CN109055290A - A kind of recombination bacillus coli of high yield L- homoserine and its application - Google Patents

Abstract

The invention discloses a kind of recombination bacillus coli of high yield L- homoserine and its applications, the present invention passes through first by interrupting metI to realize the partial inactivation of L-Methionine input system MetD, checks inhibiting effect secondly by negative regulation transcription factor MetJ is knocked out to release it to related gene in L- homoserine anabolism path.Expression by knocking out metB gene, which is realized, blocks O- succinyl-L- homoserine toward the biosynthesis of L-Methionine, builds L-Methionine starvation environment intracellular, and cell is quickly absorbed and utilizes the carbon sources such as glucose.Finally by the original position metL and thrA promoter sequence in Ptrc promoter replacement metabolic pathway is used, and at the same time enhancing the expression of L- homoserine outward transport albumen and having blocked the interior fortune system of L- homoserine.By the combination of the above Reconstruc-tion policy, the coli strain of high yield L- homoserine is obtained.

Description

A kind of recombination bacillus coli of high yield L- homoserine and its application

Technical field

The present invention relates to a kind of recombination bacillus coli and its fermentation method for producing of the L- homoserine of participation.

Background technique

L- homoserine serve not only as the biosynthesis such as threonine in microbial body, methionine and cystathionie it is important in Mesosome can be converted into other important chemical intermediates by enzyme reaction, such as L- homoserine is chiral herbicide L- grass ammonium Important intermediate in phosphine synthesis process.L-Methionine is the essential amino acid of biological growth, is distributed on biological cell film With L-Methionine transport associated protein, there are transportation system in two class specificity methionine of MetD and MetP, MetD in E.coli High to the affinity of methionine, MetP affinity is relatively low.And L-Methionine auxotrophic strain can be hungry to cell is caused Hungry environment forces cell to improve the uptake and utilization to carbon source in environment, such as glucose.Therefore metI is knocked out to realize L- The partial inactivation of fortune system MetD in methionine, metD operon include metN, metI and metQ, are separately encoded abc transport egg ATPase, methionine permeases, the methionine binding protein of white element.The cystathionine Gamma encoded in microbial body by metB gene O- succinyl-L- homoserine can be decomposed and generate cysteine by synzyme, and cysteine is that first sulphur is synthesized in organism The precursor of propylhomoserin, and the homoserine O-succinyl transferase of metA gene coding, are swashed by homoserine-γ-hydroxyl It lives and the acyl group of succinyl-CoA is transferred to synthesis O- succinyl-L- homoserine on homoserine, in order to make L- Kosé ammonia Acid can be accumulated largely, need to knock out metA gene.

Aspartic acid be E coli synthesis L- homoserine important precursor, while be also threonine, isoleucine, The synthesis precursor of lysine and branched-chain amino acid.Biosynthesis from aspartic acid to homoserine is needed by four-step reaction, Wherein the homoserine dehydrogenase of thrA and metL coding and aspartokinase II belong to bifunctional enzyme, in addition to asparagus fern ammonia Kinase activity, while there are also homoserine dehydrogenase activity, catalysis aspartate-semialdehyde is reduced into homoserine.thrA, The gene transcription levels such as metL, lysC, asd all by the adjusting of negative regulation transcription factor MetJ, therefore, it is necessary to metJ gene into Row knocks out.The biosynthesis of L-threonine is using L- homoserine as precursor substance, by the Kosé of thrB and thrC gene coding Histidine kinase and threonine synthetase are catalyzed to obtain, and the precursor substance that L- homoserine is synthesized as L-threonine, L- Soviet Union ammonia The synthesis of acid can consume a large amount of L- homoserine, it is therefore necessary to block or reduce the anabolism flux of L-threonine.

In addition, be responsible for L- homoserine from the outward transport factor that rhtA gene encodes to extracellular transport, and tdcC negative gene Duty absorbs the intake of L- homoserine and L-threonine etc..Therefore it needs to enhance the expression for being responsible for outward transport gene, knocks out and be responsible for The gene transported in product.

Summary of the invention

The purpose of the present invention is Escherichia coli are transformed to obtain the recombination of high yield L- homoserine by metabolic engineering means Coli strain and the application in production L- homoserine.

The technical solution adopted by the present invention is that:

The present invention provides a kind of recombination bacillus coli of high yield L- homoserine, and the recombination bacillus coli is by large intestine bar The metJ of the metI gene of coding L-Methionine transport protein, coding negative regulation repressor in bacterium (preferably Ecoli W3110) Gene, the metB gene of encoding cystathionine γ synzyme, the thrB gene of encoded homoserine kinase, encoded homoserine-O- After the tdcC gene of fortune albumen successively knocks out in the metA gene and coding L- homoserine of succinyl transferase, then respectively will The thrA gene of encoded homoserine dehydrogenase I, the metL gene of encoded homoserine dehydrogenase II and coding L- homoserine The promoter for transporting outward the rhtA gene of albumen replaces with the acquisition of Ptrc promoter.

Further, the Ptrc promoter nucleotides sequence is classified as shown in SEQ ID NO.22.

Further, the metI gene nucleotide series are shown in SEQ ID NO.1, metJ gene nucleotide series are Shown in SEQ ID NO.3, metB gene nucleotide series are shown in SEQ ID NO.5, thrB gene nucleotide series are SEQ Shown in ID NO.7, metA gene nucleotide series are shown in SEQ ID NO.9, tdcC gene nucleotide series are SEQ ID Shown in NO.11.

The present invention also provides a kind of recombination bacillus colis of high yield L- homoserine to produce in L- homoserine in fermentation Application, the application is that the recombination bacillus coli is seeded to fermentation medium, under the conditions of 30 DEG C, 180-200rpm Fermented and cultured isolates and purifies culture solution, obtains L- homoserine.

Further, the fermentation medium final concentration composition are as follows: glucose 40g/L, potassium dihydrogen phosphate 2g/L, ammonium sulfate 17g/L, yeast powder 4g/L, calcium carbonate 30g/L (for adjusting pH), L-threonine 0.2g/L, vitamin B₁0.0001g/L、 MgSO₄ 2g/L、FeSO₄ 0.005g/L、MnSO₄ 0.005g/L、ZnSO₄0.005g/L, solvent are deionized water, pH value 6.8。

Further, slant activation and seed culture are first carried out before the recombination bacillus coli fermented and cultured, by seed liquor with The inoculum concentration of volumetric concentration 5% is seeded to fermentation medium, the slant activation method are as follows: recombination bacillus coli is seeded in LB On plate, in 37 DEG C of overnight incubations, inclined-plane thalline is obtained；The seed culture method are as follows: picking inclined-plane thalline single colonie inoculation Into LB liquid medium, overnight incubation under conditions of 37 DEG C, 200rpm obtains seed liquor.

The fermented and cultured carries out in the fermenter, controls concentration of glucose 2- in fermentor by addition supplemented medium 10g/L；Fermentation condition is DO level 30%, and speed of agitator 200-600rpm, Ventilation Rate is controlled in 1-2vvm；Fermentation process Middle control cultivation temperature adjusts range of the pH 6.8~7.0 at 30 DEG C and with the ammonium hydroxide of volumetric concentration 50%.It is cultivated in fermentor Base composition are as follows: glucose 40g/L, potassium dihydrogen phosphate 2g/L, ammonium sulfate 17g/L, yeast powder 4g/L, L-threonine 0.2g/L, L- Methionine 0.2g/L, l-Isoleucine 0.2g/L, vitamin B₁ 0.0001g/L、MgSO₄ 2g/L、FeSO₄ 0.005g/L、 MnSO₄ 0.005g/L、ZnSO₄0.005g/L, solvent are deionized water, pH value 6.8；The supplemented medium composition are as follows: grape Sugared 500g/L, potassium dihydrogen phosphate 12.5g/L, L-threonine 0.2g/L, L-Methionine 0.2g/L, l-Isoleucine 0.2g/L, it is molten Agent is water.

The present invention expresses the gene of negative regulation transcription factor MetJ by knocking out in Ecoli W3110, to release it to L- Related gene (thrA, metL, lysC, asd etc.) checks inhibiting effect in homoserine anabolism path；Pass through interruption MetI is to realize the partial inactivation of L-Methionine input system MetD, and it is high to knock out metB gene disruption O- succinyl-L- The expression of metB gene in serine metabolism outlet, to reduce the content of L-Methionine intracellular to form the essential amino acid Hungry environment enables cell quickly to absorb and utilizes the carbon sources such as glucose；P is used in metabolic pathway_trcPromoter replacement The original position metL and thrA promoter sequence, to improve the expression of aspartokinase II and homoserine dehydrogenase；It strikes simultaneously Except metA gene and thrB gene in the metabolic breakdown approach of L- homoserine, to reduce L- homoserine to branch amino acid It is metabolized outlet.In addition, being responsible for the expression of the gene rhtA gene of L- homoserine outward transport by enhancing, by the product of synthesis intracellular It is transported to the tdcC gene extracellular, the responsible L- homoserine of knockout absorbs, in time to realize the mesh of extracellular accumulation L- homoserine 's.By the combination by the above Reconstruc-tion policy, the recombinant escherichia coli strain of high yield L- homoserine is had successfully been obtained in the present invention.

Compared with prior art, the beneficial effects are mainly reflected as follows:

The present invention provides a kind of recombination bacillus coli of high yield L- homoserine using metabolic engineering, by transformation Recombination bacillus coli afterwards can preferably carry out the life of L- homoserine compared to wild type using carbon source materials such as glucose It produces, the bacterial strain of best performance is in the horizontal bacterial strain compared to wild type of fermenting and producing L- homoserine from 0g/L after transformation It is increased to 11.2g/L.L- homoserine can be transported to extracellular and gradually accumulate in the environment by recombination bacillus coli of the present invention, The method that can maintain L-Methionine content intracellular preferably suitably to maintain essential amino acid starvation environment intracellular, and before this The industrial important compound of body production.

Specific embodiment

Below with reference to specific example, the present invention will be further described in detail, but the present invention is not limited to following implementations Example.

Experimental method in following embodiments is unless otherwise specified conventional method.

Test material as used in the following examples is unless otherwise specified conventional biochemical reagent.It is used herein " hungry environment " refer to maintaining the L-Methionine of low concentration intracellular.Term " enhancing " refers to increasing by corresponding multicore The activity of the enzyme of thuja acid coding.It (can be opened by the expression regulation sequence of the gene in the overexpression or replacement gene group of gene Mover replacement etc.).

LB liquid medium composition: peptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, solvent are deionized water, pH It is worth nature.

LB plate is the addition final concentration 2g/L agar in LB liquid medium.

Embodiment 1 is based on the Metabolically engineered of Wild type E. coli strain

(1) knockout of metI gene

For the partial inactivation for blocking metI to realize L-Methionine input system MetD, it is made to reduce taking the photograph for L-Methionine Enter to reduce the concentration of L-Methionine intracellular, therefore the metI gene in wild-type strain is knocked out, referring to Jiang Y,Chen B,Duan C,et al.Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9System[J].Applied&Environmental Microbiology,2015,81(7):2506.。

(large intestine is purchased from by CRISPR-Cas9 system editor wild-type e. coli (Escherichia coli) W3110 Bacillus genetic breeding center The Coli Genetic Stock Center) L-Methionine transportation system is encoded in genome MetI gene (nucleotides sequence is classified as shown in SEQ ID NO.1), specifically: primer 1 and primer 2 are used by PCR, with PTargetF carrier is template, and the pTarget- Δ metI mutation that building can express the sgRNA for targeting target gene metI carries Body.PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C after reneing Stretch 10min.By PCR product with Dpn I in 37 DEG C of processing 3h, conversion is applied into E.coli BL21 (DE3) recipient bacterium after inactivation It is distributed on the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h.Random picking single colonie turns It is connected in the LB liquid medium of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h, collects thallus and extracts Plasmid obtains pTarget- Δ metI carrier.

