CN111040979B - Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation - Google Patents

Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation Download PDF

Info

Publication number
CN111040979B
CN111040979B CN201811183104.5A CN201811183104A CN111040979B CN 111040979 B CN111040979 B CN 111040979B CN 201811183104 A CN201811183104 A CN 201811183104A CN 111040979 B CN111040979 B CN 111040979B
Authority
CN
China
Prior art keywords
cysteine
corynebacterium glutamicum
gene
medium
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811183104.5A
Other languages
Chinese (zh)
Other versions
CN111040979A (en
Inventor
刘君
魏亮
徐宁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin National Synthetic Biotechnology Innovation Center Co ltd
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN201811183104.5A priority Critical patent/CN111040979B/en
Publication of CN111040979A publication Critical patent/CN111040979A/en
Application granted granted Critical
Publication of CN111040979B publication Critical patent/CN111040979B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/01—Sulfurtransferases (2.8.1)
    • C12Y208/01007—Cysteine desulfurase (2.8.1.7)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a method for high yield of L-cysteine by corynebacterium glutamicum through metabolic engineering modification. Firstly, knocking out an L-cysteine desulfhydrase gene aecD, and simultaneously over-expressing a serine acetyltransferase gene cysE of the L-cysteine desulfhydrase gene aecD to obtain an L-cysteine accumulation strain; then respectively overexpressing serine acetyltransferase genes cysE of escherichia coli and arabidopsis thaliana, and obtaining EccysE (M201R) which is most beneficial to L-cysteine synthesis after activity comparison; respectively overexpressing L-cysteine transport proteins derived from escherichia coli and pantoea ananatis, and comparing the influence of different transport proteins on the yield of L-cysteine to obtain a transport protein Bcr most beneficial to secretion of L-cysteine; and then the synthesis of L-cysteine is promoted by increasing the level of precursor L-serine. Finally, 50-60 g/L glucose is used as a substrate, and the L-cysteine content reaches 800-1000 mg/L after fermentation for 3-4 days.

