CN110283901A - MiRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease - Google Patents
MiRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease Download PDFInfo
- Publication number
- CN110283901A CN110283901A CN201910678056.5A CN201910678056A CN110283901A CN 110283901 A CN110283901 A CN 110283901A CN 201910678056 A CN201910678056 A CN 201910678056A CN 110283901 A CN110283901 A CN 110283901A
- Authority
- CN
- China
- Prior art keywords
- mirna
- heart disease
- diagnosis
- coronary heart
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of miRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease, are related to disease marker field.The miRNA probe compositions for being used for diagnosis of coronary heart disease include miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p, can have the advantages that good stability, high sensitivity, high specificity, diagnostic window phase are short as the diagnosis marker of early coronary disease.For expanding the Primer composition of miRNA probe compositions, there is good specificity.The diagnosis of coronary heart disease kit can be realized the early prevention of coronary heart disease, avoid developing coronary heart disease to advanced stage using above-mentioned miRNA probe compositions as test object.
Description
Technical field
The present invention relates to disease marker fields, more particularly, to a kind of miRNA probe combinations for diagnosis of coronary heart disease
Object, Primer composition and diagnosis of coronary heart disease kit.
Background technique
Coronary heart disease is the abbreviation of coronary atherosclerotic heart disease.Coronary atherosclerosis makes luminal stenosis or closes
Plug leads to angina pectoris or myocardial infarction, also referred to as ischemic heart disease caused by myocardial ischemia, anoxic or necrosis.Coronary heart disease mistake
Journey is slowly and complicated, and early stage coronary heart disease, usually not clinical symptoms, patient does not have significant discomfort, thus can not cause
Enough attention, so that missing optimal treatment healing period.Once artery hardens, fibrous plaque is formed, then patient
The state of an illness can not just reverse.Therefore, although coronary heart disease research has been achieved with certain progress, caused morbidity and mortality
Growth trend never stop.There is the reason of above phenomenon, be a lack of after all chd prevention and diagnosis method and
Drug.The ratio of the appearance such as existing plasma proteins such as C reactive protein, vWF ELISA is later, can only check disease
The lesion in latter stage in disease.Simultaneously as patient personal considerations, Disease background etc. mix influence and its specific not strong spy
Point, the diagnosis of these protein markers and prognostic value are restricted.Therefore, the more therapy target of core and quicker is found
Accurately early diagnosis marker is imperative for sense.
In view of this, the present invention is specifically proposed.
Summary of the invention
The first object of the present invention is to provide a kind of miRNA probe compositions for diagnosis of coronary heart disease, this is used to be preced with
The miRNA probe compositions of heart trouble diagnosis alleviate the mark existing in the prior art for lacking one kind and capable of early diagnosing coronary heart disease
The problem of will object.
The second object of the present invention is to provide a kind of for expanding the above-mentioned miRNA probe combinations for diagnosis of coronary heart disease
The Primer composition of object, the Primer composition specificity is good, and mismatch rate is low.
The third object of the present invention is to provide a kind of diagnosis of coronary heart disease kit, the kit high sensitivity, specificity
By force, the diagnostic window phase is short, can diagnose early coronary disease.
In order to solve the above technical problems, spy of the present invention adopts the following technical scheme that
According to an aspect of the present invention, the present invention provides a kind of miRNA probe compositions for diagnosis of coronary heart disease,
Including miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p；
Wherein, miRNA-29a-3p is as shown in SEQ ID NO.1；MiRNA-574-3p is as shown in SEQ ID NO.2；
MiRNA-574-5p is as shown in SEQ ID NO.3.
Preferably, miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p derive from peripheral blood.
Preferably, when the content of miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p in the sample of subject
It is increased compared to normal value, determines that subject suffers from coronary heart disease.
According to another aspect of the present invention, it is above-mentioned for diagnosis of coronary heart disease for expanding that the present invention also provides a kind of
The Primer composition of miRNA probe compositions, comprising:
For expanding the primer of miRNA-29a-3p, primer P1 and such as SEQ including the sequence as shown in SEQ ID NO.4
The primer P2 of sequence shown in ID NO.5；
For expanding the primer of miRNA-574-3p, primer P3 and such as SEQ including the sequence as shown in SEQ ID NO.6
The primer P4 of sequence shown in ID NO.7；
For expanding the primer of miRNA-574-5p, primer P5 and such as SEQ including the sequence as shown in SEQ ID NO.8
The primer P6 of sequence shown in ID NO.9.
Preferably, the Primer composition further includes the primer for expanding reference gene；
Preferably, the reference gene includes U6 or cel-miRNA-39；
Preferably, the primer for expanding reference gene U6 includes the primer P7 and such as of the sequence as shown in SEQ ID NO.10
The primer P8 of sequence shown in SEQ ID NO.11.
Preferably, the primer in the Primer composition is by modification.
According to another aspect of the present invention, the present invention also provides a kind of diagnosis of coronary heart disease kit, which is examined
Disconnected kit is by detecting the miRNA probe compositions for diagnosis of coronary heart disease described above, to judge whether subject suffers from
There is coronary heart disease；
Preferably, the detection sample of the diagnosis of coronary heart disease kit includes blood plasma.
Preferably, the diagnosis of coronary heart disease kit is used for coronary disease using fluorescent quantitative poly chain reaction detection is described
The miRNA probe compositions of disease diagnosis.
Preferably, the diagnosis of coronary heart disease kit includes above-mentioned Primer composition.
Preferably, the diagnosis of coronary heart disease kit further includes detection working solution, and the detection includes expanding with working solution
Increase a effective amount of buffer, enzyme, fluorescent dye, primer and dNTP.
Compared with prior art, the invention has the following beneficial effects:
MiRNA probe compositions provided by the present invention for diagnosis of coronary heart disease are with the relevant circulation miRNA of coronary heart disease
Probe has the advantages that good stability, high sensitivity, high specificity, diagnostic window phase are short, can be diagnosed to be early coronary disease.
This for diagnosis of coronary heart disease miRNA probe compositions in circulation miRNA include miRNA-29a-3p, miRNA-574-3p and
MiRNA-574-5p, diagnosis rate can be greatly improved by carrying out diagnosis by the Conjoint Analysis of multiple circulation miRNA, be had higher
Diagnostic value；And miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p joint are used as examines for coronary heart disease
Disconnected miRNA probe compositions can detecte significant expression difference in corresponding control group sample, through being repeated several times
It tests, the expression difference between sample presents stable as a result, not being widely varied, and the accuracy of diagnosis is higher.
Provided by the present invention for expanding the Primer composition of the above-mentioned miRNA probe compositions for diagnosis of coronary heart disease,
With good specificity, there is no mispairing to combine in genome；This is for expanding the above-mentioned miRNA for diagnosis of coronary heart disease
The Primer composition and general primer of probe compositions have general annealing temperature (55-60 degree), can simplify experimentation,
It is convenient for batch experiment.
Diagnosis of coronary heart disease kit provided by the invention, by detecting the above-mentioned miRNA probe groups for diagnosis of coronary heart disease
Object is closed, to judge whether subject suffers from coronary heart disease, the kit is with conventional with protide polysaccharide marker diagnostic reagent
Box is compared, and carrying out medical diagnosis on disease with miRNA has many advantages, such as that high sensitivity, high specificity, diagnostic window phase are short, and can be carried out fast
Fast effective detection, can be not only used for diagnosing, and can be carried out the state of an illness and curative effect monitoring, can be realized the early prevention of coronary heart disease, keep away
Heart trouble without a hat on develops to advanced stage.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Figure 1A is the qRT-PCR quantitative analysis figure of miRNA-1-3p in the embodiment of the present invention；
Figure 1B is the qRT-PCR quantitative analysis figure of miRNA-29a-3p in the embodiment of the present invention；
Fig. 1 C is the qRT-PCR quantitative analysis figure of miRNA-133b in the embodiment of the present invention；
Fig. 1 D is the qRT-PCR quantitative analysis figure of miRNA-134-3p in the embodiment of the present invention；
Fig. 1 E is the qRT-PCR quantitative analysis figure of miRNA-197-5p in the embodiment of the present invention；
Fig. 1 F is the qRT-PCR quantitative analysis figure of miRNA-206 in the embodiment of the present invention；
Fig. 1 G is the qRT-PCR quantitative analysis figure of miRNA-574-3p in the embodiment of the present invention；
Fig. 1 H is the qRT-PCR quantitative analysis figure of miRNA-574-5p in the embodiment of the present invention；
Fig. 1 I is the qRT-PCR quantitative analysis figure of miRNA-765 in the embodiment of the present invention；
Fig. 2A is the correlation analysis of miRNA-29a-3p and miRNA-574-3p in the embodiment of the present invention；
Fig. 2 B is the correlation analysis of miRNA-29a-3p and miRNA-574-5p in the embodiment of the present invention；
Fig. 2 C is the correlation analysis of miRNA-574-3p and miRNA-574-5p in the embodiment of the present invention；
The ROC data analysis that Fig. 3 is each miRNA and combinations thereof in the embodiment of the present invention.
Specific embodiment
Technical solution of the present invention is clearly and completely described below in conjunction with embodiment, it is clear that described reality
Applying example is a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, the common skill in this field
Art personnel every other embodiment obtained without making creative work belongs to the model that the present invention protects
It encloses.