Primer 3 and primer 4 are used by PCR, using Escherichia coli Escherichia coli W3110 genome as template Amplification obtains metI upstream region of gene homologous fragment, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C 30s repeats 30 circulations；72 DEG C are continued to extend 10min.MetI base is obtained using primer 5 and the amplification of primer 6 in the same way Because of downstream homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.By the two of recycling A DNA fragmentation carries out fusion DNA vaccine using primer 3 and primer 6, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, and PCR product is detected with 1.0% agarose gel electrophoresis And gel extraction purifies the segment (nucleotides sequence is classified as shown in SEQ ID NO.2).By pTarget- Δ metI carrier and recycling DNA fragmentation together electrotransformation to the Escherichia coli W3110 bacterial strain containing pCas9 carrier.

For electroporation, conversion has the Escherichia coli W3110 bacterial strain of pCas9 carrier containing 50mg/L's Cultivated at 30 DEG C in the LB culture medium of kanamycins and 10mM L-arabinose, until OD600 reaches 0.6, bacterium solution pass through from Gains in depth of comprehension are to thallus.Thallus is washed twice using sterile distilled water, then washed once using 10% glycerol to use.Electricity is worn Hole is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 7 and primer 8, and by observing There are the missings of the DNA band of 1000bp confirmation metI gene in 1.0% Ago-Gel.The bacterial strain confirmed by this is existed In the LB culture medium of kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ MetI carrier.Then will have been removed the bacterial strain of pTarget- Δ metI carrier in LB culture medium at 37 DEG C overnight incubation with Remove pCas carrier.The bacterial strain so constructed is denoted as Escherichia coli W3110 Δ metI.

1 the primer sequence of table

Primer 1	TAATACTAGTCTACATCGGCTATAACGCGAGTTTTAGAGCTAGAAATAGC
		Primer 2	GCTCTAAAACTCGCGTTATAGCCGATGTAGACTAGTATTATACCTAGGAC
Primer 3	GACACGTTCTATTCTCGAAC
		Primer 4	GTGTTGAACGAACCCAGTACCTCTACTTTT
Primer 5	GTACTGGGTTCGTTCAACACAACATAAATA
		Primer 6	AAGCCCACTTTTTGCAGCAG
Primer 7	TACTGTTTTTGGCAACGTGG
		Primer 8	TGGACGAATTTCTTCACGTT

(2) knockout of metJ gene

Suppression is checked in order to remove negative regulation transcription factor MetJ to gene transcription levels such as thrA, metL, lysC, asd Production is used, and is knocked out to the metJ gene in Escherichia coli W3110 Δ metI bacterial strain.

By encoding negative regulation transcription factor in CRISPR-Cas9 system editor's W3110 Δ metI strain gene group MetJ gene (nucleotides sequence is classified as shown in SEQ ID NO.3).Primer 9 and primer 10 are used by PCR, with pTargetF carrier The pTarget- Δ metJ mutational vector for the sgRNA for targeting target gene metJ can be expressed as template building.PCR reacts item Part is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C are continued to extend 10min.By PCR Product is with DpnI in 37 DEG C of processing 3h, and conversion is coated on into E.coli BL21 (DE3) recipient bacterium containing final concentration after inactivation On the LB solid plate of 50mg/L spectinomycin hydrochloride resistance, 37 DEG C of culture 12h.Random picking single colonie is forwarded to containing final concentration In the LB liquid medium of 50mg/L spectinomycin hydrochloride resistance, 37 DEG C of culture 12h collect thallus and extract plasmid acquisition PTarget- Δ metJ carrier.

Primer 11 and primer 12 are used by PCR, using Escherichia coli Escherichia coli W3110 genome as mould Plate expands to obtain metJ upstream region of gene homologous fragment, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C 30s repeats 30 circulations；72 DEG C are continued to extend 10min.MetI is obtained using primer 13 and the amplification of primer 14 in the same way Downstream of gene homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.By recycling Two DNA fragmentations carry out fusion DNA vaccine using primer 11 and primer 14, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, and PCR product is examined with 1.0% agarose gel electrophoresis It surveys and gel extraction purifies the segment (nucleotides sequence is classified as shown in SEQ ID NO.4).By pTarget- Δ metJ carrier and return The DNA fragmentation of receipts together electrotransformation to the W3110 Δ metI bacterial strain containing pCas9 carrier.

For electroporation, conversion have the W3110 Δ metI bacterial strain of pCas9 carrier in the kanamycins containing 50mg/L and It is cultivated at 30 DEG C in the LB culture medium of 10mM L-arabinose, until OD600 reaches 0.6, bacterium solution obtains bacterium by centrifugation Body.Thallus is washed twice using sterile distilled water, then washed once using 10% glycerol to use.Electroporation exists It is carried out under 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 15 and primer 16, and passes through observation To in 1.0% Ago-Gel, there are the missings of the DNA band of 1000bp confirmation metJ gene.The bacterial strain that will be confirmed by this In the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ MetJ carrier.Then will have been removed the bacterial strain of pTarget- Δ metJ carrier in LB culture medium at 37 DEG C overnight incubation with Remove pCas carrier.The bacterial strain so constructed is denoted as W3110 Δ metI Δ metJ.

2 primer sequence of table

Primer 9	TAATACTAGTATCTGCGTAAAGAGCGCAGCGTTTTAGAGCTAGAAATAGC
		Primer 10	GCTCTAAAACGCTGCGCTCTTTACGCAGATACTAGTATTATACCTAGGAC
Primer 11	ATGCCGGTATTAGTAAGTAC
		Primer 12	CTTTTTTGCTGAGATACTTAATCCTCTTCG
Primer 13	TAAGTATCTCAGCAAAAAAGAGCGGCGCGG
		Primer 14	TTTTGCCGTTTGCGCCAGTT
Primer 15	GTACCAGTTTGGGTTTTTCT
		Primer 16	GAATATTCTTGCCGTAACGT

(3) knockout of metB gene

In order to block the katabolism path of O- succinyl-L- homoserine, the cystathionine Gamma by knocking out coding is synthesized The metB gene of enzyme destroys the process of O- succinyl-L- homoserine catabolism synthesis cysteine, further controls born of the same parents The suitable concentration of interior L-Methionine, therefore metB gene is implemented to knock out in W3110 Δ metI Δ metJ strain.

It is synthesized by encoding cystathionine γ in CRISPR-Cas9 system editor's W3110 Δ metI Δ metJ strain gene group The metB gene of enzyme.Target can be expressed as template building using primer 17 and primer 18 and pTargetF carrier by PCR Determine the pTarget- Δ metB mutational vector of the sgRNA of target gene metB (nucleotides sequence is classified as shown in SEQ ID NO.5). PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C are continued to extend 10min.By PCR product with DpnI in 37 DEG C of processing 3h, conversion is coated on into E.coli BL21 (DE3) recipient bacterium after inactivation On the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h.Random picking single colonie is forwarded to In the LB liquid medium of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h collect thallus and extract plasmid Obtain pTarget- Δ metB carrier.

Primer 19 and primer 20 are used by PCR, is obtained using the genome of W3110 Δ metI Δ metJ bacterial strain as template amplification To metB upstream region of gene homologous fragment, PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s are repeated 30 circulations；72 DEG C are continued to extend 10min.MetB downstream of gene is obtained using primer 21 and the amplification of primer 22 in the same way Homologous fragment, with the detection of 1.0% agarose gel electrophoresis, simultaneously (nucleotides sequence is classified as SEQ to gel extraction purified fragments to PCR product Shown in ID NO.6).Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using primer 19 and primer 22, PCR reaction condition is such as Under: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, and PCR product is used Simultaneously gel extraction purifies the segment to the detection of 1.0% agarose gel electrophoresis.By the DNA piece of pTarget- Δ metB carrier and recycling The Duan Yitong electrotransformation extremely W3110 Δ metI Δ metJ bacterial strain containing pCas9 carrier.

For electroporation, conversion has the W3110 Δ metI Δ metJ bacterial strain of pCas9 carrier, and in the card containing 50mg/L, that is mould It is cultivated at 30 DEG C in the LB culture medium of element and 10mM L-arabinose, until OD600 reaches 0.6, bacterium solution is obtained by centrifugation Thallus.Thallus is washed twice using sterile distilled water, then washed once using 10% glycerol to use.Electroporation exists It is carried out under 2.5KV.The spectinomycin hydrochloride that bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and 50mg/L is resisted On the LB plate of property, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 23 and primer 24, and passes through Observe that there are the missings of the DNA band of 1000bp confirmation metB gene in 1.0% Ago-Gel.By what is confirmed by this Bacterial strain in the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove PTarget- Δ metB carrier.Then the bacterial strain of pTarget- Δ metB carrier will be had been removed in LB culture medium at 37 DEG C Overnight incubation is to remove pCas carrier.The bacterial strain so constructed is denoted as W3110 Δ metI Δ metJ Δ metB.

3 primer sequence of table

Primer 17	TAATACTAGTTTCGACAGTCTGGCGAAACGGTTTTAGAGCTAGAAATAGC
		Primer 18	GCTCTAAAACCGTTTCGCCAGACTGTCGAAACTAGTATTATACCTAGGAC
Primer 19	GCTTTACTTTGCGATGAGCG
		Primer 20	ACACTCATTTGTGATGAAGTTCCCTGGGCT
Primer 21	ACTTCATCACAAATGAGTGTGATTGCGCAG
		Primer 22	CAGCTGTTGCAGCAACGGGT
Primer 23	TGAGCGGGGTGTATTTCACC
		Primer 24	ATTTGTGTCGCGGAATAGTC

(4) knockout of thrB gene

In order to increase the accumulation of L- homoserine, need to block the metabolism outlet of L- homoserine, and L- Kosé intracellular The homoserine kinase and threonine synthetase metabolism synthesis L-threonine that propylhomoserin is encoded by thrB gene and thrC gene.Cause This, knocks out the thrB gene in W3110 Δ metI Δ metJ Δ metB bacterial strain.

By CRISPR-Cas9 system to encoded homoserine in W3110 Δ metI Δ metJ Δ metB strain gene group The thrB gene of kinases is edited.It is constructed using primer 25 and primer 26 and pTargetF carrier as template by PCR The pTarget- Δ thrB for targeting the sgRNA of target gene thrB (nucleotides sequence is classified as shown in SEQ ID NO.7) can be expressed Mutational vector.PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72℃ Continue to extend 10min.PCR product is converted after inactivation to E.coli BL21 (DE3) recipient bacterium with DpnI in 37 DEG C of processing 3h In, it is coated on the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h.Random picking list Bacterium colony is forwarded in the LB liquid medium of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h, collects thallus And it extracts plasmid and obtains pTarget- Δ thrB carrier.

Primer 27 and primer 28 are used by PCR, using the genome of W3110 Δ metI Δ metJ Δ metB bacterial strain as template Amplification obtains thrB upstream region of gene homologous fragment, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C 30s repeats 30 circulations；72 DEG C are continued to extend 10min.ThrB is obtained using primer 29 and the amplification of primer 30 in the same way Downstream of gene homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.By recycling Two DNA fragmentations carry out fusion DNA vaccine using primer 27 and primer 30, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, and PCR product is examined with 0.9% agarose gel electrophoresis It surveys and gel extraction purifies the segment (nucleotides sequence is classified as shown in SEQ ID NO.8).By pTarget- Δ thrB carrier and return The DNA fragmentation of receipts together electrotransformation to the W3110 Δ metI Δ metJ Δ metB bacterial strain containing pCas9 carrier.

For electroporation, conversion has the W3110 Δ metI Δ metJ Δ metB bacterial strain of pCas9 carrier containing 50mg/L's Cultivated at 30 DEG C in the LB culture medium of kanamycins and 10mM L-arabinose, until OD600 reaches 0.6, bacterium solution pass through from Gains in depth of comprehension are to thallus.Thallus is washed twice using sterile distilled water, then washed once using 10% glycerol to use.Electricity is worn Hole is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 31 and primer 32, and passes through observation To in 1.0% Ago-Gel, there are the missings of the DNA band of 1000bp confirmation thrB gene.The bacterial strain that will be confirmed by this In the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ ThrB carrier.Then will have been removed the bacterial strain of pTarget- Δ thrB carrier in LB culture medium at 37 DEG C overnight incubation with Remove pCas carrier.The bacterial strain so constructed is denoted as W3110 Δ metI Δ metJ Δ metB Δ thrB.

4 primer sequence of table

Primer 25	TAATACTAGTATAAGCTGCCGTCAGAACCAGTTTTAGAGCTAGAAATAGC
		Primer 26	GCTCTAAAACTGGTTCTGACGGCAGCTTATACTAGTATTATACCTAGGAC
Primer 27	TGCTCAATGCAGGTGATGAA
		Primer 28	AGAGTTTCATGTCAGACTCCTAACTTCCAT
Primer 29	GGAGTCTGACATGAAACTCTACAATCTGAA
		Primer 30	TTCATCATCAAACGCCTGCT
Primer 31	GTTGTCACGCCGAACAAAAA
		Primer 32	ACCGAGACAACCAGCTGGTT

(5) knockout of metA gene

The biosynthesis of L- homoserine in order to further increase needs to block an other metabolism for L- homoserine to go Road, i.e., L- homoserine intracellular shift Enzyme catalyzed synthesis O- amber by the homoserine O-succinyl of metA gene coding Acyl-L- homoserine.Therefore, the metA gene in W3110 Δ metI Δ metJ Δ metB Δ thrB bacterial strain is knocked out.

It is high to being encoded in W3110 Δ metI Δ metJ Δ metB Δ thrB strain gene group by CRISPR-Cas9 system The metA gene of serine O- succinyl transferase is edited.Primer 33 and primer 34 are used by PCR, and PTargetF carrier can express as template building and target target gene metA (nucleotides sequence is classified as shown in SEQ ID NO.9) SgRNA pTarget- Δ metA mutational vector.PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C 2min repeats 30 circulations；72 DEG C are continued to extend 10min.By PCR product with DpnI in 37 DEG C of processing 3h, converted after inactivation to In E.coli BL21 (DE3) recipient bacterium, it is coated on the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h.Random picking single colonie is forwarded to the LB liquid medium of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration In, 37 DEG C of culture 12h collect thallus and extract plasmid acquisition pTarget- Δ metA carrier.

Primer 35 and primer 36 are used by PCR, with the genome of W3110 Δ metI Δ metJ Δ metB Δ thrB bacterial strain MetA upstream region of gene homologous fragment is obtained for template amplification, PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s repeat 30 circulations；72 DEG C are continued to extend 10min.It is obtained in the same way using primer 37 and the amplification of primer 38 MetA downstream of gene homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments (nucleosides Acid sequence is shown in SEQ ID NO.10).Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using primer 35 and primer 38, PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, PCR product is detected with 0.9% agarose gel electrophoresis and gel extraction purifies the segment.PTarget- Δ metA is carried Body and the DNA fragmentation of recycling together electrotransformation to the W3110 Δ metI Δ metJ Δ metB Δ thrB bacterium containing pCas9 carrier Strain,.

For electroporation, conversion has the W3110 Δ metI Δ metJ Δ metB Δ thrB bacterial strain of pCas9 carrier containing It is cultivated at 30 DEG C in the kanamycins of 50mg/L and the LB culture medium of 10mM L-arabinose, until OD reaches 0.6, bacterium solution Thallus is obtained by centrifugation.Thallus is washed twice using sterile distilled water, then washed once using 10% glycerol to make With.Electroporation is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 39 and primer 40, and passes through observation To in 1.0% Ago-Gel, there are the missings of the DNA band of 1600bp confirmation metA gene.The bacterial strain that will be confirmed by this In the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ MetA carrier.Then will have been removed the bacterial strain of pTarget- Δ metA carrier in LB culture medium at 37 DEG C overnight incubation with Remove pCas carrier.The bacterial strain so constructed is denoted as W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA.

5 primer sequence of table

Primer 33	TAATACTAGTCTGGGCCTGGTGGAGTTTAAGTTTTAGAGCTAGAAATAGC
		Primer 34	GCTCTAAAACTTAAACTCCACCAGGCCCAGACTAGTATTATACCTAGGAC
Primer 35	ATGAGAAAAAATCGCCTACG
		Primer 36	TCACAGAAGAAACCTGATTACCTCACTACA
Primer 37	TAATCAGGTTTCTTCTGTGATAGTCGATCG
		Primer 38	ATAAAGACTTTCACATTGGC
Primer 39	TTGTCACAGGTTGAGGAACG
		Primer 40	TGACATGTTTTTCCGGCAAG

(6) knockout of tdcC gene

In order to prevent cell from reuptaking intake to L- homoserine of the secretion into extracellular environment, to increase extracellular L- high The accumulation of serine needs to block the expression of fortune gene in responsible L- homoserine, i.e., the tdcC gene of fortune albumen in coding.Cause This, knocks out the tdcC gene in W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA bacterial strain.

By CRISPR-Cas9 system in W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA strain gene group Fortune albumen correlation tdcC gene is edited in coding L- homoserine.Primer 41 and primer 42 are used by PCR, and PTargetF carrier can express as template building and target target gene tdcC (nucleotides sequence be classified as SEQ ID NO.11 institute Show) sgRNA pTarget- Δ tdcC mutational vector.PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C are continued to extend 10min.By PCR product with DpnI in 37 DEG C of processing 3h, turn after inactivation Change into E.coli BL21 (DE3) recipient bacterium, is coated on the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration On, 37 DEG C of culture 12h.Random picking single colonie is forwarded to the LB Liquid Culture of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration In base, 37 DEG C of culture 12h collect thallus and extract plasmid acquisition pTarget- Δ tdcC carrier.

Primer 43 and primer 44 are used by PCR, with W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA bacterial strain Genome is that template amplification obtains tdcC upstream region of gene homologous fragment, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C 30s, 72 DEG C of 30s repeat 30 circulations；72 DEG C are continued to extend 10min.Expanded in the same way using primer 45 and primer 46 Increasing obtains tdcC downstream of gene homologous fragment, and PCR product, which detects simultaneously gel extraction with 1.0% agarose gel electrophoresis, purifies piece Section.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using primer 43 and primer 46, PCR reaction condition is as follows: 95 DEG C of 5min； 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, 0.9% agarose of PCR product Simultaneously gel extraction purifies the segment to detected through gel electrophoresis (nucleotides sequence is classified as shown in SEQ ID NO.12).By pTarget- Δ TdcC carrier and the DNA fragmentation of recycling together electrotransformation to the W3110 Δ metI Δ metJ Δ metB Δ containing pCas9 carrier ThrB Δ metA bacterial strain.

For electroporation, conversion has the W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA bacterial strain of pCas9 carrier to exist It is cultivated at 30 DEG C in the LB culture medium of kanamycins containing 50mg/L and 10mM L-arabinose, until OD reaches 0.6, Bacterium solution obtains thallus by centrifugation.Thallus is washed twice using sterile distilled water, then using 10% glycerol washed once with Just it uses.Electroporation is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 47 and primer 48, and passes through observation To in 1.0% Ago-Gel, there are the missings of the DNA band of 1400bp confirmation tdcC gene.The bacterial strain that will be confirmed by this In the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG at 30 DEG C overnight incubation to remove pTarget- Δ TdcC carrier.Then will have been removed the bacterial strain of pTarget- Δ tdcC carrier in LB culture medium at 37 DEG C overnight incubation with Remove pCas carrier.The bacterial strain so constructed is denoted as W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC.

6 primer sequence of table

Embodiment 2 is Metabolically engineered based on W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC bacterial strain

(1) enhancing of metL gene expression

The enzyme of metL gene coding be also with aspartokinase II and homoserine dehydrogenase II bifunctional enzyme activity, In the metabolism of L-Aspartic acid, metL and thrA gene plays similar effect, therefore will also be replaced with trc promoter sequence Original promoter sequence in metL gene (nucleotides sequence is classified as shown in SEQ ID NO.13) is to reach enhancing metL gene table The purpose reached.

Pass through CRISPR-Cas9 system editor's W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC bacterial strain The promoter sequence of the metL gene of encoded homoserine dehydrogenase in genome.Primer 49 and primer 50 are used by PCR, with And pTargetF carrier can express the pTarget- for the sgRNA for targeting target gene metL promoter sequence as template building Δ PmetL::Ptrc mutational vector.PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min are repeated 30 circulations；72 DEG C are continued to extend 10min.PCR product is converted after inactivation to E.coli with DpnI in 37 DEG C of processing 3h It in BL21 (DE3) recipient bacterium, is coated on the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of cultures 12h.Random picking single colonie is forwarded in the LB liquid medium of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of trainings 12h is supported, thallus is collected and extracts plasmid acquisition pTarget- Δ PmetL::Ptrc carrier.

Primer 51 and primer 52 are used by PCR, with W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC The genome of bacterial strain is that template amplification obtains metL gene promoter sequence upstream homologous fragment, the promoter sequence of metL gene Information is based on (the EcoCyc gene accession number: EG10590, nucleosides obtained in Ecocyc E.coli Database database Acid sequence is shown in SEQ ID NO.19), PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, weight Multiple 30 circulations；72 DEG C are continued to extend 10min.It obtains metL gene using primer 53 and the amplification of primer 54 in the same way and opens Promoter sequences downstream homologous fragment, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purified fragments.It will return Two DNA fragmentations received carry out fusion DNA vaccine using the primer of primer 51 and primer 54, and PCR reaction condition is as follows: 95 DEG C of 5min； 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, 1.0% agarose of PCR product Detected through gel electrophoresis and gel extraction purify the segment (nucleotides sequence is classified as shown in SEQ ID NO.14), in the gene band Ptrc promoter sequence (nucleotides sequence is classified as shown in SEQ ID NO.22) is inserted between two homologous fragments.By pTarget- Δ PmetL::Ptrc carrier and the DNA fragmentation of recycling together electrotransformation to the W3110 Δ metI Δ metJ containing pCas9 carrier Δ metB Δ thrB Δ metA Δ tdcC bacterial strain.

For electroporation, conversion has the W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC of pCas9 carrier Bacterial strain is cultivated at 30 DEG C in the LB culture medium of the kanamycins containing 50mg/L and 10mM L-arabinose, until OD600 Reach 0.6, bacterium solution obtains thallus by centrifugation.Thallus is washed twice using sterile distilled water, is then washed using 10% glycerol It washs once to use.Electroporation is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 55 and primer 56, and passes through observation To there are the original promoter sequences of the DNA band of 700bp confirmation metL gene have been opened by Ptrc in 1.0% Ago-Gel Promoter sequences replacement.By the bacterial strain confirmed by this in the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG Overnight incubation is at 30 DEG C to remove pTarget- Δ PmetL::Ptrc carrier.Then pTarget- Δ PmetL: will be had been removed: The bacterial strain of Ptrc carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.By the bacterium after removal pCas carrier Strain carries out PCR amplification using primer 55 and primer 54, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C 1min15s repeats 30 circulations；72 DEG C are continued to extend 10min, PCR product are carried out sequence verification, sequencing result passes through The promoter sequence in situ of BLAST sequence alignment confirmation metL gene is successfully replaced by Ptrc promoter.The bacterial strain of building is remembered For W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC-metL (trc).

7 primer sequence of table

(2) enhancing of thrA gene expression

The enzyme of thrA gene coding has aspartokinase I and homoserine dehydrogenase I bifunctional enzyme activity, in order to make More carbon sources are flowed to L- homoserine into the main path metabolic process of L- homoserine by L-Aspartic acid, will be opened with trc Original promoter sequence in promoter sequences replacement thrA gene is to achieve the purpose that enhance thrA gene expression.

Pass through CRISPR-Cas9 system editor's W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC

(nucleotides sequence is classified as SEQ ID to the thrA gene of encoded homoserine dehydrogenase in-metL (trc) strain gene group Shown in NO.15) promoter sequence.Primer 57 and primer 58 are used by PCR, energy is constructed using pTargetF carrier as template Enough expression target the pTarget- Δ PthrA::Ptrc mutational vector of the sgRNA of target gene thrA promoter sequence.PCR is anti- Answer condition as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C are continued to extend 10min. By PCR product with DpnI in 37 DEG C of processing 3h, conversion is coated on into E.coli BL21 (DE3) recipient bacterium containing dense eventually after inactivation It spends on the LB solid plate of 50mg/L spectinomycin hydrochloride resistance, 37 DEG C of culture 12h.Random picking single colonie is forwarded to containing dense eventually It spends in the LB liquid medium of 50mg/L spectinomycin hydrochloride resistance, 37 DEG C of culture 12h, collect thallus and extracts plasmid acquisition PTarget- Δ PthrA::Ptrc carrier.