Description

Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation
Technical Field
The invention belongs to the technical field of synthetic biology and metabolic engineering, and particularly relates to a method for high yield of L-cysteine by a metabolic engineering strategy by selecting a food-safe microorganism corynebacterium glutamicum as a host.
Background
L-cysteine is an important sulfur-containing amino acid and is widely applied to the fields of feed, food, medicine, cosmetics and the like. The annual demand for L-cysteine in the global market reaches 5000 tons and shows a tendency to increase year by year. At present, L-cysteine is produced mainly by proteolytic means. However, the scale and further application of the industrial production of L-cysteine are limited due to the problems of environmental pollution and low yield in the process of the proteolytic production. Accordingly, studies on the synthesis of L-cysteine by fermentation using environmentally friendly microorganisms have been receiving increasing attention (Nonaka G, Takumi K [ J ]. Amb Express,2017,7(1):90.)
Corynebacterium glutamicum is a food-safe gram-positive strain isolated from soil and widely used in the production of amino acids, vitamins and nucleic acids (Becker J, Wittmann C. [ J ]. Current Opinion in Biotechnology,2012,23(4): 631-. In recent years, with the development of synthetic biology, artificial cell factories using corynebacterium glutamicum as a base have attracted much attention for synthesizing various bioenergy and fine chemical products. At present, the pathway for L-cysteine synthesis in C.glutamicum has been elucidated. The glycolytic intermediate, phosphoglycerate, is first catalyzed by 3-phosphoglycerate dehydrogenase, phosphoserine transaminase and phosphoserine phosphorylase to produce L-serine. Subsequently, L-serine is catalyzed by serine acetyltransferase and acetylserine thiolase in that order to form L-cysteine. In previous studies, Joo et al accumulated 60mg/L L-cysteine in C.glutamicum by overexpressing the serine acetyltransferase gene (cysE) and acetylserine sulfhydrylase gene (cysK) (Joo Y C, Hyeon J E, Han S O. [ J ]. J Agric Food Chem,2017,65 (23)). But the yield is low, so that the requirement of industrial production is difficult to meet.
Disclosure of Invention
The invention aims to provide a method for high-yield production of L-cysteine by using Corynebacterium glutamicum through metabolic engineering.
The invention provides a method for high yield of L-cysteine by corynebacterium glutamicum through metabolic engineering modification, which comprises the following steps:
(1) the invention selects food safety microorganism corynebacterium glutamicum as host strain.
(2) According to the invention, a strain capable of accumulating L-cysteine is obtained by knocking out an L-cysteine desulfhydrase gene aecD and simultaneously overexpressing a serine acetyltransferase gene cysE of the strain.
(3) On the basis of the strain obtained in the step (2), the influence of different cysE genes on the yield of L-cysteine is compared, serine acetyltransferase genes cysE with different enzyme activities and feedback inhibition resistance, which are from different sources, are overexpressed, and the serine acetyltransferase genes cysE with different enzyme activities and feedback inhibition resistance, including the cysE gene derived from arabidopsis thaliana, the cysE gene derived from escherichia coli and mutants M256A, M201R, R89P and R89H/T90V/P93A/A94T thereof, and the serine acetyltransferase gene which is most beneficial to the synthesis of L-cysteine is obtained.
(4) And (3) comparing the influence of different transporters on the L-cysteine yield on the basis of the obtained strains, and overexpressing transporters from different sources, including Yded and Bcr derived from escherichia coli and CefA derived from Pantoea ananatis, to obtain the transporter which is most beneficial to the secretion of the L-cysteine.
(5) Enhancing L-cysteine production by increasing L-serine levels, including overexpression of 3-phosphoglycerate dehydrogenase (serA), phosphoserine transaminase (serC), and phosphoserine phosphorylase (serB) genes, based on the strain obtained in (4), to enhance precursor L-serine synthesis; meanwhile, the gene sdaA of the L-serine dehydratase is knocked out, the expression of the gene glyA of the glycine hydroxymethyltransferase is reduced, and the accumulation of precursor L-serine is promoted.
(6) Inoculating the obtained corynebacterium glutamicum engineering strain into a 250mL triangular flask containing 20-25 mL seed culture medium, and culturing for 12-16 h to a logarithmic phase. The cells were then harvested by centrifugation, suspended in fresh fermentation medium, inoculated into a 250mL Erlenmeyer flask containing 50mL of fermentation medium, and the OD was started6000.8 to 1.2, and 5 to 15g/L of CaCO3. The fermentation conditions are 32 ℃, 150-200 rpm, and the constant temperature shaking culture is carried out. The fermentation medium is as follows: 50-60 g/L glucose, 0.1-0.2 g/L urea, 5-10 g/L corn steep liquor, 15-20 g/L ammonium sulfate and KH2PO4 5～6g/L，MgSO4·7H2O 2～5g/L，FeSO4·7H2O 0.2～0.5g/L，MnCl2·4H20.2-0.4 g/L of O, 0.2-0.4 mg/L of biotin, 11-2 mg/L of vitamin B, 61-2 mg/L of vitamin B, CaCO35-15 g/L of buffer used for fermentation medium. The seed culture medium comprises 10-20 g/L glucose, 0.1-0.2 g/L urea, 15-20 g/L corn steep liquor, 15-20 g/L ammonium sulfate and 6.5-7.0 pH. Finally, 50-60 g/L glucose is used as a substrate, and the L-cysteine content reaches 800-1000 mg/L after fermentation for 3-4 days.
Drawings
FIG. 1 is a schematic diagram of a strategy for synthesizing L-cysteine by Corynebacterium glutamicum through metabolic engineering
FIG. 2 is a graph comparing the effect of different sources of the cysE gene on L-cysteine production
FIG. 3 is a graph comparing the effect of different transporters on L-cysteine production
FIG. 4 is a schematic diagram of the construction of plasmids pTac-5, pTac-9 and pTac-11
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
The following examples are not intended to be specific, but to summarize the materials, reagents, and the like used. Are all commercially available.
EXAMPLE 1 construction of Corynebacterium glutamicum L-cysteine desulfhydrase Gene aecD-deleted Strain
