | Novel aspartokinase mutant and method for production of l-amino acid using same | |
| CN104812906B (en) | The method for generating l-amino acid using the Enterobacteriaceae strains fermentation of improvement | |
| TWI654305B (en) | Microorganism producing o-phosphoserine and a method for producing o-phosphoserine or l-cysteine using the same | |
| US20060148041A1 (en) | Method for fermentative production of amino acids and amino acid derivatives of the phosphoglycerate family | |
| CN109055289B (en) | Recombinant escherichia coli for high yield of L-methionine and application thereof | |
| CN105886449B (en) | A kind of recombination bacillus coli and its application for producing l-methionine | |
| BRPI0903495B1 (en) | mutant microorganisms capable of producing putrescine and method for producing putrescine using the same | |
| WO2007077041A1 (en) | Process for the preparation of methionine and its precursors homoserine or succinylhomoserine employing a microorganism with enhanced sulfate permease expression | |
| CN108504613B (en) | L-homoserine production strain and construction method and application thereof | |
| CN108949661B (en) | Recombinant escherichia coli for producing O-succinyl-L-homoserine and application thereof | |
| CN111040979B (en) | Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation | |
| RU2280687C2 (en) | Microorganism cell, plasmid vector, method for creature of microorganism cell and method for preparing l-methionine | |
| JP2013509858A (en) | Method for producing L-cysteine, L-cystine, a derivative or precursor thereof, or a mixture thereof using a bacterium of Enterobacteriaceae | |
| CN109055290A (en) | A kind of recombination bacillus coli of high yield L- homoserine and its application | |
| EP3039120A1 (en) | A microorganism for methionine production with enhanced methionine efflux | |
| RU2723714C2 (en) | Method and microorganism for enzymatic production of methionine with improved output of methionine | |
| US9243268B2 (en) | Method for preparing cysteine or a derivative thereof using a novel O-phosphoserine sulfhydrylase | |
| CN112725251B (en) | Engineering bacterium for producing spermidine | |
| CN113736719A (en) | Corynebacterium glutamicum genetically engineered bacterium and application thereof in production of spermidine | |
| CN112779200B (en) | Genetically engineered bacterium for high yield of L-methionine and construction and application thereof | |
| Zhu et al. | Combining fermentation to produce O-succinyl-l-homoserine and enzyme catalysis for the synthesis of l-methionine in one pot |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |