CN105030808A - A micro-rna family that modulates fibrosis and uses thereof - Google Patents

Abstract

The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease.

Description

Micro-rna family of that modulates fibrosis and uses thereof

The divisional application that the application is the applying date is on July 31st, 2008, Chinese application number is 200880109703.0, denomination of invention is the patent application of " micro-rna family of that modulates fibrosis and uses thereof ".

To the cross reference of related application

This application claims the U.S. Provisional Application No.60/952 submitted on July 31st, 2007,917; The U.S. Provisional Application No.60/980 that on October 16th, 2007 submits to, 303; With the U.S. Provisional Application No.61/047 that on April 22nd, 2008 submits to, the rights and interests of 014, by addressing by they all complete incomes herein.

About the statement of government-funded

The present invention makes under the subsidy of the appropriation No.HL53351-06 from (U.S.) NIH (NIH).Government has some right of the present invention.

About the explanation of the text that electronics is submitted to

By addressing by the content intact income of the text submitted to this electronics herein: the computer-readable format of sequence table copies (filename: UTFD_2021WO.txt, record day: on July 30th, 2008, file size 5 kilobytes).

Invention field

Generally speaking, the present invention relates to developmental biology and biology field.In particular, it pays close attention to miR-29 family to the gene regulation in fibroblast and cell physiological.This miRNA family, at collagen deposition, plays a significant role in the collagen deposition particularly mediated by fibroblast.

Background of invention

Heart disease and performance thereof, comprise coronary heart disease, myocardial infarction, congestive heart failure and cardiac hypertrophy, knows and represent a current Major health risk of the U.S..The cost that the patient of these diseases is suffered from diagnosis, treatment and support reaches multi-million dollar completely.The performance of cardiopathic two especially severes is myocardial infarction and cardiac hypertrophy.With regard to myocardial infarction, typically, due to atherosclerosis, in coronary artery, there is acute thrombocytopaenic coronary occlusion, cause cardiomyocyte cell death.Because myocardial cell, i.e. cardiac muscle cells, is end differentiation eventually and generally ability does not carry out cell division, so they are generally replaced by scar tissue when they are dead during acute myocardial infarction process.Scar tissue does not have contractility, is helpless to cardiac function, and often through during systole expanding, or pass through the size and the effective radius that increase ventricle, such as become loose, and play illeffects in cardiac function.Although initial collagen deposition is infarction healing and prevents required for rupture of heart, fibroblast continues to generate around the myocyte of collagen in infarction marginal zone and the distal myocardium (remotemyocardium) of infarcted hearts brings out interstitial fibrosis.Due to the increase of pressure, this fibrosis brings out stiff, diastolic dysfunction and cardiac myocyte hypertrophy, and can also cause arrhythmia (arrythmias).

Cardiac hypertrophy is heart to the adaptability response of in fact form of ownership heart disease (comprise those and be derived from genetic mutation in hypertension, mechanical load, myocardial infarction, heart arrhythmias, endocrine disorder and cardiac contractile proteins gene).Although hypertrophy response is improve kinemic compensatory mechanism at first, lasting hypertrophy can cause DCM (dilated cardiomyopathy) (DCM), heart failure and sudden death.In the U.S., have about 500,000 people to diagnose out heart failure every year, mortality rate is close to 50%.The cause and effect of cardiac hypertrophy is extensively proved, but basic molecular mechanism is not yet illustrated.Understanding these mechanism is great focus in cardiopathic prevention and therapy, and can be vital as the treatment form in the novel drugs of the selectively targeted cardiac hypertrophy of design and heart heart failure.

The main mechanism for alleviating or eliminate heart failure performance is represented with the treatment that pharmacological agent is carried out.Diuretic constitutes slightly to the first-line treatment of moderate heart failure.If diuretic is invalid, so vasodilator can be used, such as angiotensin converting enzyme (ACE) inhibitor (such as enalopril and lisinopril) or muscular strength medication (namely improving kinemic medicine by improving myocardium muscle contraction power).Unfortunately, many in these standard treatments have numerous untoward reaction, and are taboo in some patient.So, the pharmacological agent of current use has major defect in particular patient group.New, safety and the availability of effective medicament can benefit the patient that can not use current available pharmacology's form or the patient not obtaining enough alleviations from those forms undoubtedly.