(1) Extraction of C.glutamicum ATCC13032 genome template
And C, culturing the glutamicum ATCC13032 in an LB culture medium (20-25 g/L peptone, 10-20 g/L yeast powder and 20-25 g/L sodium chloride) at 30 ℃ and 150-200 rpm for 12-16 h, and then extracting the total DNA by using a genome extraction kit (Tiangen).
(2) Primers aecD1-F/aecD1-R and aecD2-F/aecD2-R are designed by taking a C.glutamcum ATCC13032 genome as a template, and the sequences are respectively as follows:
aecD 1-F：cgcggatcccgacagtcaatgcgatgcc；
aecD 1-R：acgaagaattttagaaggcctttccgcaacccacaaagg；
aecD 2-F：tgtgggttgcggaaaggccttctaaaattcttcgtgagg；
aecD 2-R：tgctctagaaacggccaacaccgtatcc。
fragments aecD1 and aecD2 were obtained by PCR using the primers designed as described above. Then, the obtained PCR products aecD1 and aecD2 were used as templates, and aecD1-F/aecD2-R was used as primers to obtain a fusion fragment aecD by a fusion PCR method, and after double digestion with BamHI and XbaI, the fragment was ligated to the vector pCRD206 to obtain a plasmid pCRD-aecD.
(3) aecD gene knockout step: plasmid pCRD-aecD was electroporated into C.glutamicum ATCC13032 cells. Electric rotating stripThe parts are as follows: mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, placed on ice for 30 minutes, and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, 1ml of LBHIS medium was quickly transferred to a shock cup, and after 5-10 blows, the medium was transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol. Culturing at 25 ℃ for 2-3 days, picking single colony to transfer to LBHIS (5g/L peptone, 5g/L NaCl,2.5g/L yeast powder, 18.5g/L brain heart leachate and 91g/L sorbitol) culture medium, and culturing at 37 ℃ for 1 day. Then, the solid LBHIS medium was streaked for 1 day. Picking single colony to A + sucrose medium (10g/L glucose, 7g/L casein hydrolysate, 5g/L ammonium sulfate, 2g L-1yeast extract,2g/L urea, 0.5g/L KH2PO4,0.5g/L K2HPO4·3H2O,0.5g/L MgSO4·7H2O,6mg/L Fe2SO4·7H2O,4.2mg/L Mn2SO4·H2O,0.2mg/L biotin,0.2mg/L thiamine, 4% glucose and 10% sucrose), and culturing for 2-3 days. Then streaked into a + sucrose medium. Colonies were picked and streaked on A + kanamycin and A solid media. Strains that grew on A medium but failed to grow on A + kanamycin medium were selected. Subsequently, the wild-type strain is used as a control, the obtained strain is subjected to PCR verification by using the primer aecD-CF/aecD-CR, and the reduction of the size of the PCR product is the correct knockout strain.
The primer aecD-CF/aecD-CR has the following sequence:
aecD CF：ggccccagtcatagtcaactgc；
aecD CR：agtacttcacacggatgaaattggc。
and (3) PCR system: ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, Step 294 ℃ for 30s, Step 360 ℃ for 30s, Step 472 ℃ for 1min, Step 572 ℃ for 10min and Step 64 ℃.
Fusion PCR conditions and methods: (1) ddH2O28. mu.L, template 13. mu.L, template 23. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 10 cycles, and Step 572 deg.C for 10 min. (2) ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 30 cycles, and Step 572 deg.C for 10 min.
A double enzyme digestion system: gene aecD or plasmid pCRD 20620. mu.L, BamHI 1. mu.L, XbaI 1. mu.L, 10 XBuffer 5. mu.L, ddH2O23. mu.L, reacted at 37 ℃ for 1 h.
A connection system: 16. mu.L of the aecD fragment of the gene, 1. mu.L of the pCRD206 fragment, 0.5. mu.L of T4 ligase, 2. mu.L of 10 XBuffer, and reacted at 22 ℃ for 1 hour.
EXAMPLE 2 construction of strains overexpressing the self-serine deacetylase Gene cysE
(1) Designing a primer CgcysE-F/CgcysE-R by taking a genome of C.glutamicum ATCC13032 as a template, wherein the sequence of the primer is as follows:
CgcysE-F：tccgagctcaaaggaggacaaccatgatccgtgaagatctcgca；
CgcysE-R：cggggtaccatagggcgctaactgttcttaaatg。
the fragment CgcysE was obtained by PCR using the above primers. Then, after double digestion with SacI and KpnI, the resulting product was ligated to the vector pTrcmob to obtain plasmid pTrc-1.
And (3) PCR system: ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, Step 294 ℃ for 30s, Step 360 ℃ for 30s, Step 472 ℃ for 1min, Step 572 ℃ for 10min and Step 64 ℃.
A double enzyme digestion system: gene aecD or plasmid pCRD 20620. mu.L, BamHI 1. mu.L, XbaI 1. mu.L, 10 XBuffer 5. mu.L, ddH2O23. mu.L, reacted at 37 ℃ for 1 h.
A connection system: 16. mu.L of the aecD fragment of the gene, 1. mu.L of the pCRD206 fragment, 0.5. mu.L of T4 ligase, 2. mu.L of 10 XBuffer, and reacted at 22 ℃ for 1 hour.
(2) The plasmid pTrc-1 was electroporated into cells of the L-cysteine desulfhydrase gene aecD-deleted strain of Corynebacterium glutamicum. The electrotransfer conditions were: 100. mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, and the mixture was placed on ice for 30 minutes and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, 1ml of LBHIS medium was quickly transferred to a shock cup, and after 5-10 blows, the medium was transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol.
(3) Inoculating the obtained corynebacterium glutamicum engineering strain into a 250mL triangular flask containing 20-25 mL seed culture medium, and culturing for 12-16 h to a logarithmic phase. The cells were then harvested by centrifugation, suspended in fresh fermentation medium, inoculated into a 250mL Erlenmeyer flask containing 50mL of fermentation medium, starting OD6000.8 to 1.2, and 5 to 15g/L of CaCO3. The fermentation conditions are 32 ℃, 150-200 rpm, and the constant temperature shaking culture is carried out. The fermentation medium is as follows: 50-60 g/L glucose, 0.1-0.2 g/L urea, 5-10 g/L corn steep liquor, 15-20 g/L ammonium sulfate and KH2PO4 5～6g/L，MgSO4·7H2O 2～5g/L，FeSO4·7H2O 0.2～0.5g/L，MnCl2·4H20.2-0.4 g/L of O, 0.2-0.4 mg/L of biotin, 11-2 mg/L of vitamin B, 61-2 mg/L of vitamin B, CaCO35-15 g/L of buffer used for fermentation medium. The seed culture medium comprises 10-20 g/L glucose, 0.1-0.2 g/L urea, 15-20 g/L corn steep liquor, 15-20 g/L ammonium sulfate and 6.5-7.0 pH. Finally, 50-60 g/L glucose is used as a substrate, and the L-cysteine content reaches 50-90 mg/L after fermentation for 3-4 days.
Example 3 investigation of the Effect of the serine acetyltransferase gene cysE of various origins on L-cysteine
(1) Extraction of E.coli MG1655 genome template