According to an aspect of the present invention, the present invention provides a kind of miRNA probe compositions for diagnosis of coronary heart disease,
MiRNA probe compositions provided by the present invention for diagnosis of coronary heart disease are the relevant circulation miRNA of coronary heart disease.MiRNA is one
Kind of length is about the non-coding tiny RNA of 18-24 nucleotide, can regulate and control bion development, cell Proliferation, differentiation, apoptosis,
Physiology and the pathologic processes such as hormone, lipid metabolism and tumour generation.It is also proved to contain in body fluid (such as blood plasma, urine, sweat)
There are miRNA, referred to as circulation miRNA.Circulation miRNA usually by some particles wrap up or with some protein bindings, thus surely
Surely be present in body fluid, from be degraded or extreme environment inactivation.Meanwhile the detection for recycling miRNA has high susceptibility
And specificity, so that circulation miRNA has the significant advantage as diagnostic probe.Compared with conventional protide diagnostic probe,
Carrying out medical diagnosis on disease with circulation miRNA, good, high sensitivity, high specificity, diagnostic window phase are short (latent in morbidity with stability
Phase or early stage can make diagnosis) the advantages that, it can be not only used for diagnosing, and can be carried out the state of an illness and curative effect evaluation.
Coronary heart disease is mainly caused by coronary atherosclerosis, after unstable plaque rupture in artery, relevant cell
In miRNA can be discharged into blood circulation, while these cells are also possible to receive the miRNA in blood circulation, so that hat
Unconventionality expression is presented in miRNA in cardiaopath's blood circulation.These abnormal express spectras can be used for the diagnosis of coronary heart disease.
The present invention is detected to assess miRNA in blood plasma as early coronary disease using the analysis of the ROC curve of SPSS software
The feasibility and potentiality of new diagnostic tool, area (AUC) numerical value is bigger under line, illustrates their potentiality as diagnostic marker
Bigger, the specificity and accuracy of diagnosis are higher.And the miRNA primed probe as diagnosis must have in conjunction with and
The features such as specificity of expression and being stabilized property.The present invention with miRNA special primed probe to normal and pathology sample into
Row qRT-PCR compares expression quantity variation of the miRNA in normal and pathology sample, is judged by the difference of its expression quantity
Whether it has a possibility that diagnosis, and test, which is repeated several times, should obtain consistent results.By screening, the present invention filter out including
The miRNA probe compositions for diagnosis of coronary heart disease of miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p.Although
Recycling miRNA has a potentiality as diagnostic probe, but human internal environment is extremely complex and the abundance of circulation miRNA is very low, then
In addition the discrete error of sampling difference and experiment aspect, single circulation miRNA diagnosis often has certain deviation and diagnosis
Fault.Therefore, diagnosis rate can be greatly improved by carrying out diagnosis by the Conjoint Analysis of multiple circulation miRNA, have higher face
Bed diagnostic value.Wherein miRNA-29a-3p is as shown in SEQ ID NO.1；MiRNA-574-3p is as shown in SEQ ID NO.2；
MiRNA-574-5p is as shown in SEQ ID NO.3.
The present invention is from it was found that, miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p are used as being preced with
The miRNA probe compositions of heart trouble diagnosis can detecte significant expression difference, i.e. table in corresponding control group sample
It is at least 2 times or more up to amount difference, therefore as miRNA-29a-3p, miRNA-574-3p and miRNA- in the sample of subject
The content of 574-5p is increased compared to normal value, it is possible to determine that subject suffers from coronary heart disease, and wherein normal value refers to not suffering from
The content of miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p in the control group sample of coronary heart disease.The present invention provides
The miRNA probe compositions for diagnosis of coronary heart disease tested through being repeated several times, the expression difference between sample presents stable
As a result, not being widely varied, the accuracy of diagnosis is higher.
It is related after unstable plaque rupture in artery since coronary heart disease is mainly caused by coronary atherosclerosis
MiRNA in cell can be discharged into blood circulation, therefore preferably with miRNA-29a-3p, miRNA-574-3p in peripheral blood
With miRNA-574-5p as the miRNA probe compositions for being used for diagnosis of coronary heart disease.
According to another aspect of the present invention, the present invention also provides above-mentioned for diagnosis of coronary heart disease for expanding
The Primer composition of miRNA probe compositions, comprising:
For expanding the primer of miRNA-29a-3p, primer P1 and such as SEQ including the sequence as shown in SEQ ID NO.4
The primer P2 of sequence shown in ID NO.5；
For expanding the primer of miRNA-574-3p, primer P3 and such as SEQ including the sequence as shown in SEQ ID NO.6
The primer P4 of sequence shown in ID NO.7；
For expanding the primer of miRNA-574-5p, primer P5 and such as SEQ including the sequence as shown in SEQ ID NO.8
The primer P6 of sequence shown in ID NO.9.