Myocardial cell surrounded by the fine network of collagen fiber in normal condition.Response pathologic pressure, cardiac fibroblast and extracellular matrix proteins are disproportionately and exceedingly accumulate.Myocardial fibrosis, i.e. a feature of form of ownership pathologic hypertrophy, cause machinery stiff, this facilitates contractile dysfunction (Abraham etc., 2002).Another mark of pathologic hypertrophy and heart failure is reactivating one group of heart of fetus gene (comprising those codings atrial natriuretic peptide (ANP), BNP (BNP) and contractile protein fetus isoform such as skeleton α-actin and β-myoglobulin heavy chain (MHC)).These genes are contained usually after birth, and are replaced (McKinsey and Olson, 2005) by the expression of a composition human heart gene.Fetus gene expression is understood not yet completely to cardiac function and the consequence (such as fibrosis) reinvented.But, propose response pressure and the β-MHC (one is ATP enzyme at a slow speed) that occurs be in harmonious proportion α-MHC (a kind of rapid desufflation ATP enzyme) and lower the reduction (Bartel relating to cardiac function, 2004), and known BNP play in cardiac fibrosis dominant trait effect.

Outside cardiac fibrosis, have many diseases or illness relevant with the fibrosis of various tissue.Congenital hepatic fibrosis (a kind of autosomal recessive disease) is a kind of rare heredopathia affecting both liver and kidney.The feature of this disease is that liver is abnormal, such as hepatomegaly, door hypertension and the fiber-like connective tissue (hepatic fibrosis) throughout whole liver.Pulmonary fibrosis (or lung cicatrization) is derived from normal lung air bag and is replaced by fibrotic tissue gradually.When cicatrization, organize thickening, the ability causing tissue transport oxygen to enter blood flow is irreversibly lost.The reaction (because of heredity susceptible) that to be the fibrotic process in lung tissue be to lung microscopic damage of most popular idea.Although still do not know definite cause, draw relevant with therapeutic radiation with the environment sucked and professional pollutant, smoking, disease (such as scleroderma, rheumatoid arthritis, lupus and sarcoidosis), some medication.

Scleroderma is a kind of chronic disease being characterized as collagen over-deposit in skin or other organ.Although the limitation type of this disease makes people lose ability, not too can be fatal.As the result of the heart, kidney, lung or damage of intestines, systemic type or systemic sclerosis (it is the general type of this disease) can be fatal.Scleroderma affects skin, and when more serious, it can affect blood vessel and internal organs.

Skeletal muscle fiber is the phenomenon usually occurred in ill or injured muscle.It is with the undue growth of fibrous tissue for feature, and this is derived from the attempt that health is attempted from injury recovery usually.Fibrosing lesion muscle function also causes weakness.The degree that muscle function is lost generally increases with Fibrotic degree.The victim of muscular dystrophy (particularly Bake (Becker) muscular dystrophy (BMD) and the performance of more seriously deep allele, Di Xienei (Duchenne) muscular dystrophy (DMD)) usually suffers from increasing skeletal muscle fiber along with progression of disease.Other slight illness known (such as denervation atrophy) causes skeletal muscle fiber, and neuromuscular disease, such as acute polyneuritis, poliomyelitis, Werdig/Hoffman disease, amyotrophic lateral sclerosis (LouGehrig is sick) and gradual oblongata atrophy disease.

Nearest proposition Microrna relates to regulate several biological processes, comprises the adjustment to growth opportunity, apoptosis, lipid metabolism and hematopoetic cell differentiation etc.Microrna (miR) refers to derivative from usually to encode the polycistronic transcription thing of multiple closely related miRNA, the intron of protein coding gene or each miR-96 gene, and length is about 18 small-sized, nonprotein coding RNAs to about 25 nucleotide.See (2003) such as summary Carrington.MiR plays the repressor of target thing mRNA, and this is by promoting their degraded (when their sequence is preferably complementary) or realizing by suppressing to translate (when containing mispairing when their sequence).

MiRNA is by rna plymerase ii (polII) or rna plymerase iii (polIII; See (2006) Cellular & MolecularImmunologyVol.3:411-419 such as Qi) transcribe, and be derived from the primary transcript being called elementary miRNA transcript (pri-miRNA), their general long number kilobase.Pri-miRNA is processed into about 70 hair clip shape precursors (pre-miRNA) to about 100 nucleotide by RNA enzyme Drosha in nucleus.After being transported to Cytoplasm, hair clip pre-miRNA is processed to generate double-strand miRNA by Dicer further.Then ripe miRNA chain is mixed the silencing complex (RISC) of RNA induction, it is combined with its said target mrna by base-pair complementarity there.When the perfect base pairing of relatively rare, miRNA and mRNA target thing, its promotes mRNA degraded.More commonly, miRNA and said target mrna form faulty heteroduplex, thus affect mRNA stability or suppress mRNA translation.