Coli MG1655 in LB medium (20-25 g/L peptone, 10-20 g/L yeast powder, 20-25 g/L sodium chloride), 37 ℃ 150-200 rpm culture for 12-16 h, using genome extraction kit (Tiangen) to extract total DNA.
(2) Coli MG1655 genome as template design primer EccysE-F/EccysE-R, its sequence is:
EccysE-F：tccgagctcaaaggaggacaacccaatgtcgtgtgaagaactgga；
EccysE-R：cggggtaccatgattacatcgcatccgg。
the fragment CgcysE is obtained by PCR using the above designed primers. Then, after double digestion with SacI and KpnI, the resulting product was ligated to the vector pTrcmob to obtain plasmid pTrc-2.
(3) The codon-optimized Arabidopsis cysE gene with codon usage preference of Corynebacterium glutamicum has the sequence shown in the sequence table and is synthesized by Jinwei science and technology, Inc., Suzhou. Design of primer with synthesized gene sequence as template
AtcysE-F/AtcysE-R, the sequence of which is:
AtcysE-R：tccgagctcaaaggaggacaaccatggctacctgcatcgacacctgc；
AtcysE-R：cggggtaccttagataacgtagtcggaccactcg。
the fragment AtcysE was obtained by PCR using the designed primers. Then, after double digestion with SacI and KpnI, the resulting product was ligated to the vector pTrcmob to obtain plasmid pTrc-3.
(4) The construction of E.coli cysE mutants M256A, M201R, R89P and R89H/T90V/P93A/A94T, comprises the following steps: the E.coli cysE gene obtained above was used as a template to design primers M256A-F/M256A-R, respectively,
M201R-F/M201R-R, R89P-F/R89P-R and 89H/T90V/P93A/A94T-F/R89H/T90V/P93A/A94T-R, the sequences of which are respectively:
EccysE-M256A-F：agccatcaatggatgcagaccagcatttcaacggtatt；
EccysE-M256A-R：aataccgttgaaatgctggtctgcatccattgatggct；
EccysE-M201R-F：tcgtgaaggtgtgcgcattggcgcgggcgcgaaaatc；
EccysE-M201R–R：gattttcgcgcccgcgccaatgcgcacaccttcacga；
EccysE-R89P-F：atattcaggcggtgcccacccgcgacccggcagtcgat；
EccysE-R89P-R：tcgcgggtgggcaccgcctgaatatcacaggccgcaga；
EccysE-R89H/T90V/P93A/A94T–F：gtgcatgtacgcgacgctacagtcgataaatactcaacc；
EccysE-R89H/T90V/P93A/A94T–R：atcgactgtagcgtcgcgtacatgcaccgcctgaat。
the primers are utilized, plasmid pTrc-2 is taken as a template, point mutation is carried out by a PCR method, corresponding M256A, M201R, R89P and R89H/T90V/P93A/A94T mutants are obtained, and plasmid pTrc-4-7 is obtained.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, at Step 294 ℃ for 30s, at Step 360 ℃ for 30s, at Step 472 ℃ for 6min, at Step 572 ℃ for 10min and at Step 64 ℃.
(4) And (3) electrically transferring the obtained plasmid pTrc-3-7 to a Corynebacterium glutamicum L-cysteine desulfhydrase gene aecD deletion strain cell. The electrotransfer conditions were: 100. mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, and the mixture was placed on ice for 30 minutes and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, 1ml of LBHIS medium was quickly transferred to a shock cup, and after 5-10 blows, the medium was transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol.
(5) Inoculating the obtained corynebacterium glutamicum engineering strain into a 250mL triangular flask containing 20-25 mL seed culture medium, and culturing for 12-16 h to a logarithmic phase. The cells were then harvested by centrifugation, suspended in fresh fermentation medium, inoculated into a 250mL Erlenmeyer flask containing 50mL of fermentation medium, and the OD was started6000.8 to 1.2, and 5 to 15g/L of CaCO3. The fermentation conditions are 32 ℃, 150-200 rpm, and the constant temperature shaking culture is carried out. The fermentation medium is as follows: 50-60 g/L glucose, 0.1-0.2 g/L urea, 5-10 g/L corn steep liquor, 15-20 g/L ammonium sulfate and KH2PO4 5～6g/L，MgSO4·7H2O 2～5g/L，FeSO4·7H2O 0.2～0.5g/L，MnCl2·4H20.2-0.4 g/L of O, 0.2-0.4 mg/L of biotin, 11-2 mg/L of vitamin B, 61-2 mg/L of vitamin B, CaCO35-15 g/L of buffer used for fermentation medium. The seed culture medium comprises 10-20 g/LGlucose, 0.1-0.2 g/L of urea, 15-20 g/L of corn steep liquor, 15-20 g/L of ammonium sulfate and pH of 6.5-7.0. Finally, 50-60 g/L glucose is used as a substrate, and the L-cysteine content reaches 300-400 mg/L after fermentation for 3-4 days.
Example 4 investigation of the Effect of transporters from different sources on L-cysteine
(1) The E.coli MG1655 genome is taken as a template to design primers ydeD-F/ydeD-R and bcr-F/bcr-R, and the sequences are respectively as follows:
ydeD-F：tcccccgggagaaggagatataccatgtcgcgaaaagatggggtg；
ydeD-R：cgcggatccttaacttcccacctttaccgc；
bcr-F：tcccccgggagaaggagatataccatgaccacccgacagcattcgtcg；
bcr-R：cgcggatcctcaccgttttttcggccgactgg。
the primers obtained above were used to obtain the fragments EcydeD and Ecbcr by PCR. Then, after double digestion with SmaI and BamHI, the fragments were ligated to the vector pTrc-5 to obtain plasmids pTrc-8 and pTrc-9, respectively.
(2) Template for extracting Pantoea ananatis genome
Pantoea ananatis is cultured in an LB culture medium (20-25 g/L peptone, 10-20 g/L yeast powder and 20-25 g/L sodium chloride) at 34 ℃ and 150-200 rpm for 12-16 h, and then total DNA is extracted by using a genome extraction kit (Tiangen).
(3) A primer cefA-F/cefA-R is designed by taking the genome of Pantoea ananatis as a template, and the sequence of the primer is as follows:
cefA-F：tcccccgggaaaggaggacaaccatgctcgatccttccttcttta；
cefA-R：cgcggatccctagagaagcctgaaggcatcgac。
using the primers obtained above, a fragment cefA was obtained by PCR. SmaI and BamHI were digested simultaneously and ligated to the vector pTrc-5, respectively, to obtain plasmid pTrc-10.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, Step 294 ℃ for 30s, Step 360 ℃ for 30s, Step 472 ℃ for 1min, Step 572 ℃ for 10min and Step 64 ℃.
A double enzyme digestion system: gene aecD or plasmid pCRD 20620. mu.L, BamHI 1. mu.L, XbaI 1. mu.L，10×buffer 5μL，ddH2O23. mu.L, reacted at 37 ℃ for 1 h.
A connection system: 16. mu.L of the aecD fragment of the gene, 1. mu.L of the pCRD206 fragment, 0.5. mu.L of T4 ligase, 2. mu.L of 10 XBuffer, and reacted at 22 ℃ for 1 hour.
(4) And (3) electrically transferring the obtained plasmid pTrc-8-10 into a Corynebacterium glutamicum L-cysteine desulfhydrase gene aecD deletion strain cell. The electrotransfer conditions are as follows: 100. mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, and the mixture was placed on ice for 30 minutes and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, 1ml of LBHIS medium was quickly transferred to a shock cup, and after 5-10 blows, the medium was transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol.