Primer 59 and primer 60 are used by PCR, with W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC

The genome of-metL (trc) bacterial strain is that template amplification obtains thrA gene promoter sequence upstream homologous fragment, The promoter sequence information of thrA gene is based on (the EcoCyc gene obtained in Ecocyc E.coli Database database Registration number: EG10998, nucleotides sequence are classified as shown in SEQ ID NO.20), PCR reaction condition is as follows: 95 DEG C of 5min；95℃ 30s, 55 DEG C of 30s, 72 DEG C of 30s repeat 30 circulations；72 DEG C are continued to extend 10min.In the same way using primer 61 and drawing The amplification of object 62 obtains thrA gene promoter sequence downstream homologous fragment, and PCR product is detected simultaneously with 1.0% agarose gel electrophoresis Gel extraction purified fragments.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using the primer of primer 59 and primer 62, PCR is anti- Answer condition as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purifies the segment (nucleotides sequence is classified as SEQ ID NO.16 It is shown), it is same that Ptrc promoter sequence (nucleotides sequence is classified as shown in SEQ ID NO.22) has been inserted into two in the gene band Between the segment of source.By pTarget- Δ PthrA::Ptrc carrier and the DNA fragmentation of recycling together electrotransformation to contain pCas9 carry W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC-metL (trc) bacterial strain of body.

For electroporation, conversion has the W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC of pCas9 carrier

- metL (trc) bacterial strain is in the LB culture medium of the kanamycins containing 50mg/L and 10mM L-arabinose 30 It is cultivated at DEG C, until OD600 reaches 0.6, bacterium solution obtains thallus by centrifugation.Thallus is washed twice using sterile distilled water, so It is washed once using 10% glycerol afterwards to use.Electroporation is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 63 and primer 64, and passes through observation To there are the original promoter sequences of the DNA band of 700bp confirmation thrA gene have been opened by Ptrc in 1.0% Ago-Gel Promoter sequences replacement.By the bacterial strain confirmed by this in the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG Overnight incubation is at 30 DEG C to remove pTarget- Δ PthrA::Ptrc carrier.Then pTarget- Δ PthrA: will be had been removed: The bacterial strain of Ptrc carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.By the bacterium after removal pCas carrier Strain carries out PCR amplification using primer 63 and primer 62, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C 1min 15s repeats 30 circulations；72 DEG C are continued to extend 10min, PCR product are carried out sequence verification, sequencing result passes through The promoter sequence in situ of BLAST sequence alignment confirmation thrA gene is successfully replaced by Ptrc promoter.The bacterium so constructed Strain is denoted as W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC-metL-thrA (trc).

8 primer sequence of table

(3) enhancing of rhtA gene expression

Even if rhtA gene encodes the outward transport of L- homoserine, albumen can be effective by the L- homoserine product of synthesis intracellular Ground is transported to extracellular, the accumulation of L- homoserine intracellular and the burden of high concentration product is alleviated, in order to realize L- homoserine More effective extracellular transport strategy will be increased with the original promoter sequence in trc promoter sequence replacement rhtA gene with reaching The purpose of strong rhtA gene expression.

Pass through CRISPR-Cas9 system editor's W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC- (nucleotides sequence is classified as SEQ ID to the rhtA gene of encoded homoserine dehydrogenase in metL-thrA (trc) strain gene group Shown in NO.17) promoter sequence.It is constructed using primer 65 and primer 66 and pTargetF carrier as template by PCR The pTarget- Δ PrhtA::Ptrc mutational vector for targeting the sgRNA of target gene thrA promoter sequence can be expressed.PCR Reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 2min repeat 30 circulations；72 DEG C are continued to extend 10min.By PCR product with DpnI in 37 DEG C of processing 3h, conversion is coated on into E.coli BL21 (DE3) recipient bacterium after inactivation On the LB solid plate of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h.Random picking single colonie is forwarded to In the LB liquid medium of the spectinomycin hydrochloride resistance of 50mg/L containing final concentration, 37 DEG C of culture 12h collect thallus and extract plasmid Obtain pTarget- Δ PrhtA::Ptrc carrier.

Primer 67 and primer 68 are used by PCR, with W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ The genome of tdcC-metL-thrA (trc) bacterial strain is that template amplification obtains rhtA gene promoter sequence upstream homologous fragment, The promoter sequence information of rhtA gene is based on Ecocyc E._c(the EcoCyc gene obtained in oli Database database Registration number: EG10998, nucleotides sequence are classified as shown in SEQ ID NO.21), PCR reaction condition is as follows: 95 DEG C 5_min；95℃ 30s, 55 DEG C of 30s, 72 DEG C of 30s repeat 30 circulations；72 DEG C are continued to extend 10min.In the same way using primer 69 and drawing The amplification of object 70 obtains rhtA gene promoter sequence downstream homologous fragment, and PCR product is detected simultaneously with 1.0% agarose gel electrophoresis Gel extraction purified fragments.Two DNA fragmentations of recycling are subjected to fusion DNA vaccine using the primer of primer 71 and primer 72, PCR is anti- Answer condition as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min repeat 30 circulations；72 DEG C are continued to extend 10min, PCR product is detected with 1.0% agarose gel electrophoresis and gel extraction purifies the segment (nucleotides sequence is classified as SEQ ID NO.18 It is shown), it is same that Ptrc promoter sequence (nucleotides sequence is classified as shown in SEQ ID NO.22) has been inserted into two in the gene band Between the segment of source.By pTarget- Δ PrhtA::Ptrc carrier and the DNA fragmentation of recycling together electrotransformation to W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC-metL-thrA (trc) bacterial strain, it is inverted to have pCas9 carrier.

For electroporation, conversion has the W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ of pCas9 carrier TdcC-metL-thrA (trc) bacterial strain in the LB culture medium of the kanamycins containing 50mg/L and 10mM L-arabinose It is cultivated at 30 DEG C, until OD600 reaches 0.6, bacterium solution obtains thallus by centrifugation.Thallus is washed twice using sterile distilled water, Then it washed once using 10% glycerol to use.Electroporation is carried out at 2.5KV.

Bacterium solution after electrotransformation is applied to the kanamycins containing 50mg/L and the spectinomycin hydrochloride resistance of 50mg/L On LB plate, 30 DEG C of overnight incubations.Picking single colonie carries out PCR as template, with primer 71 and primer 70, and passes through observation To there are the original promoter sequences of the DNA band of 700bp confirmation rhtA gene have been opened by Ptrc in 1.0% Ago-Gel Promoter sequences replacement.By the bacterial strain confirmed by this in the LB culture medium of the kanamycins containing 50mg/L and 5mM IPTG Overnight incubation is at 30 DEG C to remove pTarget- Δ PrhtA::Ptrc carrier.Then pTarget- Δ PrhtA: will be had been removed: The bacterial strain of Ptrc carrier in LB culture medium at 37 DEG C overnight incubation to remove pCas carrier.By the bacterium after removal pCas carrier Strain carries out PCR amplification using primer 63 and primer 62, and PCR reaction condition is as follows: 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C 1min 15s repeats 30 circulations；72 DEG C are continued to extend 10min, PCR product are carried out sequence verification, sequencing result passes through The promoter sequence in situ of BLAST sequence alignment confirmation rhtA gene is successfully replaced by Ptrc promoter.The bacterium so constructed Strain is denoted as W3110 Δ metI Δ metJ Δ metB Δ thrB Δ metA Δ tdcC-metL-thrA-rhtA (trc).

9 primer sequence of table

The experiment of 3 shake flask fermentation of embodiment

Fermenting experiment test is carried out in shaking flask to above-mentioned thallus, to produce L- Kosé ammonia between more each genotype strain The ability of acid.Shake flask fermentation experiment is carried out by following scheme: on LB plate by each bacterial strain streak inoculation, in 37 DEG C of incubators Middle overnight incubation, picking single colonie are seeded in the LB culture medium of 5ml, and are trained in 37 DEG C of incubators with the revolving speed of 200rpm It supports overnight, obtains seed liquor.

The fermentation medium of 20ml is added in the shaking flask of 500ml, and the seed liquor of every kind of bacterial strain of 1ml is seeded to fermentation In culture medium.Then it is cultivated 48 hours in 30 DEG C of incubator with the revolving speed of 180rpm, 1ml liquid is taken from shaking flask, with super Pure water dilutes 100 times, detects the content of L- homoserine in fermentation liquid after filter membrane by amino-acid analyzer, final ratio is less The amount of homogenic type bacterial strain acquisition L- homoserine.As a result as shown in the experiment of the Metabolically engineered bacterial strain shake flask fermentation of table 10.Fermentation training Support base final concentration composition are as follows: glucose 40g/L, potassium dihydrogen phosphate 2g/L, ammonium sulfate 17g/L, yeast powder 4g/L, calcium carbonate 30g/ L, L-threonine 0.2g/L, l-Isoleucine 0.2g/L, vitamin B₁ 0.0001g/L、MgSO₄ 2g/L、FeSO₄ 0.005g/ L、MnSO₄ 0.005g/L、ZnSO₄0.005g/L, solvent are deionized water, pH value 6.8.

Each bacterial strain shake flask fermentation result of table 10

Bacterial strain	L- homoserine (g/L)
		W3110	0
W3110ΔmetI	0
		W3110ΔmetIΔmetJ	0
W3110ΔmetIΔmetJΔmetB	2.1
		W3110ΔmetIΔmetJΔmetBΔthrB	3.8
W3110ΔmetIΔmetJΔmetBΔthrBΔmetA	5.7
		W3110ΔmetIΔmetJΔmetBΔthrBΔmetAΔtdcC	6.5
W3110ΔmetIΔmetJΔmetBΔthrBΔmetAΔtdcC-metL(trc)	8.1
		W3110ΔmetIΔmetJΔmetBΔthrBΔmetAΔtdcC-metL-thrA(trc)	9.3
W3110ΔmetIΔmetJΔmetBΔthrBΔmetAΔtdcC-metL-thrA-rhtA(trc)	11.2//L

According to table 10 it is found that by Metabolically engineered W3110 Δ metI Δ metJ Δ metB Δ thrB Δ tdcC-metL- ThrA-rhtA (trc) bacterial strain is compared without carrying exogenous plasmid and with production and in the ability of extracellular accumulation L- homoserine The production of L- homoserine can be preferably carried out using carbon source materials such as glucose in wild type.The best performance after transformation Bacterial strain be increased to 11.2g/L from 0g/L in the horizontal bacterial strain compared to wild type of fermenting and producing L- homoserine.Other warps The level that improved bacterial strain is crossed in production L- homoserine has different degrees of raising compared to original strain.

4 large fermentation tank culture experiment of embodiment

In order to which L- homoserine is mass produced, W3110 Δ metI Δ metJ Δ metB Δ thrB Δ tdcC- is used MetL-thrA-rhtA (trc) bacterial strain, is cultivated in 5L fermentor.On LB plate by bacterial strain streak inoculation, at 37 DEG C Overnight incubation in incubator.Picking single colonie is seeded in the LB culture medium of 10ml, and 8h is cultivated at 37 DEG C, then tries 1ml Pipe culture inoculates in the 500ml triangular flask of seed (LB liquid) culture medium containing 100ml, and is turned with 200rpm Speed cultivates 8-10h in 37 DEG C of incubators, and the inoculum of 200ml is inoculated with the 5L fermentor into the fermentation medium containing 1.5L (BIOTECH-5JG) in, supplemented medium is added by fed-batch process, and cultivate 50-100h.Pass through in fermentation process Feed supplement controls concentration of glucose in 2-10g/L.Existed by DO level in stirring coupling dissolved oxygen (DO) scheme control fermentation process 30% or so, speed of agitator control controls cultivation temperature in 1-2vvm, fermentation process in 200-600rpm, Ventilation Rate control Range of the Ph 6.8~7.0 is adjusted at 30 DEG C and with 50% ammonium hydroxide.Medium component is as shown in table 11, and passes through amino acid The concentration for the L- homoserine in fermentation liquid that analyzer analysis is so cultivated is 60g/L.