Primer composition provided by the invention is expanding the above-mentioned miRNA probe compositions miRNA- for diagnosis of coronary heart disease
There is good specificity, there is no mispairing to combine in genome when 29a-3p, miRNA-574-3p and miRNA-574-5p；
This is used to expand the Primer composition of the above-mentioned miRNA probe compositions for diagnosis of coronary heart disease and general primer with general
Annealing temperature (55-60 degree), can simplify experimentation, is convenient for batch experiment.
In some preferred embodiments, the Primer composition further includes the primer for expanding reference gene, this
Invention does not limit the selection of reference gene, may be selected the acceptable conventional reference gene in this field, including but not limited to U6 or
Cel-miRNA-39 is, it is preferable to use more stable reference gene U6, and wherein it is preferable to use following primer amplification, effects by reference gene U6
Fruit is more preferably: the primer P8 of the primer P7 of the sequence as shown in SEQ ID NO.10 and the sequence as shown in SEQ ID NO.11.
It is understood that the primer in primer sets provided by the invention, can part, or all by modification,
To add fluorophor, fluorescent quenching group or imparting primer other function etc., the modification can be modified the 5 ' of primer
End or 3 ' ends at 5 ' ends of primer and 3 ' ends while can also be modified, and the present invention is without limitation.In some optional implementations
Modification described in mode includes but is not limited to thio-modification, phosphorylation modification, fluorescent decoration, reversed dT is modified, internal amino is repaired
The modification such as decorations or 5- methyl dideoxycytosine.
According to another aspect of the present invention, the present invention also provides a kind of diagnosis of coronary heart disease kit, the coronary heart disease
Diagnostic kit is by detecting the above-mentioned miRNA probe compositions for diagnosis of coronary heart disease, to judge whether subject suffers from hat
Heart trouble.Diagnosis of coronary heart disease kit provided by the invention, using miRNA as diagnostic probe composition, with conventional protide polysaccharide
The diagnosis of class marker is compared, and carrying out medical diagnosis on disease with miRNA has many advantages, such as that high sensitivity, high specificity, diagnostic window phase are short,
And can quickly and effectively be detected, it can be not only used for diagnosing, and can be carried out the state of an illness and curative effect monitoring, can be realized the morning of coronary heart disease
Phase prevention, avoids developing coronary heart disease to advanced stage.
Diagnosis of coronary heart disease kit provided by the invention, to include miRNA-29a-3p, miRNA-574-3p and miRNA-
The Combining diagnosis probe system of 574-5p composition can overcome the possible error of single miRNA diagnosis, obtain more acurrate more efficient
Diagnosis system.Since miRNA relevant with coronary heart disease can be discharged into blood circulation, the diagnosis of coronary heart disease kit
Detection sample preferably includes the blood plasma of subject.
The present invention is to the diagnosis of coronary heart disease kit detection miRNA probe compositions for diagnosis of coronary heart disease
With no restrictions, the conventional method for being able to detect miRNA can be used as the diagnosis of coronary heart disease kit and realizes detection method
The side of the miRNA probe compositions for diagnosis of coronary heart disease.In some alternative embodiments, the diagnosis of coronary heart disease
The method that kit realizes the detection miRNA probe compositions for diagnosis of coronary heart disease includes but is not limited to cDNA library gram
Grand method, Northern blot method, qRT-PCR method, gene chips or high-flux sequence method etc..It is understood that according to institute
The detection method of diagnosis of coronary heart disease kit is stated, further includes matched reagent and consumptive material in kit, such as when the coronary disease
It can also include buffering in kit when sick diagnostic kit is using Northern blot method detection miRNA probe compositions
The reagents such as liquid, hybridization solution and nitrocellulose filter or consumptive material；When the miRNA with the detection of qRT-PCR method for diagnosis of coronary heart disease is visited
It can also include the reagents such as fluorescent dye, buffer, archaeal dna polymerase and dNTP in kit when injection composition；It is measured with high pass
It can also include extracting the reagent with reverse transcription for RNA and being used for when sequence method detects miRNA probe compositions, in kit
Build the reagent etc. of library sequencing.
In some preferred embodiments, the diagnosis of coronary heart disease kit uses fluorescent quantitative poly chain type
It reacts (qRT-PCR) and detects the coronary heart disease dependent diagnostic probe.QRT-PCR has higher sensitivity and specificity, can be with
Detect extremely micro circulation miRNA.QRT-PCR also overcomes the shortcomings that regular-PCR instrument, and makes product quantification, thus
It is more suitable for clinical use.It is preferable to use fluorescent dye determinations to be detected, using CT value as quantitative basis.
It in some preferred embodiments, include above-mentioned in the kit for expanding for diagnosis of coronary heart disease
The Primer composition of miRNA probe compositions, to realize that the method using qRT-PCR detects miRNA probe compositions.Using upper
The kit of composition is stated, is had when expanding miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p good special
Property, mismatch rate is low, and annealing temperature is convenient for batch experiment at 55-60 DEG C, to simplify experimentation.