(5) Inoculating the obtained corynebacterium glutamicum engineering strain into a 250mL triangular flask containing 20-25 mL seed culture medium, and culturing for 12-16 h to a logarithmic phase. The cells were then harvested by centrifugation, suspended in fresh fermentation medium, inoculated into a 250mL Erlenmeyer flask containing 50mL of fermentation medium, and the OD was started6000.8 to 1.2, and 5 to 15g/L of CaCO3. The fermentation conditions are 32 ℃, 150-200 rpm, and the constant temperature shaking culture is carried out. The fermentation medium is as follows: 50-60 g/L glucose, 0.1-0.2 g/L urea, 5-10 g/L corn steep liquor, 15-20 g/L ammonium sulfate and KH2PO4 5～6g/L，MgSO4·7H2O 2～5g/L，FeSO4·7H2O 0.2～0.5g/L，MnCl2·4H20.2-0.4 g/L of O, 0.2-0.4 mg/L of biotin, 11-2 mg/L of vitamin B, 61-2 mg/L of vitamin B, CaCO35-15 g/L of buffer used for fermentation medium. The seed culture medium comprises 10-20 g/L glucose, 0.1-0.2 g/L urea, 15-20 g/L corn steep liquor, 15-20 g/L ammonium sulfate and 6.5-7.0 pH. Finally, 50-60 g/L glucose is used as a substrate, and the L-cysteine content reaches 500-700 mg/L after fermentation for 3-4 days.
Example 5 increasing L-serine levels promotes L-cysteine Synthesis
(1) Knockout of SdaA gene, comprising the steps of: the primers sdaA upF/sdaA upR are designed by taking C.glutamcum ATCC13032 genome as a template, and the sequences sdaA dnF/sdaA dnR are respectively as follows:
sdaA upF：ggaagatctcaaccctggtcagccaact；
sdaA upR：tccaaactcacgcgattgtcgacggtatgtgaggatgat；
sdaA dnF：atcatcctcacataccgtcgacaatcgcgtgagtttgga；
sdaA dnR：tgctctagagccaaagtcactcgcattct。
using the primers obtained above, fragments sdaA1 and sdaA2 were obtained by PCR. Then, a fusion fragment sdaA was obtained by a fusion PCR method using the obtained PCR products sdaA1 and sdaA2 as templates and sdaAupF/sdaAdnR as primers, and digested with BamHI and XbaI in two steps, followed by ligation into a vector pCRD206, to obtain a plasmid pCRD-sdaA. Plasmid pCRD-sdaA was electroporated into cells of Corynebacterium glutamicum L-cysteine desulfhydrase gene aecD-deleted strain. The electrotransfer conditions were: 100. mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, and the mixture was placed on ice for 30 minutes and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, the cells were immediately transferred to a cuvette with 1ml of LBHIS medium, blown 5-10 times and transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol. Culturing at 25 ℃ for 2-3 days, picking single colony to transfer to LBHIS (5g/L peptone, 5g/L NaCl,2.5g/L yeast powder, 18.5g/L brain heart leachate and 91g/L sorbitol) culture medium, and culturing at 37 ℃ for 1 day. Then, the solid LBHIS medium was streaked for 1 day. And (4) selecting a single colony to be cultured in an A + sucrose liquid culture medium for 2-3 days. Then streaked into a + sucrose solid medium. Colonies were picked and streaked on A + kanamycin and A solid media. Strains that grew on A medium and failed to grow on A + kanamycin medium were selected. Subsequently, the obtained strain was subjected to PCR verification using the primers sdaA-CF/sdaA-CR, using the wild-type strain as a control, and the correct knockout strain was obtained as a result of the reduction in the size of the PCR product. The sequence of the primer sdaA-CF/sdaA-CR is as follows: sdaA-CF: aagtcttcatcggcgattctg, respectively; sdaA-CR: tacgttgaatctccatgcagaacgac are provided.
And (3) PCR system: ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, Step 294 ℃ for 30s, Step 360 ℃ for 30s, Step 472 ℃ for 1min, Step 572 ℃ for 10min and Step 64 ℃.
Fusion PCR conditions and methods: (1) ddH2O28. mu.L, template 13. mu.L, template 23. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 10 cycles, and Step 572 deg.C for 10 min. (2) ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 30 cycles, and Step 572 deg.C for 10 min.
A double enzyme digestion system: gene sdaA or plasmid pCRD 20620. mu.L, BamHI 1. mu.L, XbaI 1. mu.L, 10 XBuffer 5. mu.L, ddH2O23. mu.L, reacted at 37 ℃ for 1 h.
A connection system: 16. mu.L of gene sdaA fragment, 1. mu.L of pCRD206 fragment, 0.5. mu.L of T4 ligase, 2. mu.L of 10 XBuffer, and reaction at 22 ℃ for 1 hour.
(2) The glyA promoter is replaced, and the expression of the gene glyA is reduced. The method comprises the following steps: (1) the glyA gene knockout step is as follows: designing primers glyA upF/glyA upR, glyA dnF/glyA dnR and ndhE-F/ndhE-R by taking C.glutamum ATCC13032 genome as a template, wherein the sequences are respectively as follows:
glyA upF：tgctctagaggcgtaatgggagaagtggg；
glyA upR：tgagagaaaggagcgcccaggtacgcccacaagcataga；
glyA dnF：gtttgcctaggattaggtacatgaccgatgcccaccaag；
glyA dnR：agcagatcttccgcctgctggccat；
nadE-F：tctatgcttgtgggcgtacctgggcgctcctttctctcatg；
nadE-R：gtgggcatcggtcatgtacctaatcctaggcaaacatgg。
using the primers obtained above, fragments glyA1, glyA 2 and ndhE were obtained by PCR. Then, using the PCR products glyA1, glyA 2 and ndhE obtained above as templates and glyA upF/glyA dnR as primers, a fusion fragment glyA was obtained by fusion PCR, which was digested with BamHI and XbaI and ligated to vector pCRD206 to obtain plasmid pCRD-glyA-ndhE. Plasmid pCRD-glyA-ndhE was electroporated into cells of the double deletion strain of Corynebacterium glutamicum aecD and sdaA. The electrotransfer conditions were: 100. mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, and the mixture was placed on ice for 30 minutes and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, 1ml of LBHIS medium was quickly transferred to a shock cup, and after 5-10 blows, the medium was transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol. Culturing at 25 ℃ for 2-3 days, picking single colony to transfer to LBHIS (5g/L peptone, 5g/L NaCl,2.5g/L yeast powder, 18.5g/L brain heart leachate and 91g/L sorbitol) culture medium, and culturing at 37 ℃ for 1 day. Then streaking on LBHIS solid medium for 1 day. And (4) selecting a single colony to be cultured in an A + sucrose liquid culture medium for 2-3 days. Then streaked into a + sucrose solid medium. Colonies were picked and streaked on A + kanamycin and A solid media. Strains that grew on A medium but failed to grow on A + kanamycin medium were selected. Subsequently, the wild type strain is used as a control, PCR verification is carried out on the obtained strain by using a primer glyA-CF/glyA dnR, and the reduction of the size of the PCR product is the correct knockout strain. The primer glyA-CF sequence is: glyA CF: catgacacttaatcgtcgggat are provided.