Medium component is as shown in table 11, and analyzes the L- Kosé in the fermentation liquid so cultivated by amino-acid analyzer The concentration of propylhomoserin is 60g/L.

11 culture medium prescription of table (solvent is deionized water, pH6.8)

Composition	Fermentation medium	Supplemented medium
			Glucose (g/L)	40	500
Yeast powder (g/L)	4
			KH2PO4(g/L)	2	12.5
MgSO4(g/L)	2
			(NH4)2SO4(g/L)	17
L-Methionine (g/L)	0.2	2
			L-threonine (g/L)	0.2	2
L-Isoleucine (g/L)	0.2	2
			FeSO4(g/L)	0.005
MnSO4(g/L)	0.005
			ZnSO4(g/L)	0.005
Vitamin B1 (g/L)	0.0001

Sequence table

<110>Zhejiang Polytechnical University

<120>a kind of recombination bacillus coli of high yield L- homoserine and its application

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 654

<212> DNA

<213>unknown (Unknown)

<400> 1

atgtctgagc cgatgatgtg gctgctggtt cgtggcgtat gggaaacgct ggcaatgacc 60

ttcgtatccg gtttttttgg ctttgtgatt ggtctgccgg ttggcgttct gctttatgtc 120

acgcgtccgg ggcaaattat tgctaacgcg aagctgtatc gtaccgtttc tgcgattgtg 180

aacattttcc gttccatccc gttcattatc ttgcttgtat ggatgattcc gtttacccgc 240

gttattgtcg gtacatcgat tggtttgcag gcagcgattg ttccgttaac cgttggtgca 300

gcaccgttta ttgcccgtat ggtcgagaac gctctgctgg agatcccaac cgggttaatt 360

gaagcttccc gcgcaatggg tgccacgccg atgcagatcg tccgtaaggt gctgttaccg 420

gaagcgctgc cgggtctggt gaatgcggca actatcaccc tgattaccct ggtcggttat 480

tccgcgatgg gtggtgcagt cggtgccggt ggtttaggtc agattggcta tcagtatggc 540

tacatcggct ataacgcgac ggtgatgaat acggtactgg tattgctggt cattctggtt 600

tatttaattc agttcgcagg cgaccgcatc gtccgggctg tcactcgcaa gtaa 654

<210> 2

<211> 1000

<212> DNA

<213>unknown (Unknown)

<400> 2

gacacgttct attctcgaac tgctgaaaga catcaaccgc cgtctggggt tgacgattct 60

gttgatcacc cacgaaatgg acgttgtgaa gcgcatttgt gattgcgtgg cggtcatcag 120

caatggagaa ctgatcgagc aggacacggt aagtgaagtg ttctcgcatc cgaaaacgcc 180

gctggcgcag aagtttattc agtcgaccct gcatctggat atcccggaag attaccagga 240

acgtctgcaa gcggagccat ttactgactg cgtgccgatg ctgcgtctgg agtttaccgg 300

tcaatcggtc gatgccccac tgctttctga aaccgcgcgt cgtttcaacg tcaacaacaa 360

cattattagc gcgcagatgg attacgccgg tggcgttaag ttcggcatca tgctgactga 420

aatgcacggc acacaacaag atacgcaagc cgccattgcc tggctgcagg aacaccatgt 480

aaaagtagag gtactgggtt cgttcaacac aacataaata attgaagaag gaataaggta 540

tggcgttcaa attcaaaacc tttgcggcag tgggagccct gatcggatca ctggcactgg 600

taggctgcgg tcaggatgaa aaagatccaa accacattaa agtcggcgtg attgttggtg 660

ccgaacagca ggttgcagaa gtcgcgcaga aagttgcgaa agacaaatat ggcctggacg 720

ttgagctggt aaccttcaac gactatgttc tgccaaacga agcattgagc aaaggcgata 780

tcgacgccaa cgccttccag cataaaccgt accttgatca gcaactgaaa gatcgtggct 840

acaaactggt cgcagtaggc aacacttttg tttatccgat tgctggttac tccaagaaaa 900

tcaaatcact ggatgaactg caggatggtt cgcaggttgc cgtgccaaac gacccaacta 960

accttggtcg ttcactgctg ctgctgcaaa aagtgggctt 1000

<210> 3

<211> 318

<212> DNA

<213>unknown (Unknown)

<400> 3

atggctgaat ggagcggcga atatatcagc ccatacgctg agcacggcaa gaagagtgaa 60

caagtcaaaa agattacggt ttccattcct cttaaggtgt taaaaatcct caccgatgaa 120

cgcacgcgtc gtcaggtgaa caacctgcgt cacgctacca acagcgagct gctgtgcgaa 180

gcgtttctgc atgcctttac cgggcaacct ttgccggatg atgccgatct gcgtaaagag 240

cgcagcgacg aaatcccgga agcggcaaaa gagatcatgc gtgagatggg gattaacccg 300

gagacgtggg aatactaa 318

<210> 4

<211> 1013

<212> DNA

<213>unknown (Unknown)

<400> 4

atgccggtat tagtaagtac tgcaccagca ccaccttcca gttctgccag cgcacgctga 60

accacatcgc gcgttgggtt gccgcgacgc gagtaatcat gcgcgcgcgg ttcattaaat 120

ccggtaaagt tataggtgct ggaaagatgg atcggtggga caacgcaacc atactgttcg 180

tcgtcattta acccgctacg cactgcgatg gtggcctgtt tacgcgtcat gtgatgaagt 240

tccctgggct ttgtcggtga aatgtcaggc accagagtaa acattgtgtt aatggacgtc 300

aatacatctg gacatctaaa cttctttgcg tatagattga gcaaatccca aatagccgtt 360

aaaattatat gcattatcac gccgacaggt gcattacacg atgtcacggt aacgcctgta 420

cggtaaacta tgcgggttta cggtcagtac ccacatcaac tgtgtggtct ggtctcaatt 480

tattgacgaa gaggattaag tatctcagca aaaaagagcg gcgcggagtg gaatcgcctg 540

atgcgctacg cttatcaggc ctacgtcata ttgcaattta ttgaatttgc acgaacttgt 600

aggccggata aggcgttcac gccgcatccg gcataaacaa cgagcacgtt gtctgcgacc 660

caccgctttt tatacatgga cgtttaacta tgaaaaacag gctgctgatc ctcagcctgc 720

tggtttctgt acctgccttt gcctggcagc cacaaaccgg cgacatcatc tttcagatct 780

ctcgctcatc gcaaagtaaa gcgatccaac tggcgaccca taccgattat agccacaccg 840

gtatgctggt gatacgcaac aaaaagccct acgtttttga agcagtcggc ccggtgaaat 900

acaccccgct caagcagtgg atcgcccatg gtgaaaaggg caaatacgtt gttcgccgcg 960

ttgaaggcgg actgagtgtt gaacaacagc aaaaactggc gcaaacggca aaa 1013

<210> 5

<211> 1160

<212> DNA

<213>unknown (Unknown)

<400> 5

atgacgcgta aacaggccac catcgcagtg cgtagcgggt taaatgacga cgaacagtat 60

ggttgcgttg tcccaccgat ccatctttcc agcacctata actttaccgg atttaatgaa 120

ccgcgcgcgc atgattactc gcgtcgcggc aacccaacgc gcgatgtggt tcagcgtgcg 180

ctggcagaac tggaaggtgg tgctggtgca gtacttacta ataccggcat gtccgcgatt 240

cacctggtaa cgaccgtctt tttgaaacct ggcgatctgc tggttgcgcc gcacgactgc 300

tacggcggta gctatcgcct gttcgacagt ctggcgaaac gcggttgcta tcgcgtgttg 360

tttgttgatc aaggcgatga acaggcatta cgggcagcgc tggcagaaaa acccaaactg 420

gtactggtag aaagcccaag taatccattg ttacgcgtcg tggatattgc gaaaatctgc 480

catctggcaa gggaagtcgg ggcggtgagc gtggtggata acaccttctt aagcccggca 540

ttacaaaatc cgctggcatt aggtgccgat ctggtgttgc attcatgcac gaaatatctg 600

aacggtcact cagacgtagt ggccggcgtg gtgattgcta aagacccgga cgttgtcact 660

gaactggcct ggtgggcaaa caatattggc gtgacgggcg gcgcgtttga cagctatctg 720

ctgctacgtg ggttgcgaac gctggtgccg cgtatggagc tggcgcagcg caacgcgcag 780

gcgattgtga aatacctgca aacccagccg ttggtgaaaa aactgtatca cccgtcgttg 840

ccggaaaatc aggggcatga aattgccgcg cgccagcaaa aaggctttgg cgcaatgttg 900

agttttgaac tggatggcga tgagcagacg ctgcgtcgtt tcctgggcgg gctgtcgttg 960

tttacgctgg cggaatcatt agggggagtg gaaagtttaa tctctcacgc cgcaaccatg 1020

acacatgcag gcatggcacc agaagcgcgt gctgccgccg ggatctccga gacgctgctg 1080

cgtatctcca ccggtattga agatggcgaa gatttaattg ccgacctgga aaatggcttc 1140

cgggctgcaa acaaggggta 1160

<210> 6

<211> 1388

<212> DNA

<213>unknown (Unknown)

<400> 6

gctttacttt gcgatgagcg agagatctga aagatgatgt cgccggtttg tggctgccag 60

gcaaaggcag gtacagaaac cagcaggctg aggatcagca gcctgttttt catagttaaa 120

cgtccatgta taaaaagcgg tgggtcgcag acaacgtgct cgttgtttat gccggatgcg 180

gcgtgaacgc cttatccggc ctacaagttc gtgcaaattc aataaattgc aatatgacgt 240

aggcctgata agcgtagcgc atcaggcgat tccactccgc gccgctcttt tttgctgaga 300

tacttaatcc tcttcgtcaa taaattgaga ccagaccaca cagttgatgt gggtactgac 360

cgtaaacccg catagtttac cgtacaggcg ttaccgtgac atcgtgtaat gcacctgtcg 420

gcgtgataat gcatataatt ttaacggcta tttgggattt gctcaatcta tacgcaaaga 480

agtttagatg tccagatgta ttgacgtcca ttaacacaat gtttactctg gtgcctgaca 540

tttcaccgac aaagcccagg gaacttcatc acgagatact taatcctctt cgtcaataaa 600

ttgagaccag accacacagt tgatgtgggt actgaccgta aacccgcata gtttaccgta 660

caggcgttac cgtgacatcg tgtaatgcac ctgtcggcgt gataatgcat ataattttaa 720

cggctatttg ggatttgctc aatctatacg caaagaagtt tagatgtcca gatgtattga 780

cgtccattaa cacaatgttt actctggtgc ctgacatttc accgacaaag cccagggaac 840

ttcatcacaa aatgagtgtg attgcgcagg caggggcgaa aggtcgtcag ctgcataaat 900

ttggtggcag tagtctggct gatgtgaagt gttatttgcg tgtcgcgggc attatggcgg 960

agtactctca gcctgacgat atgatggtgg tttccgccgc cggtagcacc actaaccagt 1020

tgattaactg gttgaaacta agccagaccg atcgtctctc tgcgcatcag gttcaacaaa 1080

cgctgcgtcg ctatcagtgc gatctgatta gcggtctgct acccgctgaa gaagccgata 1140

gcctcattag cgcttttgtc agcgaccttg agcgcctggc ggcgctgctc gacagcggta 1200

ttaacgacgc agtgtatgcg gaagtggtgg gccacgggga agtatggtcg gcacgtctga 1260

tgtctgcggt acttaatcaa caagggctgc cagcggcctg gcttgatgcc cgcgagtttt 1320

tacgcgctga acgcgccgca caaccgcagg ttgatgaagg gctttcttac ccgttgctgc 1380

aacagctg 1388

<210> 7

<211> 933

<212> DNA

<213>unknown (Unknown)