In some alternative embodiments, the kit comprising above-mentioned Primer composition, also comprising for qRT-PCR's
Reagent, the reagent include but is not limited to buffer, enzyme preparation and dNTP etc., optionally, primer sets and buffer, enzyme preparation and
Other preparations such as dNTP can packaging independently；More preferably some schemes are that the kit also includes that detection is used
Working solution, the detection include expanding a effective amount of buffer, enzyme, primer and dNTP with working solution.The amplification effective quantity refers to
Be according to qRT-PCR reaction system, i.e., sample size needed for each reaction, buffer concentration, the concentration of enzyme, primed probe are dense
Degree etc., each ingredient that experimental system is related to mix, and allow the content for detecting each component in working solution after template is added, directly
It connects and is reacted for quantitative fluorescent PCR.Working solution is set in diagnosis of coronary heart disease kit, when using the kit, need to only be added
QRT-PCR can be carried out by entering sample cDNA, convenient and efficient.Optionally, RNA extraction and transcriptive process,reversed can also be added in kit
Relevant buffering agents etc..
In some alternative embodiments, the diagnosis of coronary heart disease kit further includes kit package part and experiment
Consumptive material etc., laboratory packaged unit include but is not limited to kit package box, reagent bottle and reagent kit product specification etc., explanation
The points for attention such as kit main application, operating process, experimental principle, sample requirement and storage requirement are preferably recorded in book；It is real
Testing consumptive material includes but is not limited to the experiment consumptive material such as microcentrifugal tube, PCR reaction vessel and liquid-transfering gun pipette tips.
Technical solution of the present invention and beneficial effect are further illustrated below with reference to preferred embodiment.
Embodiment
A kind of kit for diagnosis of coronary heart disease is present embodiments provided, which is intended to specifically find and examine
Disconnected coronary heart disease, realizes early prevention, avoids developing coronary heart disease to advanced stage.Kit primary specificity in the present embodiment is for hat
The miRNA of heart trouble is expanded, and detects miRNA using qRT-PCR method.Examination provided in this embodiment for diagnosis of coronary heart disease
For agent box using patients blood plasma as detection sample, the case that the present embodiment selects receives coronary angiography for typical patients with coronary heart disease
Patients with coronary heart disease, be collected simultaneously the control group patient of non-coronary heart disease, the relevant clinical data of patient is complete.With such as 1 institute of table
The miRNA stated is as the miRNA probe compositions for being used for diagnosis of coronary heart disease.Kit provided in this embodiment further includes for expanding
Increase the Primer composition of miRNA and reference gene as described in Table 1, Primer composition is as shown in table 2:
Table 1 is used for the miRNA probe compositions of diagnosis of coronary heart disease
| Probe | Sequence (5'-3') | Number |
| miRNA-29a-3p | UAGCACCAUCUGAAAUCGGUUA | SEQ ID NO.1 |
| miRNA-574-3p | CACGCUCAUGCACACACCCACA | SEQ ID NO.2 |
| miRNA-574-5p | UGAGUGUGUGUGUGUGAGUGUGU | SEQ ID NO.3 |
Table 2 is used to expand the primer of miRNA and reference gene as described in Table 1
The application method of kit provided in this embodiment: Fluorescence quantitative real-time polymerase chain reaction condition is used
(qRT-PCR) method is designed three pairs of primers for above three miR-96 gene, is obtained with patient's peripheral blood miRNA reverse transcription
CDNA is template, is expanded by taking turns PCR to target miRNA, and then detect to its expression quantity more, and specific includes such as
Lower step:
The extraction of patients with coronary artery disease peripheral blood blood plasma RNA: step a extracts patients with coronary artery disease peripheral blood 5ml and is placed in EDTA-
In anticoagulant tube, 10min is centrifuged with 3000rpm in horizontal centrifuge.After centrifugation, draw in upper plasma and 1.5ml EP pipe,
MiRNA in blood plasma is extracted with Trizol method, wherein the adding proportion of blood plasma and Trizol reagent is 1:3.
The reverse transcription of blood plasma miRNA: step b utilizes the mir-X of ClontechTMmiRNA First-Strand
Synthesis Kit carries out reverse transcription to miRNA is obtained.The cDNA that reverse transcription obtains is spare in -20 DEG C of placements.
Step c, qRT-PCR reaction condition: each reaction needs to carry out 3 repetitions, i.e. 3 parallel laboratory tests.Reaction condition
Are as follows:
98 DEG C of acquisition melting curves are increased to from 60 DEG C after circulation terminates.
Step d, whether using qRT-PCR method, verifying miRNA in patients with coronary artery disease and control group plasma sample has table
Up to difference.Carry out the expression pattern analysis of 3 kinds of miRNA respectively using SPSS software, obtain expression significance of difference data and
Correlation data.