And (3) PCR system: ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, Step 294 ℃ for 30s, Step 360 ℃ for 30s, Step 472 ℃ for 1min, Step 572 ℃ for 10min and Step 64 ℃.
Fusion PCR conditions and methods: (1) ddH2O28. mu.L, template 13. mu.L, template 23. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 10 cycles, Step 572℃ 10min。(2)ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 30 cycles, and Step 572 deg.C for 10 min.
A double enzyme digestion system: gene glyA or plasmid pCRD 20620. mu.L, BamHI 1. mu.L, XbaI 1. mu.L, 10 XBuffer 5. mu.L, ddH2O23. mu.L, reacted at 37 ℃ for 1 h.
A connection system: 16. mu.L of the glyA fragment, 1. mu.L of the pCRD206 fragment, 0.5. mu.L of T4 ligase, 2. mu.L of 10 XBuffer, and reaction at 22 ℃ for 1 hour.
(3) Overexpression of the genes for 3-phosphoglycerate dehydrogenase (serA), phosphoserine transaminase (serC) and phosphoserine phosphorylase (serB) enhances the synthesis of precursor L-serine. The method comprises the following steps: designing primers serA-F/serA-R, serC-F/serC-R and serB-F/serB-R by taking C.glutamcum ATCC13032 genome as a template, wherein the sequences are as follows:
serA-F：ctagtctagaaaaggaggacaaccatgagccagaatggccgtccgg；
serA-R：cggtcatagattcactcctttttaagccagatccatccacacagc；
serC-F：tgtgtggatggatctggcttaaaaaggagtgaatctatgaccgacttccccaccctgc；
serC-R：cgacataagcaacttcctttttacttccttgcaaaaccgccatcg；
serB-F：gcggttttgcaaggaagtaaaaaggaagttgcttatgtcgtgttccgcgctcag；
serB-R：aaaactgcagttaggcattggtcaatggaacgcgg。
the primers are utilized to obtain segments serA, serC and serB respectively by a PCR method. The fusion fragment serACB is obtained by using the fragments serA, serC and serB obtained as above as templates and serA-F/serB-R as primers through a fusion PCR method, and is subjected to double digestion by XbaI and ptsI and then is connected to a vector pTrc-9 to obtain a plasmid pTrc-11.
PCR conditions were as follows: keeping the temperature at Step 194 ℃ for 4min, Step 294 ℃ for 30s, Step 360 ℃ for 30s, Step 472 ℃ for 1min, Step 572 ℃ for 10min and Step 64 ℃.
Fusion PCR conditions and methods: (1) ddH2O28. mu.L, template 13. mu.L, template 23. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 10 cycles, and Step 572 deg.C for 10 min. (2) ddH2O30. mu.L, template 1. mu.L, Fastpfu buffer 10. mu.L, Fastpfu 1. mu.L, primer 11.5. mu.L, primer 21.5. mu.L, dNTP 5. mu.L. Step 194 deg.C for 4min, Step 294 deg.C for 30s, Step 353 deg.C for 30s, Step 472 deg.C for 1.5min, 30 cycles, and Step 572 deg.C for 10 min.
A double enzyme digestion system: gene serACB or plasmid p pTrc-920. mu.L, BamHI 1. mu.L, XbaI 1. mu.L, 10 XBuffer 5. mu.L, ddH2O23. mu.L, reacted at 37 ℃ for 1 h.
A connection system: 16. mu.L of gene serACB fragment, 1. mu.L of pTrc-9 fragment, 0.5. mu.L of T4 ligase, 2. mu.L of 10 XBuffer, and reaction at 22 ℃ for 1 h.
The plasmid pTrc-11 obtained above was electroporated into the cells of the Corynebacterium glutamicum strain constructed in (2) above. The electrotransfer conditions were: mu.l of competent cells were placed on ice, 200ng of recombinant plasmid was added, placed on ice for 30 minutes, and transferred to a 0.1cm Bio-Rad cuvette. A MicroPulser (Bio-Rad) electroporator was used. The shock parameter was voltage 1.8 kv. After the shock, the cells were immediately transferred to a cuvette with 1ml of LBHIS medium, blown 5-10 times and transferred to an EP tube, heat-shocked at 46 ℃ for 6 minutes, and then incubated at 25 ℃ for 2 hours. The bacterial suspension was spread on LBHIS plates containing chloramphenicol.
(5) Inoculating the obtained corynebacterium glutamicum engineering strain into a 250mL triangular flask containing 20-25 mL seed culture medium, and culturing for 12-16 h to a logarithmic phase. The cells were then harvested by centrifugation, suspended in fresh fermentation medium, inoculated into a 250mL Erlenmeyer flask containing 50mL of fermentation medium, and the OD was started6000.8 to 1.2, and 5 to 15g/L of CaCO3. The fermentation conditions are 32 ℃, 150-200 rpm, and the constant temperature shaking culture is carried out. The fermentation medium is as follows: 50-60 g/L glucose, 0.1-0.2 g/L urea, 5-10 g/L corn steep liquor, 15-20 g/L ammonium sulfate and KH2PO4 5～6g/L，MgSO4·7H2O 2～5g/L，FeSO4·7H2O 0.2～0.5g/L，MnCl2·4H2O 0.2～0.4g0.2-0.4 mg/L biotin, 11-2 mg/L vitamin B, 61-2 mg/L vitamin B, CaCO35-15 g/L of buffer used for fermentation medium. The seed culture medium comprises 10-20 g/L glucose, 0.1-0.2 g/L urea, 15-20 g/L corn steep liquor, 15-20 g/L ammonium sulfate and 6.5-7.0 pH. Finally, 50-60 g/L glucose is used as a substrate, and the L-cysteine content reaches 800-1000 mg/L after fermentation for 3-4 days.
Sequence listing
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> method for high yield of L-cysteine by corynebacterium glutamicum through metabolic engineering
<130> 2018
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 945
<212> DNA
<213> Arabidopsis thaliana
<400> 1
atggctacct gcatcgacac ctgccgcacc ggcaacaccc aggacgacga ctcccgcttc 60
tgctgcatca agaacttctt ccgcccaggc ttctccgtta accgcaagat ccaccacacc 120
cagatcgagg acgatgacga cgtatggatc aagatgctgg aggaggctaa gtccgacgtt 180
aagcaggagc caatcctgtc caactactac tacgcttcca tcacctccca ccgctccctg 240
gagtccgctc tggctcacat cctgtccgtt aagctgtcca acctgaacct gccatccaac 300
accctgttcg agctgttcat ctccgttctg gaggagtccc cagagatcat cgagtccacc 360
aagcaggacc tgatcgctgt taaggagcgc gacccagctt gcatctccta cgttcactgc 420
ttcctgggct tcaagggctt cctggcttgc caggctcacc gcatcgctca caccctgtgg 480
aagcagaacc gcaagatcgt tgctctgctg atccagaacc gcgtttccga gtccttcgct 540
gttgacatcc acccaggcgc taagatcggc aagggcatcc tgctggacca cgctaccggc 600
gttgttatcg gcgagaccgc tgtagttggc gacaacgtaa gcatcctgca cggcgttacc 660
ctgggcggca ccggcaagca gtccggcgac cgccacccaa agatcggcga cggcgttctg 720
atcggcgctg gctcctgcat cctgggcaac atcaccatcg gcgagggcgc taagatcggc 780
tccggctccg ttgttgttaa ggacgttcca gctcgcacca ccgctgttgg caacccagct 840
cgcctgatcg gcggcaagga gaacccacgc aagcacgaca agatcccatg cctgactatg 900
gaccagacct cctacctgac cgagtggtcc gactacgtta tctaa 945