The 5' part of crossing over the miRNA of base 2-8 (being called " seed " district) is (Krenz and Robbins, 2004 that are even more important for the identification of target thing; Kiriazis and Kranias, 2000).The sequence of seed forms many bases when front target thing forecast model together with the system generation conservative of target sequence.Although can obtain the increasing abstruse calculating means for predicting miRNA and target thing thereof, the prediction of target thing remains a significant challenge, and needs experimental verification.The function of miRNA is attributed to the adjustment of specific mRNA target thing because of the ability of each miRNA and hundreds of potential height and the base pairing of low-affinity mRNA target thing and make each mRNA of multiple miRNA targeting become more complicated.The understanding to miRNA function strengthened can disclose undoubtedly facilitate normal development, differentiation, iuntercellular and intracellular communication, cell cycle, blood vessel occur, the regulating networks of apoptosis and other cell processes many.Recently, inventor reports a kind of heartspecific Microrna, miR-208, it is encoded by the intron of α-myoglobulin heavy chain (MHC) gene, and be response cardiac pressure and raise (see common pendent application WO2008/016924, by the addressing by its complete income herein) required for the quick skeletal muscle gene in β-MHC expression and containment heart.Present invention specifies the participation of Microrna in heart and other tissue.

Summary of the invention

The present invention is based on following discovery, namely miR-29 family (its in heart response pressure and lower) regulates collagen deposition and fibrosis (comprising cardiac fibrosis) to be formed.MiR-29a-c expresses or the rise of function causes the expression of collagen and fibrin gene to reduce, and causes the cardiac fibrosis reduced.Thus, the invention provides a kind ofly is having the method for the treatment of cardiac fibrosis, cardiac hypertrophy or heart failure in required experimenter, comprises the experimenter that qualification has cardiac fibrosis, cardiac hypertrophy or heart failure; And use the agonist of miR-29a-c expression or function to described experimenter.In one embodiment, described miR-29a-c agonist is the polynucleotide of the mature sequence comprising miR-29a, miR-29b, miR-29c or its combination.Described miR-29a-c agonist can use (such as intravenous or subcutaneous) by parenteral, oral, percutaneous, sustained release, controlled release, delayed release, suppository, conduit or sublingual administration are used.In another embodiment, described method comprises further and uses the second therapy to described experimenter.Described second therapy is selected from lower group: beta-Blocking agent, muscular strength medicine, diuretic, ACE-I, AII antagonist, BNP, Ca ⁺⁺-blocker, endothelin receptor antagonists and hdac inhibitor.

Present invention also offers a kind ofly is having the method for preventing pathologic hypertrophy or heart failure in required experimenter, comprises the experimenter of the risky generation pathological heart hypertrophy of qualification or heart failure; And promote expression or the activity of the miR-29a-c in the heart cell of described experimenter.In one embodiment, promote the expression of miR-29a-c or activity to comprise and send the agonist of miR-29a-c or the expression vector of coding miR-29a-c to described heart cell.In another embodiment, described risky experimenter shows the risk factor that one or more are selected from lower group: long-standing uncontrolled hypertension, the valvular heart disease do not corrected, chronic angina (chronicangina), recent myocardial infarction, to cardiopathic congenital procatarxis and pathologic hypertrophy.In another embodiment, described risky experimenter has been diagnosed as the genetic factor had cardiac hypertrophy.Also having in an embodiment, described risky experimenter has the family history of cardiac hypertrophy.

A kind of genetically modified non-human mammal is also contained in the present invention, and its cell fails expressive function miR-29a, miR29b and/or miR29c.In another embodiment, the invention provides a kind of genetically modified non-human mammal, its cell is included in the miR-29a-c coding region under allogeneic promoter control, and described allogeneic promoter has activity in the cell of described non-human mammal.Described transgene mammal can be mice.

In one embodiment, the invention provides a kind ofly is having the method for the treatment of myocardial infarction in required experimenter, comprises expression or the activity of the miR-29a-c in the heart cell promoting described experimenter.In another embodiment, the invention provides a kind ofly is having the method for preventing cardiac hypertrophy and DCM (dilated cardiomyopathy) in required experimenter, comprises expression or the activity of the miR-29a-c in the heart cell promoting described experimenter.In another embodiment, the invention provides a kind ofly is having the method suppressing cardiac hypertrophy to be in progress in required experimenter, comprises expression or the activity of the miR-29a-c in the heart cell promoting described experimenter.