Comparative example
It is expanded in non-coronary disease sufferer and patients with coronary heart disease respectively as listed in table 3 using above-mentioned qRT-PCR method method
miRNA。
The miRNA sequence and primer sequence detected in 3 comparative example of table
Experimental result is for example shown in Figure 1A -1I, 2A-2C and Fig. 3, and in Figure 1A -1I, Control is the control of non-patients with coronary heart disease
Group, CAD are patients with coronary heart disease, it can be seen from the figure that in CAD group, miRNA-29a-3p, miRNA-574-3p and miRNA-
The content of 574-5p is at least twice of control group, and content difference of other miRNAs in CAD group and control group is not
Significantly, illustrate in this 9 miRNAs, the content of miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p can be anti-
Answer whether subject suffers from coronary heart disease, miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p can be used as being preced with
The miRNA probe compositions of heart trouble diagnosis.From Fig. 2A -2C as can be seen that between miRNA-29a-3p and miRNA-574-3p；
Between miRNA-29a-3p and miRNA-574-5p；And correlation is all had between miRNA-574-3p and miRNA-574-5p
Property, illustrate that miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p have the potentiality of combined diagnosis.In Fig. 3, pass through
The AUC of ROC curve and other data, it can be found that miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p tri-
The value (accuracy and sensibility) that miRNAs is combined diagnosis is highest in all combinations.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Pipe present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its according to
So be possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features into
Row equivalent replacement；And these are modified or replaceed, various embodiments of the present invention technology that it does not separate the essence of the corresponding technical solution
The range of scheme.
SEQUENCE LISTING
<110>University Of Qingdao
<120>miRNA probe compositions, Primer composition and the diagnosis of coronary heart disease kit of diagnosis of coronary heart disease are used for
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 1
uagcaccauc ugaaaucggu ua 22
<210> 2
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 2
cacgcucaug cacacaccca ca 22
<210> 3
<211> 23
<212> RNA
<213>people (Homo sapiens
<400> 3
ugagugugug ugugugagug ugu 23
<210> 4
<211> 28
<212> DNA
<213>artificial sequence
<400> 4
ggcccctagc accatctgaa atcggtta 28
<210> 5
<211> 18
<212> DNA
<213>artificial sequence
<400> 5
cagtgcaggg tccgaggt 18
<210> 6
<211> 23
<212> DNA
<213>artificial sequence
<400> 6
ccacgctcat gcacacaccc aca 23
<210> 7
<211> 18
<212> DNA
<213>artificial sequence
<400> 7
cagtgcaggg tccgaggt 18
<210> 8
<211> 27
<212> DNA
<213>artificial sequence
<400> 8
gccctgagtg tgtgtgtgtg agtgtgt 27
<210> 9
<211> 18
<212> DNA
<213>artificial sequence
<400> 9
cagtgcaggg tccgaggt 18
<210> 10
<211> 23
<212> DNA
<213>artificial sequence
<400> 10
ctcgcttcgg cagcacatat act 23
<210> 11
<211> 22
<212> DNA
<213>artificial sequence
<400> 11
acgcttcacg aatttgcgtg tc 22
<210> 12
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 12
acauacuucu uuauaugccc au 22
<210> 13
<211> 28
<212> DNA
<213>artificial sequence
<400> 13
gccccgcaca tacttcttta tatgccca 28
<210> 14
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 14
uuuggucccc uucaaccagc ua 22
<210> 15
<211> 26
<212> DNA
<213>artificial sequence
<400> 15
gccctttggt ccccttcaac cagcta 26
<210> 16
<211> 23
<212> RNA
<213>people (Homo sapiens)
<400> 16
cggguagaga gggcaguggg agg 23
<210> 17
<211> 23
<212> DNA
<213>artificial sequence
<400> 17
cgggtagaga gggcagtggg agg 23
<210> 18
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 18
uggaauguaa ggaagugugu gg 22
<210> 19
<211> 27
<212> DNA
<213>artificial sequence
<400> 19
gcgggtggaa tgtaaggaag tgtgtgg 27
<210> 20
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 20
uagcaccauc ugaaaucggu ua 22
<210> 21
<211> 28
<212> DNA
<213>artificial sequence
<400> 21
ggcccctagc accatctgaa atcggtta 28
<210> 22
<211> 23
<212> RNA
<213>people (Homo sapiens)
<400> 22
ccugugggcc accuagucac caa 23
<210> 23
<211> 22
<212> DNA
<213>artificial sequence
<400> 23
cctgtgggcc acctagtcac ca 22
<210> 24
<211> 22
<212> RNA
<213>people (Homo sapiens)
<400> 24
cacgcucaug cacacaccca ca 22
<210> 25
<211> 23
<212> DNA
<213>artificial sequence
<400> 25
ccacgctcat gcacacaccc aca 23
<210> 26
<211> 23
<212> RNA
<213>people (Homo sapiens)
<400> 26
ugagugugug ugugugagug ugu 23
<210> 27
<211> 27
<212> DNA
<213>artificial sequence
<400> 27
gccctgagtg tgtgtgtgtg agtgtgt 27
<210> 28
<211> 21
<212> RNA
<213>people (Homo sapiens)
<400> 28
uggaggagaa ggaaggugau g 21
<210> 29
<211> 26
<212> DNA
<213>artificial sequence
<400> 29
gccggtggag gagaaggaag gtgatg 26
<210> 30
<211> 18
<212> DNA
<213>artificial sequence
<400> 30
cagtgcaggg tccgaggt 18
Claims (10)
1. being used for the miRNA probe compositions of diagnosis of coronary heart disease, which is characterized in that including miRNA-29a-3p, miRNA-574-
3p and miRNA-574-5p；
Wherein, miRNA-29a-3p is as shown in SEQ ID NO.1；MiRNA-574-3p is as shown in SEQ ID NO.2；miRNA-
574-5p is as shown in SEQ ID NO.3.