Claims (2)

1. A corynebacterium glutamicum engineering strain for high-yield L-cysteine, which is characterized in that: is constructed by the following method: using corynebacterium glutamicum as a host strain; knock-out of L-cysteine desulfhydrase geneaecD；Expressing serine acetyltransferase gene cysE mutant M201R from Escherichia coli; expressing a transporter Bcr of Escherichia coli; modification of a serine module: expressing the genes 3-phosphoglycerate dehydrogenase serA, phosphoserine transaminase serC and phosphoserine phosphorylase serB; knock-out of L-serine dehydratase genesdaA(ii) a Reducing the expression of the glycine hydroxymethyltransferase gene glyA.
2. A method for producing L-cysteine with high yield by using the engineered strain of Corynebacterium glutamicum as described in claim 1, wherein the L-cysteine is produced by using the engineered strain of Corynebacterium glutamicum as follows: the method comprises the following specific steps: inoculating the corynebacterium glutamicum engineering strain into a 250mL triangular flask containing 20-25 mL seed culture medium, and culturing for 12-16 h to a logarithmic phase; then centrifugally collecting cells, suspending the cells with fresh fermentation medium, inoculating the cells into a 250mL triangular flask containing 50mL fermentation medium, starting with an OD600 of 0.8-1.2, and adding 5-15 g/LCaCO3(ii) a Carrying out constant-temperature shaking culture under the fermentation condition of 32 ℃ and 150-200 rpm; the fermentation medium is as follows: 50-60 g/L glucose, 0.1-0.2 g/L urea, 5-10 g/L corn steep liquor, 15-20 g/L ammonium sulfate and KH2PO4 5～6g/L，MgSO4·7H2O 2～5g/L，FeSO4·7H2O 0.2～0.5g/L，MnCl2·4H20.2-0.4 g/L of O, 0.2-0.4 mg/L of biotin, and vitamin B11-2 mg/L of vitamin B6 1～2mg/L，CaCO35-15 g/L of buffer used for the fermentation medium; the seed culture medium comprises 10-20 g/L glucose, 0.1-0.2 g/L urea, 15-20 g/L corn steep liquor, 15-20 g/L ammonium sulfate and 6.5-7.0 pH.
CN201811183104.5A 2018-10-11 2018-10-11 Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation Active CN111040979B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811183104.5A CN111040979B (en) 2018-10-11 2018-10-11 Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811183104.5A CN111040979B (en) 2018-10-11 2018-10-11 Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation

Publications (2)

Publication Number Publication Date
CN111040979A CN111040979A (en) 2020-04-21
CN111040979B true CN111040979B (en) 2022-05-10

Family

ID=70229028

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811183104.5A Active CN111040979B (en) 2018-10-11 2018-10-11 Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation

Country Status (1)

Country Link
CN (1) CN111040979B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112301050A (en) * 2019-07-26 2021-02-02 浙江大学 Method for constructing high-yield glutathione recombinant strain and application
CN111019877B (en) * 2019-12-31 2022-04-19 浙江工业大学 Genetically engineered bacterium for producing L-cysteine, construction method and application
CN113621638A (en) * 2021-09-02 2021-11-09 浙江华睿生物技术有限公司 Method for constructing Escherichia coli producing L-serine
CN113788881B (en) * 2021-11-15 2022-02-11 中国科学院天津工业生物技术研究所 Cysteine transporter mutant and application thereof in production of L-cysteine
CN114958704B (en) * 2022-06-17 2023-09-05 中国科学院天津工业生物技术研究所 Genetically engineered bacterium for producing L-cysteine

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102498216A (en) * 2009-08-25 2012-06-13 味之素株式会社 PRocess for production of L-amino acid
CN108330095A (en) * 2018-03-01 2018-07-27 江南大学 It is a kind of accumulation N-acetyl-neuraminate recombination Corynebacterium glutamicum and its application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102498216A (en) * 2009-08-25 2012-06-13 味之素株式会社 PRocess for production of L-amino acid
CN108330095A (en) * 2018-03-01 2018-07-27 江南大学 It is a kind of accumulation N-acetyl-neuraminate recombination Corynebacterium glutamicum and its application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Engineering of Escherichia coli L-serine O-acetyltransferase on the basis of crystal structure: desensitization to feedback inhibition by L-cysteine;Y.Kai等;《Protein Engineering,Design Selection》;20060203;摘要 *
Masaru Wada等.Puri¢cation, characterization and identi¢cation of cysteine desulfhydrase of Corynebacterium glutamicum, and its relationship to cysteine production.《FEMS Microbiology Letters》.2002, *
Metabolic Engineering of Corynebacterium glutamicum for L-Serine Production;Petra Peters-Wendisch等;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;20051231;摘要 *
Metabolic pathways and biotechnological production of L-cysteine;Masaru Wada等;《Appl Microbiol Biotechnol》;20061005;第51页右栏第2-3段，第52页左栏第3段，第53页左栏第2段，图3 *

Also Published As

Publication number Publication date
CN111040979A (en) 2020-04-21

Similar Documents

Publication Publication Date Title
CN111040979B (en) Method for high-yield production of L-cysteine by corynebacterium glutamicum through metabolic engineering transformation
CN111197021B (en) Recombinant corynebacterium glutamicum with improved L-lysine yield and construction method thereof
AU2018293281B2 (en) Novel aspartokinase mutant and method for production of L-amino acid using same
US20060148041A1 (en) Method for fermentative production of amino acids and amino acid derivatives of the phosphoglycerate family
CA2951019C (en) A microorganism of genus corynebacterium having an ability to produce l-arginine and a method for producing l-arginine using the same
CN108504613B (en) L-homoserine production strain and construction method and application thereof
CN110982772B (en) Corynebacterium capable of producing valine at high yield and construction method and application thereof
CN110317766B (en) Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application
CN109055289B (en) Recombinant escherichia coli for high yield of L-methionine and application thereof
CN112877270B (en) Genetic engineering bacterium for producing hydroxyl tetrahydropyrimidine and application thereof
CN102002472A (en) Microorganism producing O-acetyl-homoserine and the method of producing O-acetyl-homoserine using the microorganism
CN112063572B (en) Recombinant escherichia coli capable of highly producing O-acetyl-L-homoserine and application thereof
CN111705030B (en) Escherichia coli genetic engineering bacterium capable of producing L-homoserine with high yield, construction method and strain
CN110982768B (en) Recombinant corynebacterium glutamicum capable of enhancing L-leucine synthesis capacity of pyruvic acid and application thereof
KR101689451B1 (en) Recombinant microorganisms of escherichia with l-threonine productivity and method of producing l-threonine using the same
CA3035466C (en) Corynebacterium for producing l-lysine by fermentation
CN112592875A (en) Homoserine producing strain and construction method and application thereof
CN112779200B (en) Genetically engineered bacterium for high yield of L-methionine and construction and application thereof
CN110872595B (en) Acid-resistant expression cassette and application thereof in fermentation production of organic acid
CN111019877B (en) Genetically engineered bacterium for producing L-cysteine, construction method and application
JPWO2013154182A1 (en) Amino acid production method
JP7407941B2 (en) O-phosphoserine excretion protein variant, and method for producing O-phosphoserine, cysteine and derivatives thereof using the same
KR102377745B1 (en) Novel promoter and use thereof
JP7293409B2 (en) Method for producing sulfur-containing amino acid or derivative thereof
KR102472559B1 (en) A method of producing sulfur-containing amino acids and derivatives thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20240507

Address after: No. 15 West 8th Road, Airport Economic Zone, Binhai New Area, Tianjin, 300308

Patentee after: Tianjin National Synthetic Biotechnology Innovation Center Co.,Ltd.

Country or region after: China

Address before: No.32, Xiqi Road, Airport Economic Zone, Binhai New Area, Tianjin 300308

Patentee before: TIANJIN INSTITUTE OF INDUSTRIAL BIOTECHNOLOGY, CHINESE ACADEMY OF SCIENCES

Country or region before: China