<400> 7

atggttaaag tttatgcccc ggcttccagt gccaatatga gcgtcgggtt tgatgtgctc 60

ggggcggcgg tgacacctgt tgatggtgca ttgctcggag atgtagtcac ggttgaggcg 120

gcagagacat tcagtctcaa caacctcgga cgctttgccg ataagctgcc gtcagaacca 180

cgggaaaata tcgtttatca gtgctgggag cgtttttgcc aggaactggg taagcaaatt 240

ccagtggcga tgaccctgga aaagaatatg ccgatcggtt cgggcttagg ctccagtgcc 300

tgttcggtgg tcgcggcgct gatggcgatg aatgaacact gcggcaagcc gcttaatgac 360

actcgtttgc tggctttgat gggcgagctg gaaggccgta tctccggcag cattcattac 420

gacaacgtgg caccgtgttt tctcggtggt atgcagttga tgatcgaaga aaacgacatc 480

atcagccagc aagtgccagg gtttgatgag tggctgtggg tgctggcgta tccggggatt 540

aaagtctcga cggcagaagc cagggctatt ttaccggcgc agtatcgccg ccaggattgc 600

attgcgcacg ggcgacatct ggcaggcttc attcacgcct gctattcccg tcagcctgag 660

cttgccgcga agctgatgaa agatgttatc gctgaaccct accgtgaacg gttactgcca 720

ggcttccggc aggcgcggca ggcggtcgcg gaaatcggcg cggtagcgag cggtatctcc 780

ggctccggcc cgaccttgtt cgctctgtgt gacaagccgg aaaccgccca gcgcgttgcc 840

gactggttgg gtaagaacta cctgcaaaat caggaaggtt ttgttcatat ttgccggctg 900

gatacggcgg gcgcacgagt actggaaaac taa 933

<210> 8

<211> 1137

<212> DNA

<213>unknown (Unknown)

<400> 8

taaattcctc tatgacacca acgttggggc tggattaccg gttattgaga acctgcaaaa 60

tctgctcaat gcaggtgatg aattgatgaa gttctccggc attctttctg gttcgctttc 120

ttatatcttc ggcaagttag acgaaggcat gagtttctcc gaggcgacca cgctggcgcg 180

ggaaatgggt tataccgaac cggacccgcg agatgatctt tctggtatgg atgtggcgcg 240

taaactattg attctcgctc gtgaaacggg acgtgaactg gagctggcgg atattgaaat 300

tgaacctgtg ctgcccgcag agtttaacgc cgagggtgat gttgccgctt ttatggcgaa 360

tctgtcacaa ctcgacgatc tctttgccgc gcgcgtggcg aaggcccgtg atgaaggaaa 420

agttttgcgc tatgttggca atattgatga agatggcgtc tgccgcgtga agattgccga 480

agtggatggt aatgatccgc tgttcaaagt gaaaaatggc gaaaacgccc tggccttcta 540

tagccactat tatcagccgc tgccgttggt actgcgcgga tatggtgcgg gcaatgacgt 600

tacagctgcc ggtgtctttg ctgatctgct acgtaccctc tcatggaagt taggagtctg 660

aatgaaactc tacaatctga aagatcacaa cgagcaggtc agctttgcgc aagccgtaac 720

ccaggggttg ggcaaaaatc aggggctgtt ttttccgcac gacctgccgg aattcagcct 780

gactgaaatt gatgagatgc tgaagctgga ttttgtcacc cgcagtgcga agatcctctc 840

ggcgtttatt ggtgatgaaa tcccacagga aatcctggaa gagcgcgtgc gcgcggcgtt 900

tgccttcccg gctccggtcg ccaatgttga aagcgatgtc ggttgtctgg aattgttcca 960

cgggccaacg ctggcattta aagatttcgg cggtcgcttt atggcacaaa tgctgaccca 1020

tattgcgggt gataagccag tgaccattct gaccgcgacc tccggtgata ccggagcggc 1080

agtggctcat gctttctacg gtttaccgaa tgtgaaagtg gttatcctct atccacg 1137

<210> 9

<211> 930

<212> DNA

<213>unknown (Unknown)

<400> 9

atgccgattc gtgtgccgga cgagctaccc gccgtcaatt tcttgcgtga agaaaacgtc 60

tttgtgatga caacttctcg tgcgtctggt caggaaattc gtccacttaa ggttctgatc 120

cttaacctga tgccgaagaa gattgaaact gaaaatcagt ttctgcgcct gctttcaaac 180

tcacctttgc aggtcgatat tcagctgttg cgcatcgatt cccgtgaatc gcgcaacacg 240

cccgcagagc atctgaacaa cttctactgt aactttgaag atattcagga tcagaacttt 300

gacggtttga ttgtaactgg tgcgccgctg ggcctggtgg agtttaatga tgtcgcttac 360

tggccgcaga tcaaacaggt gctggagtgg tcgaaagatc acgtcacctc gacgctgttt 420

gtctgctggg cggtacaggc cgcgctcaat atcctctacg gcattcctaa gcaaactcgc 480

accgaaaaac tctctggcgt ttacgagcat catattctcc atcctcatgc gcttctgacg 540

cgtggctttg atgattcatt cctggcaccg cattcgcgct atgctgactt tccggcagcg 600

ttgattcgtg attacaccga tctggaaatt ctggcagaga cggaagaagg ggatgcatat 660

ctgtttgcca gtaaagataa gcgcattgcc tttgtgacgg gccatcccga atatgatgcg 720

caaacgctgg cgcaggaatt tttccgcgat gtggaagccg gactagaccc ggatgtaccg 780

tataactatt tcccgcacaa tgatccgcaa aatacaccgc gagcgagctg gcgtagtcac 840

ggtaatttac tgtttaccaa ctggctcaac tattacgtct accagatcac gccatacgat 900

ctacggcaca tgaatccaac gctggattaa 930

<210> 10

<211> 1227

<212> DNA

<213>unknown (Unknown)

<400> 10

atgagaaaaa atcgcctacg cccccacata cgccagattc agcaacggat acggtttccc 60

caaatcgtcc acctcagagc gtcccgtaac cttaaaaccc accttcttat agaacccaac 120

cgcctgctca ttttgctcat taacgttggt tgtcagttcc ggtgccatcg agagcgcatg 180

ctccaccagc acccgaccta cgccgcagcc gcgcacatca ggatcgataa acagcgcatc 240

catatgctgc ccacttagca acataaatcc aaccggctga tcccgctcat taaccgcgac 300

ccacaacggc gcttccggca ggaaggaacg aactaggtcc tccagctcgg tccgatactc 360

tgctgataga aaatcgtgag tggcatcgac agaacgacac caaatcgcaa cgagttcctc 420

cccttcctca tgccgtgagc ggcgaatact aataaccatt ttctctcctt ttagtcattc 480

ttatattcta acgtagtctt ttccttgaaa ctttctcacc ttcaacatgc aggctcgaca 540

ttggcaaatt ttctggttat cttcagctat ctggatgtct aaacgtataa gcgtatgtag 600

tgaggtaatc aggtttcttc tgtgatagtc gatcgttaag cgattcagca ccttacctca 660

ggcaccttcg ggtgcctttt ttatttccga aacgtacctc agcaggtgaa taaattttat 720

tcatattgtt atcaacaagt tatcaagtat ttttaattaa aatggaaatt gtttttgatt 780

ttgcatttta aatgagtagt cttagttgtg ctgaacgaaa agagcacaac gatccttcgt 840

tcacagtggg gaagttttcg gatccatgac gaggagctgc acgatgactg aacaggcaac 900

aacaaccgat gaactggctt tcacaaggcc gtatggcgag caggagaagc aaattcttac 960

tgccgaagcg gtagaatttc tgactgagct ggtgacgcat tttacgccac aacgcaataa 1020

acttctggca gcgcgcattc agcagcagca agatattgat aacggaacgt tgcctgattt 1080

tatttcggaa acagcttcca ttcgcgatgc tgattggaaa attcgcggga ttcctgcgga 1140

cttagaagac cgccgcgtag agataactgg cccggtagag cgcaagatgg tgatcaacgc 1200

gctcaacgcc aatgtgaaag tctttat 1227

<210> 11

<211> 1332

<212> DNA

<213>unknown (Unknown)

<400> 11

atgagtactt cagatagcat tgtatccagc cagacaaaac aatcgtcctg gcgtaaatca 60

gataccacat ggacgttagg cttgtttggt acggcaatcg gcgccggggt gctgttcttc 120

cctatccgcg caggttttgg cggactgatc ccgattcttc tgatgttggt attggcatac 180

cccatcgcgt tttattgcca ccgggcgctg gcgcgtctgt gtctttctgg ctctaaccct 240

tccggcaaca ttacggaaac ggtggaagag cattttggta aaactggcgg cgtggttatc 300

acgttcctgt acttcttcgc gatttgccca ctgctgtgga tttatggcgt tactattacc 360

aataccttta tgacgttctg ggaaaaccag ctcggctttg caccgctgaa tcgcggcttt 420

gtggcgctgt tcctgttgct gctgatggct ttcgtcatct ggtttggtaa ggatctgatg 480

gttaaagtga tgagctacct ggtatggccg tttatcgcca gcctggtgct gatttctttg 540

tcgctgatcc cttactggaa ctctgcagtt atcgaccagg ttgacctcgg ttcgctgtcg 600

ttaaccggtc atgacggtat cctgatcact gtctggctgg ggatttccat catggttttc 660

tcctttaact tctcgccaat cgtctcttcc ttcgtggttt ctaagcgtga agagtatgag 720

aaagacttcg gtcgcgactt caccgaacgt aaatgttccc aaatcatttc tcgtgccagc 780

atgctgatgg ttgcagtggt gatgttcttt gcctttagct gcctgtttac tctgtctccg 840

gccaacatgg cggaagccaa agcgcagaat attccagtgc tttcttatct ggctaaccac 900

tttgcgtcca tgaccggtac caaaacaacg ttcgcgatta cactggaata tgcggcttcc 960

atcatcgcac tcgtggctat cttcaaatct ttcttcggtc actatctggg aacgctggaa 1020

ggtctgaatg gcctggtcct gaagtttggt tataaaggcg acaaaactaa agtgtcgctg 1080

ggtaaactga acactatcag catgatcttc atcatgggct ccacctgggt tgttgcctac 1140

gccaacccga acatccttga cctgattgaa gccatgggcg caccgattat cgcatccctg 1200

ctgtgcctgt tgccgatgta tgccatccgt aaagcgccgt ctctggcgaa ataccgtggt 1260

cgtctggata acgtgtttgt taccgtgatt ggtctgctga ccatcctgaa catcgtatac 1320

aaactgtttt aa 1332

<210> 12

<211> 1045

<212> DNA

<213>unknown (Unknown)

<400> 12

aaattatgga agatctctat gatgtcgata acgtgattgt gccaattggt ggtggcggtt 60

taattgctgg tattgcggtg gcaattaaat ctattaaccc gaccattcgt gttattggcg 120

tacagtctga aaacgttcac ggcatggcgg cttctttcca ctccggagaa ataaccacgc 180

accgaactac cggcaccctg gcggatggtt gtgatgtctc ccgcccgggt aatttaactt 240

acgaaatcgt tcgtgaatta gtcgatgaca tcgtgctggt cagcgaagac gaaatcagaa 300

acagtatgat tgccttaatt cagcgcaata aagtcgtcac cgaaggcgca ggcgctctgg 360

catgtgctgc attattaagc ggtaaattag accaatatat tcaaaacaga aaaaccgtca 420

gtattatttc cggcggcaat atcgatcttt ctcgcgtctc tcaaatcacc ggtttcgttg 480

acgcttaatt aattcgttga ggataggata tgtaatccgt aactcaggat gagaaaagag 540

atgaatgaat ttccggttgt tttggttatt aactgtggtt cgtcttcgat taagttttcc 600

gtgctcgatg ccagcgactg tgaagtatta atgtcaggta ttgccgacgg tattaactcg 660

gaaaatgcat tcttatccgt aaatggggga gagccagcac cgctggctca ccacagctac 720

gaaggtgcat tgaaggcaat tgcatttgaa ctggaaaaac ggaatttaaa tgacagtgtg 780

gccttaattg gccaccgcat cgctcacggc ggcagtattt ttaccgagtc cgccattatt 840

accgatgaag tcattgataa tatccgtcgc gtttctccac tggcacccct gcataattac 900

gccaatttaa gtggtattga atcggcgcag caattatttc cgggcgtaac tcaggtggcg 960

gtatttgata ccagtttcca ccagacgatg gctccggaag cttatttata cggcctgccg 1020

tggaaatatt atgaagagtt aggtg 1045

<210> 13

<211> 2433

<212> DNA

<213>unknown (Unknown)