2. the miRNA probe compositions according to claim 1 for diagnosis of coronary heart disease, which is characterized in that miRNA-
29a-3p, miRNA-574-3p and miRNA-574-5p derive from peripheral blood.
3. the miRNA probe compositions according to claim 1 or 2 for diagnosis of coronary heart disease, which is characterized in that when tested
When the content of miRNA-29a-3p, miRNA-574-3p and miRNA-574-5p are increased compared to normal value in the sample of person, sentence
Subject is determined with coronary heart disease.
4. the primer sets for expanding the described in any item miRNA probe compositions for diagnosis of coronary heart disease of claim 1-3
Close object, comprising:
For expanding the primer of miRNA-29a-3p, primer P1 and such as SEQ ID including the sequence as shown in SEQ ID NO.4
The primer P2 of sequence shown in NO.5；
For expanding the primer of miRNA-574-3p, primer P3 and such as SEQ ID including the sequence as shown in SEQ ID NO.6
The primer P4 of sequence shown in NO.7；
For expanding the primer of miRNA-574-5p, primer P5 and such as SEQ ID including the sequence as shown in SEQ ID NO.8
The primer P6 of sequence shown in NO.9.
5. Primer composition according to claim 4, which is characterized in that the Primer composition further includes in expanding
Join the primer of gene；
Preferably, the reference gene includes U6 or cel-miRNA-39；
Preferably, the primer for expanding reference gene U6 includes the primer P7 and such as SEQ of the sequence as shown in SEQ ID NO.10
The primer P8 of sequence shown in ID NO.11.
6. Primer composition according to claim 4 or 5, which is characterized in that the primer in the Primer composition passes through
Modification.
7. diagnosis of coronary heart disease kit, which is characterized in that the diagnosis of coronary heart disease kit is any by detection claim 1-3
The miRNA probe compositions for diagnosis of coronary heart disease described in, to judge whether subject suffers from coronary heart disease；
Preferably, the detection sample of the diagnosis of coronary heart disease kit includes blood plasma.
8. diagnosis of coronary heart disease kit according to claim 7, which is characterized in that the diagnosis of coronary heart disease kit uses
The fluorescent quantitative poly chain reaction detection miRNA probe compositions for being used for diagnosis of coronary heart disease.
9. diagnosis of coronary heart disease kit according to claim 7, which is characterized in that the diagnosis of coronary heart disease kit includes
The described in any item Primer compositions of claim 4-6.