<400> 13

atgagtgtga ttgcgcaggc aggggcgaaa ggtcgtcagc tgcataaatt tggtggcagt 60

agtctggctg atgtgaagtg ttatttgcgt gtcgcgggca ttatggcgga gtactctcag 120

cctgacgata tgatggtggt ttccgccgcc ggtagcacca ctaaccagtt gattaactgg 180

ttgaaactaa gccagaccga tcgtctctct gcgcatcagg ttcaacaaac gctgcgtcgc 240

tatcagtgcg atctgattag cggtctgcta cccgctgaag aagccgatag cctcattagc 300

gcttttgtca gcgaccttga gcgcctggcg gcgctgctcg acagcggtat taacgacgca 360

gtgtatgcgg aagtggtggg ccacggggaa gtatggtcgg cacgtctgat gtctgcggta 420

cttaatcaac aagggctgcc agcggcctgg cttgatgccc gcgagttttt acgcgctgaa 480

cgcgccgcac aaccgcaggt tgatgaaggg ctttcttacc cgttgctgca acagctgctg 540

gtgcaacatc cgggcaaacg tctggtggtg accggattta tcagccgcaa caacgccggt 600

gaaacggtgc tgctggggcg taacggttcc gactattccg cgacacaaat cggtgcgctg 660

gcgggtgttt ctcgcgtaac catctggagc gacgtcgccg gggtatacag tgccgacccg 720

cgtaaagtga aagatgcctg cctgctgccg ttgctgcgtc tggatgaggc cagcgaactg 780

gcgcgcctgg cggctcccgt tcttcacgcc cgtactttac agccggtttc tggcagcgaa 840

atcgacctgc aactgcgctg tagctacacg ccggatcaag gttccacgcg cattgaacgc 900

gtgctggcct ccggtactgg tgcgcgtatt gtcaccagcc acgatgatgt ctgtttgatt 960

gagtttcagg tgcccgccag tcaggatttc aaactggcgc ataaagagat cgaccaaatc 1020

ctgaaacgcg cgcaggtacg cccgctggcg gttggcgtac ataacgatcg ccagttgctg 1080

caattttgct acacctcaga agtggccgac agtgcgctga aaatcctcga cgaagcggga 1140

ttacctggcg aactgcgcct gcgtcagggg ctggcgctgg tggcgatggt cggtgcaggc 1200

gtcacccgta acccgctgca ttgccaccgc ttctggcagc aactgaaagg ccagccggtc 1260

gaatttacct ggcagtccga tgacggcatc agcctggtgg cagtactgcg caccggcccg 1320

accgaaagcc tgattcaggg gctgcatcag tccgtcttcc gcgcagaaaa acgcatcggc 1380

ctggtattgt tcggtaaggg caatatcggt tcccgttggc tggaactgtt cgcccgtgag 1440

cagagcacgc tttcggcacg taccggcttt gagtttgtgc tggcaggtgt ggtggacagc 1500

cgccgcagcc tgttgagcta tgacgggctg gacgccagcc gcgcgttagc cttcttcaac 1560

gatgaagcgg ttgagcagga tgaagagtcg ttgttcctgt ggatgcgcgc ccatccgtat 1620

gatgatttag tggtgctgga cgttaccgcc agccagcagc ttgctgatca gtatcttgat 1680

ttcgccagcc acggtttcca cgttatcagc gccaacaaac tggcgggagc cagcgacagc 1740

aataaatatc gccagatcca cgacgccttc gaaaaaaccg ggcgtcactg gctgtacaat 1800

gccaccgtcg gtgcgggctt gccgatcaac cacaccgtgc gcgatctgat cgacagcggc 1860

gatactattt tgtcgatcag cgggatcttc tccggcacgc tctcctggct gttcctgcaa 1920

ttcgacggta gcgtgccgtt taccgagctg gtggatcagg cgtggcagca gggcttaacc 1980

gaacctgacc cgcgtgacga tctctctggc aaagacgtga tgcgcaagct ggtgattctg 2040

gcgcgtgaag caggttacaa catcgaaccg gatcaggtac gtgtggaatc gctggtgcct 2100

gctcattgcg aaggcggcag catcgaccat ttctttgaaa atggcgatga actgaacgag 2160

cagatggtgc aacggctgga agcggcccgc gaaatggggc tggtgctgcg ctacgtggcg 2220

cgtttcgatg ccaacggtaa agcgcgtgta ggcgtggaag cggtgcgtga agatcatccg 2280

ttggcatcac tgctgccgtg cgataacgtc tttgccatcg aaagccgctg gtatcgcgat 2340

aaccctctgg tgatccgcgg acctggcgct gggcgcgacg tcaccgccgg ggcgattcag 2400

tcggatatca accggctggc acagttgttg taa 2433

<210> 14

<211> 1069

<212> DNA

<213>unknown (Unknown)

<400> 14

cagttggatc gctttacttt gcgatgagcg agagatctga aagatgatgt cgccggtttg 60

tggctgccag gcaaaggcag gtacagaaac cagcaggctg aggatcagca gcctgttttt 120

catagttaaa cgtccatgta taaaaagcgg tgggtcgcag acaacgtgct cgttgtttat 180

gccggatgcg gcgtgaacgc cttatccggc ctacaagttc gtgcaaattc aataaattgc 240

aatatgacgt aggcctgata agcgtagcgc atcaggcgat tccactccgc gccgctcttt 300

tttgctgaga tacttaatcc tcttcgtcaa taaattgaga ccagaccaca cagttgatgt 360

gggtactgac cgtaaacccg catagtttac cgtacaggcg ttaccgtgac atcgtgtaat 420

gcacctgtcg gcgtgataat gcatataatt ttaacggcta tttgggattt gctcaatcta 480

tacgcaaaga agtttagatg tccagatgta ttgacaatta atcatccggc tcgtataatg 540

tgtggtcaca aaggagatat acatgagtgt gattgcgcag gcaggggcga aaggtcgtca 600

gctgcataaa tttggtggca gtagtctggc tgatgtgaag tgttatttgc gtgtcgcggg 660

cattatggcg gagtactctc agcctgacga tatgatggtg gtttccgccg ccggtagcac 720

cactaaccag ttgattaact ggttgaaact aagccagacc gatcgtctct ctgcgcatca 780

ggttcaacaa acgctgcgtc gctatcagtg cgatctgatt agcggtctgc tacccgctga 840

agaagccgat agcctcatta gcgcttttgt cagcgacctt gagcgcctgg cggcgctgct 900

cgacagcggt attaacgacg cagtgtatgc ggaagtggtg ggccacgggg aagtatggtc 960

ggcacgtctg atgtctgcgg tacttaatca acaagggctg ccagcggcct ggcttgatgc 1020

ccgcgagttt ttacgcgctg aacgcgccgc acaaccgcag gttgatgaa 1069

<210> 15

<211> 2463

<212> DNA

<213>unknown (Unknown)

<400> 15

atgcgagtgt tgaagttcgg cggtacatca gtggcaaatg cagaacgttt tctgcgtgtt 60

gccgatattc tggaaagcaa tgccaggcag gggcaggtgg ccaccgtcct ctctgccccc 120

gccaaaatca ccaaccacct ggtggcgatg attgaaaaaa ccattagcgg ccaggatgct 180

ttacccaata tcagcgatgc cgaacgtatt tttgccgaac ttttgacggg actcgccgcc 240

gcccagccgg ggttcccgct ggcgcaattg aaaactttcg tcgatcagga atttgcccaa 300

ataaaacatg tcctgcatgg cattagtttg ttggggcagt gcccggatag catcaacgct 360

gcgctgattt gccgtggcga gaaaatgtcg atcgccatta tggccggcgt attagaagcg 420

cgcggtcaca acgttactgt tatcgatccg gtcgaaaaac tgctggcagt ggggcattac 480

ctcgaatcta ccgtcgatat tgctgagtcc acccgccgta ttgcggcaag ccgcattccg 540

gctgatcaca tggtgctgat ggcaggtttc accgccggta atgaaaaagg cgaactggtg 600

gtgcttggac gcaacggttc cgactactct gctgcggtgc tggctgcctg tttacgcgcc 660

gattgttgcg agatttggac ggacgttgac ggggtctata cctgcgaccc gcgtcaggtg 720

cccgatgcga ggttgttgaa gtcgatgtcc taccaggaag cgatggagct ttcctacttc 780

ggcgctaaag ttcttcaccc ccgcaccatt acccccatcg cccagttcca gatcccttgc 840

ctgattaaaa ataccggaaa tcctcaagca ccaggtacgc tcattggtgc cagccgtgat 900

gaagacgaat taccggtcaa gggcatttcc aatctgaata acatggcaat gttcagcgtt 960

tctggtccgg ggatgaaagg gatggtcggc atggcggcgc gcgtctttgc agcgatgtca 1020

cgcgcccgta tttccgtggt gctgattacg caatcatctt ccgaatacag catcagtttc 1080

tgcgttccac aaagcgactg tgtgcgagct gaacgggcaa tgcaggaaga gttctacctg 1140

gaactgaaag aaggcttact ggagccgctg gcagtgacgg aacggctggc cattatctcg 1200

gtggtaggtg atggtatgcg caccttgcgt gggatctcgg cgaaattctt tgccgcactg 1260

gcccgcgcca atatcaacat tgtcgccatt gctcagggat cttctgaacg ctcaatctct 1320

gtcgtggtaa ataacgatga tgcgaccact ggcgtgcgcg ttactcatca gatgctgttc 1380

aataccgatc aggttatcga agtgtttgtg attggcgtcg gtggcgttgg cggtgcgctg 1440

ctggagcaac tgaagcgtca gcaaagctgg ctgaagaata aacatatcga cttacgtgtc 1500

tgcggtgttg ccaactcgaa ggctctgctc accaatgtac atggccttaa tctggaaaac 1560

tggcaggaag aactggcgca agccaaagag ccgtttaatc tcgggcgctt aattcgcctc 1620

gtgaaagaat atcatctgct gaacccggtc attgttgact gcacttccag ccaggcagtg 1680

gcggatcaat atgccgactt cctgcgcgaa ggtttccacg ttgtcacgcc gaacaaaaag 1740

gccaacacct cgtcgatgga ttactaccat cagttgcgtt atgcggcgga aaaatcgcgg 1800

cgtaaattcc tctatgacac caacgttggg gctggattac cggttattga gaacctgcaa 1860

aatctgctca atgcaggtga tgaattgatg aagttctccg gcattctttc tggttcgctt 1920

tcttatatct tcggcaagtt agacgaaggc atgagtttct ccgaggcgac cacgctggcg 1980

cgggaaatgg gttataccga accggacccg cgagatgatc tttctggtat ggatgtggcg 2040

cgtaaactat tgattctcgc tcgtgaaacg ggacgtgaac tggagctggc ggatattgaa 2100

attgaacctg tgctgcccgc agagtttaac gccgagggtg atgttgccgc ttttatggcg 2160

aatctgtcac aactcgacga tctctttgcc gcgcgcgtgg cgaaggcccg tgatgaagga 2220

aaagttttgc gctatgttgg caatattgat gaagatggcg tctgccgcgt gaagattgcc 2280

gaagtggatg gtaatgatcc gctgttcaaa gtgaaaaatg gcgaaaacgc cctggccttc 2340

tatagccact attatcagcc gctgccgttg gtactgcgcg gatatggtgc gggcaatgac 2400

gttacagctg ccggtgtctt tgctgatctg ctacgtaccc tctcatggaa gttaggagtc 2460

tga 2463

<210> 16

<211> 1304

<212> DNA

<213>unknown (Unknown)