10. according to the described in any item diagnosis of coronary heart disease kits of claim 7-9, which is characterized in that the diagnosis of coronary heart disease
Kit further includes detection working solution, detection working solution include expand a effective amount of buffer, enzyme, fluorescent dye,
Primer and dNTP.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910678056.5A CN110283901A (en) | 2019-07-25 | 2019-07-25 | MiRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910678056.5A CN110283901A (en) | 2019-07-25 | 2019-07-25 | MiRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110283901A true CN110283901A (en) | 2019-09-27 |
Family
ID=68022530
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910678056.5A Pending CN110283901A (en) | 2019-07-25 | 2019-07-25 | MiRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110283901A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111961730A (en) * | 2020-09-27 | 2020-11-20 | 浙江大学 | MiRNA detection kit based on thio-modified loop-mediated isothermal amplification method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630339A (en) * | 2014-10-20 | 2015-05-20 | 中国医学科学院阜外心血管病医院 | Circulating miRNAs (microRNAs) for early diagnosis of acute coronary syndromes and application thereof |
| CN105030808A (en) * | 2007-07-31 | 2015-11-11 | 得克萨斯系统大学董事会 | A micro-rna family that modulates fibrosis and uses thereof |
| CN107130017A (en) * | 2017-03-31 | 2017-09-05 | 北京大学人民医院 | The purposes of kit and reagent in reagent preparation box |
| CN108165623A (en) * | 2018-01-02 | 2018-06-15 | 青岛大学 | The application of miRNA, product and detection method using it |
-
2019
- 2019-07-25 CN CN201910678056.5A patent/CN110283901A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105030808A (en) * | 2007-07-31 | 2015-11-11 | 得克萨斯系统大学董事会 | A micro-rna family that modulates fibrosis and uses thereof |
| CN104630339A (en) * | 2014-10-20 | 2015-05-20 | 中国医学科学院阜外心血管病医院 | Circulating miRNAs (microRNAs) for early diagnosis of acute coronary syndromes and application thereof |
| CN107130017A (en) * | 2017-03-31 | 2017-09-05 | 北京大学人民医院 | The purposes of kit and reagent in reagent preparation box |
| CN108165623A (en) * | 2018-01-02 | 2018-06-15 | 青岛大学 | The application of miRNA, product and detection method using it |
Non-Patent Citations (4)
| Title |
|---|
| EMANUELA BOŠTJANČIČ等: "MicroRNAs and cardiac sarcoplasmic reticulum calcium ATPase-2 in human myocardial infarction:expression and bioinformatic analysis", 《BMC GENOMICS》 * |
| JIANQING ZHOU等: "miRNA 206 and miRNA 574-5p are highly expression in coronary artery disease", 《BIOSCI. REP.》 * |
| ZHONGMENG LAI等: "MicroRNA-574-5p promotes cell growth of vascular smooth muscle cells in the progression of coronary artery disease", 《BIOMEDICINE & PHARMACOTHERAPY》 * |
| 张海涛等: "冠心病患者外周血外泌体中microRNA基因芯片的差异性表达", 《临床心血管病杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111961730A (en) * | 2020-09-27 | 2020-11-20 | 浙江大学 | MiRNA detection kit based on thio-modified loop-mediated isothermal amplification method |
| CN111961730B (en) * | 2020-09-27 | 2021-10-19 | 浙江大学 | MiRNA detection kit based on thio-modified loop-mediated isothermal amplification method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450901B (en) | The nucleic acid markers of quick diagnosis mucocutaneous lymphnode syndrome and test kit thereof | |
| Wu et al. | Plasma‐derived exosomal circular RNA hsa_circ_0005540 as a novel diagnostic biomarker for coronary artery disease | |
| CN109797222B (en) | Liver cancer diagnosis marker, detection primer, kit and application of liver cancer diagnosis marker | |
| CN110484624B (en) | Gastric cancer biomarker based on peripheral blood and detection method and application thereof | |
| CN108949990A (en) | A kind of kit and method detecting EGFR genetic mutation | |
| CN107460241B (en) | Application of exosome small-molecule RNA in acute myocardial infarction risk assessment | |
| CN110283901A (en) | MiRNA probe compositions, Primer composition and diagnosis of coronary heart disease kit for diagnosis of coronary heart disease | |
| CN106967810A (en) | The method and kit of a kind of detection FGFR3 gene mutation diagnosing bladder cancers | |
| CN106987633A (en) | A kind of primer and kit for detecting colorectal cancer serum secretion type lncRNAs | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN112522391B (en) | Application of hsa_circ_0008961 as gout diagnosis marker | |
| CN109735612A (en) | The biomolecule marker and its kit of Kawasaki disease coronary aneurysm complication | |
| KR20200015101A (en) | Method for early diagnosis of breast cancer and monitoring after treatment using liquid biopsy multi-cancer gene biomarkers | |
| CN107557466A (en) | Thrombotic disease tumor susceptibility gene combined detection kit and its genechip detection method | |
| JP7394441B2 (en) | How to test for brain tumors | |
| CN108220423A (en) | Acute myocardial infarction fast diagnosis reagent based on blood plasma miRNA and its application in diagnostic kit, appraisal procedure | |
| CN107988370A (en) | A kind of application of circRNA genes in diagnosing chronic granulocytic leukemia reagent is prepared | |
| CN113862350A (en) | Diagnosis marker hsa _ circ _0043898 in peripheral blood of spinal tuberculosis and application thereof | |
| CN107447008A (en) | For the enhancer RNA combinations of acatalepsia reason recurrent miscarriage, primer sets and application and kit | |
| KR20220028418A (en) | MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof | |
| KR20220028416A (en) | MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof | |
| CN105838779A (en) | Method for monitoring and controlling drug resistance of gastrointestinal stromal tumor patient to imatinib/sunitinib through ddPCR technology | |
| JP3901684B2 (en) | Examination method of body fluid of neuroblastoma | |
| CN110205377A (en) | The assessment in advance of Kawasaki disease risk | |
| CN113817817B (en) | Method for diagnosing allergic airway inflammation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190927 |