<400> 16

ttaaagtttt cccgacattg gctgaatcgt tacacgatgt cgatttcact gtcgccacca 60

ctgcgcgcag tcgggcgaaa tatcattact acgccacgcc agttgaactg gtgccgctgt 120

tagaggaaaa atcttcatgg atgagccatg ccgcgctggt gtttggtcgc gaagattccg 180

ggttgactaa cgaagagtta gcgttggctg acgttcttac tggtgtgccg atggtggcgg 240

attatccttc gctcaatctg gggcaggcgg tgatggtcta ttgctatcaa ttagcaacat 300

taatacaaca accggcgaaa agtgatgcaa cggcagacca acatcaactg caagctttac 360

gcgaacgagc catgacattg ctgacgactc tggcagtggc agatgacata aaactggtcg 420

actggttaca acaacgcctg gggcttttag agcaacgaga cacggcaatg ttgcaccgtt 480

tgctgcatga tattgaaaaa aatatcacca aataaaaaac gccttagtaa gtatttttca 540

gcttttcatt ctgactgcaa cgggcaatat gtctctgtgt ggattaaaaa aagagtgtct 600

gatagcagct tctgaactgg ttacctgccg tgagtaaatt aaaattttat tgacaattaa 660

tcatccggct cgtataatgt gtggtcacaa aggagatata catgcgagtg ttgaagttcg 720

gcggtacatc agtggcaaat gcagaacgtt ttctgcgtgt tgccgatatt ctggaaagca 780

atgccaggca ggggcaggtg gccaccgtcc tctctgcccc cgccaaaatc accaaccacc 840

tggtggcgat gattgaaaaa accattagcg gccaggatgc tttacccaat atcagcgatg 900

ccgaacgtat ttttgccgaa cttttgacgg gactcgccgc cgcccagccg gggttcccgc 960

tggcgcaatt gaaaactttc gtcgatcagg aatttgccca aataaaacat gtcctgcatg 1020

gcattagttt gttggggcag tgcccggata gcatcaacgc tgcgctgatt tgccgtggcg 1080

agaaaatgtc gatcgccatt atggccggcg tattagaagc gcgcggtcac aacgttactg 1140

ttatcgatcc ggtcgaaaaa ctgctggcag tggggcatta cctcgaatct accgtcgata 1200

ttgctgagtc cacccgccgt attgcggcaa gccgcattcc ggctgatcac atggtgctga 1260

tggcaggttt caccgccggt aatgaaaaag gcgaactggt ggtg 1304

<210> 17

<211> 888

<212> DNA

<213>unknown (Unknown)

<400> 17

atgcctggtt cattacgtaa aatgccggtc tggttaccaa tagtcatatt gctcgttgcc 60

atggcgtcta ttcagggtgg agcctcgtta gctaagtcac tttttcctct ggtgggcgca 120

ccgggtgtca ctgcgctgcg tctggcatta ggaacgctga tcctcatcgc gttctttaag 180

ccatggcgac tgcgctttgc caaagagcaa cggttaccgc tgttgtttta cggcgtttcg 240

ctgggtggga tgaattatct tttttatctt tctattcaga cagtaccgct gggtattgcg 300

gtggcgctgg agttcaccgg accactggcg gtggcgctgt tctcttctcg tcgcccggta 360

gatttcgtct gggttgtgct ggcggttctt ggtctgtggt tcctgctacc gctggggcaa 420

gacgtttccc atgtcgattt aaccggctgt gcgctggcac tgggggccgg ggcttgttgg 480

gctatttaca ttttaagtgg gcaacgcgca ggagcggaac atggccctgc gacggtggca 540

attggttcgt tgattgcagc gttaattttc gtgccaattg gagcgcttca ggctggtgaa 600

gcactctggc actggtcggt tattccattg ggtctggctg tcgctattct ctcgaccgct 660

ctgccttatt cgctggaaat gattgccctc acccgtttgc caacacggac atttggtacg 720

ctgatgagca tggaaccggc gctggctgcc gtttccggga tgattttcct cggagaaaca 780

ctgacaccca tacagctact ggcgctcggc gctatcatcg ccgcttcaat ggggtctacg 840

ctgacagtac gcaaagagag caaaataaaa gaattagaca ttaattaa 888

<210> 18

<211> 1034

<212> DNA

<213>unknown (Unknown)

<400> 18

tgtcgtgttt gtaggtcggg tattcagtgg tctggaattt accataaccc acacccacta 60

caccgtagat gcttgcccag tcgttaatgc ggtaagccgg accagcagtg atgccgtagt 120

actggttttt gttgtagtca ccagagcttg cagtacggct tttctcggtg taagtgaaag 180

aaccgatcac acccagcggg ctgttgtctt cttcatagcg gtatttcagg ttgaaaccgc 240

ccattttgtt catttggccc tgagcgtcgc tctgtgcgta accgccagtt acagtagaag 300

tcgcagctac ggaagtacct gcggtgaaag ccagaactgc ggccagtgct gaaagacatg 360

caattttttt cataaccacc tcaaatgtga ttcaaataag tcctaagttt taaatatatc 420

aaaaattaat gggaaactct tcgcgatttg tgatgtctaa cgggccattt catgtaacag 480

aacgttgaca attaatcatc cggctcgtat aatgtgtggt cacaaaggag atatacatgc 540

ctggttcatt acgtaaaatg ccggtctggt taccaatagt catattgctc gttgccatgg 600

cgtctattca gggtggagcc tcgttagcta agtcactttt tcctctggtg ggcgcaccgg 660

gtgtcactgc gctgcgtctg gcattaggaa cgctgatcct catcgcgttc tttaagccat 720

ggcgactgcg ctttgccaaa gagcaacggt taccgctgtt gttttacggc gtttcgctgg 780

gtgggatgaa ttatcttttt tatctttcta ttcagacagt accgctgggt attgcggtgg 840

cgctggagtt caccggacca ctggcggtgg cgctgttctc ttctcgtcgc ccggtagatt 900

tcgtctgggt tgtgctggcg gttcttggtc tgtggttcct gctaccgctg gggcaagacg 960

tttcccatgt cgatttaacc ggctgtgcgc tggcactggg ggccggggct tgttgggcta 1020

tttacatttt aagt 1034

<210> 19

<211> 72

<212> DNA

<213>unknown (Unknown)

<400> 19

ttgacgtcca ttaacacaat gtttactctg gtgcctgaca tttcaccgac aaagcccagg 60

gaacttcatc ac 72

<210> 20

<211> 226

<212> DNA

<213>unknown (Unknown)

<400> 20

ttgacttagg tcactaaata ctttaaccaa tataggcata gcgcacagac agataaaaat 60

tacagagtac acaacatcca tgaaacgcat tagcaccacc attaccacca ccatcaccat 120

taccacaggt aacggtgcgg gctgacgcgt acaggaaaca cagaaaaaag cccgcacctg 180

acagtgcggg cttttttttt cgaccaaagg taacgaggta acaacc 226

<210> 21

<211> 241

<212> DNA

<213>unknown (Unknown)

<400> 21

tttccataca ccgctatcca tctaaattta aatcactttt tcagagaact gcgtaagtat 60

tacgcatgtt ttccctgtca ttcatccaga ttattcctaa tcaccagact aatgattcca 120

tcaatcctgg cgcattttag tcaaaacggg ggaaaatttt ttcaacaaat gctcaaccag 180

cattgggtat atccagtaca ctccacgctt tacttaagtc tagatatttg tgggagaaag 240

g 241

<210> 22

<211> 52

<212> DNA

<213>unknown (Unknown)

<400> 22

ttgacaatta atcatccggc tcgtataatg tgtggtcaca aaggagatat ac 52

Claims (8)

1. a kind of recombination bacillus coli of high yield L- homoserine, it is characterised in that the recombination bacillus coli is by Escherichia coli The metI gene of middle coding L-Methionine transport protein, metJ gene, the encoding cystathionine γ for encoding negative regulation repressor are closed At the metB gene of enzyme, the thrB gene of encoded homoserine kinase, encoded homoserine-O- succinyl transferase metA After the tdcC gene of fortune albumen successively knocks out in gene and coding L- homoserine, then respectively by encoded homoserine dehydrogenase I ThrA gene, the metL gene of encoded homoserine dehydrogenase II and the rhtA gene of coding L- homoserine outward transport albumen Promoter replaces with the acquisition of Ptrc promoter.

2. the recombination bacillus coli of high yield L- homoserine as described in claim 1, it is characterised in that the Ptrc starts daughter nucleus Nucleotide sequence is shown in SEQ ID NO.22.

3. the recombination bacillus coli of high yield L- homoserine as described in claim 1, it is characterised in that the metI gene nucleosides Acid sequence is shown in SEQ ID NO.1, metJ gene nucleotide series are shown in SEQ ID NO.3, metB gene nucleotide sequence It is classified as shown in SEQ ID NO.5, thrB gene nucleotide series are shown in SEQ ID NO.7, metA gene nucleotide series are SEQ ID NO.9 is shown, tdcC gene nucleotide series are shown in SEQ ID NO.11.

4. the recombination bacillus coli of high yield L- homoserine described in a kind of claim 1 produces answering in L- homoserine in fermentation With.

5. application as claimed in claim 4, it is characterised in that the application is that the recombination bacillus coli is seeded to hair Ferment culture medium, fermented and cultured under the conditions of 30 DEG C, 180-200rpm, culture solution is isolated and purified, and obtains L- homoserine.

6. application as claimed in claim 5, it is characterised in that the fermentation medium final concentration composition are as follows: glucose 40g/L, Potassium dihydrogen phosphate 2g/L, ammonium sulfate 17g/L, yeast powder 4g/L, calcium carbonate 30g/L, L-threonine 0.20g/L, L-Methionine 0.2g/L, vitamin B₁0.0001g/L, l-Isoleucine 0.2g/L, MgSO₄2g/L、FeSO₄0.005g/L、MnSO₄0.005g/ L、ZnSO₄0.005g/L, solvent are deionized water, pH value 6.8.

7. application as claimed in claim 5, it is characterised in that slant activation and seed culture are first carried out before the fermented and cultured, Seed liquor is seeded to fermentation medium, the slant activation method with the inoculum concentration of volumetric concentration 5% are as follows: large intestine bar will be recombinated Bacterium is inoculated on LB plate, in 37 DEG C of overnight incubations, obtains inclined-plane thalline；The seed culture method are as follows: picking inclined-plane thalline Single colonie is seeded in LB liquid medium, overnight incubation under conditions of 37 DEG C, 200rpm, obtains seed liquor.

8. application as claimed in claim 5, it is characterised in that the fermented and cultured carries out in the fermenter, by adding feed supplement Culture medium controls concentration of glucose 2-10g/L in fermentor；Fermentation condition is DO level 30%, speed of agitator 200- 600rpm, Ventilation Rate are controlled in 1-2vvm；Cultivation temperature is controlled in fermentation process to adjust at 30 DEG C and with 50% ammonium hydroxide PH6.8~7.0；Culture medium forms in fermentor are as follows: glucose 40g/L, potassium dihydrogen phosphate 2g/L, ammonium sulfate 17g/L, yeast powder 4g/L, L-threonine 0.2g/L, L-Methionine 0.2g/L, l-Isoleucine 0.2g/L, vitamin B₁ 0.0001g/L、MgSO₄ 2g/L、FeSO₄ 0.005g/L、MnSO₄ 0.005g/L、ZnSO₄0.005g/L, solvent are deionized water, pH value 6.8；It is described Supplemented medium composition are as follows: glucose 500g/L, potassium dihydrogen phosphate 12.5g/L, L-threonine 0.2g/L, L-Methionine 0.2g/ L, l-Isoleucine 0.2g/L, solvent are water.