A kind of method for the treatment of or prevention tissue fibering in experimenter is also contained in the present invention, comprises the experimenter that qualification has tissue fibering or fibrosis risk in a organized way; And improve expression and/or the activity of the miR-29a-c in the skeletal muscle of described experimenter or fibroblast cell.Described tissue fibering can be cardiac fibrosis, scleroderma, skeletal muscle fiber, hepatic fibrosis, renal fibrosis, pulmonary fibrosis or diabetic fibrosis.In some embodiments, the expression and/or the activity that improve miR-29a-c comprise the agonist using miR-29a-c to described experimenter.The agonist of miR-29a-c can be the polynucleotide of the sequence comprising ripe miR-29a, miR-29b and/or miR-29c sequence.Described miR-29a-c agonist can also be the expression vector of coding miR-29a, miR-29b and/or miR-29c.In one embodiment, described method comprises further and uses non-miR-29a-c fibrosis therapy to described experimenter.

Present invention also offers a kind of method identifying miR-29a-c modulator, comprise and make cells contacting candidate compound; Assessment miR-29a-c is active or express; And activity in comparison step (b) or express and the activity of miR-29a-c when there is not described candidate compound or expression, the difference wherein measured between the active or expression of the miR-29a-c obtained indicates described candidate compound to be the modulator of miR-29.Candidate compound described in described cells contacting can be made in vitro or in vivo.Suitable candidate compound comprises protein, peptide, polypeptide, polynucleotide, oligonucleotide or micromolecule.

A kind of pharmaceutical composition is also contained in the present invention, and it comprises agonist or the antagonist of miR-29a-c.In some embodiments, described pharmaceutical composition can be injection or local application and preparing.Preparaton for local application can be gel (gel), emulsifiable paste (cream), lotion (lotion) or ointment (ointment).

The invention provides a kind of method of inducing collagen deposition in the tissue, comprise the antagonist making described contact tissue miR-29a-c.Described antagonist can be the antagonist of miR-29a, miR-29b or miR-29c.Described antagonist can be the tiny RNA antagonist (antagomir) of miR-29a-c, the antisense oligonucleotide of the ripe miR-29a-c sequence of targeting or comprise the inhibitory RNA molecules (such as siRNA or shRNA) of the sequence identical with ripe miR-29a-c sequence or ribozyme or other inhibition nucleic acid.In one embodiment, described method comprises further and makes described contact tissue second medicament.Described second medicament can be topical vitamin A, topical vitamin C or vitamin E.In another embodiment, described method comprises further carries out the second process to described tissue, such as Chemopeel, laser treatment, skin leveling (dermaplaning) or dermabrasion.In another embodiment, be organized in described in the experimenter suffering from Ehlers Danlos syndrome (Ehler ' s-Danlossyndrome) or vitamin C deficiency.

Particularly, the present invention relates to following item:

1. there iing a method for the treatment of cardiac fibrosis, cardiac hypertrophy or heart failure in required experimenter, comprising:

A () qualification has the experimenter of cardiac fibrosis, cardiac hypertrophy or heart failure; And

B () uses the agonist of miR-29a-c expression or function to described experimenter.

2. the method for 1, wherein said miR-29a-c agonist is the polynucleotide of the mature sequence comprising miR-29a, miR-29b, miR-29c or its combination.

3. the method for 2, wherein said polynucleotide comprise sequence SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.

4. the method for 2, wherein said miR-29a-c agonist is used by parenteral or is injected directly into heart tissue and uses.

5. the method for 4, it is intravenous or subcutaneous that wherein said parenteral is used.

6. the method for 2, wherein said miR-29a-c agonist is used by oral, percutaneous, sustained release, controlled release, delayed release, suppository, conduit or sublingual administration.

7. the method for 1, comprises further and uses the second therapy to described experimenter.

8. the method for 7, wherein said second therapy is selected from lower group: beta-Blocking agent, muscular strength medicine, diuretic, ACE-I, AII antagonist, BNP, Ca ⁺⁺-blocker, endothelin receptor antagonists and hdac inhibitor.

9. the method for 7, wherein said second therapy was used with the described miR-29a-c agonist same time.

10. the method for 7, wherein said second therapy was used before or after described miR-29a-c agonist.

The method of 11. 1, wherein one or more symptoms of cardiac fibrosis, cardiac hypertrophy or heart failure improve after using described miR-29a-c agonist in experimenter.

The method of 12. 11, one or more improved symptoms wherein said be improve motor capacity, the cardiac ejection volume of rising, the ventricular end diastolic pressure of reduction, the pulmonary capillary wedge pressure of reduction, the cardiac output of rising, the cardiac index of rising, the pulmonary artery pressure of reduction, the left ventricular contraction of reduction and diastolic dimensions, the cardiac fibrosis of reduction, the deposition of collagen in cardiac muscle of reduction, the left and right ventricle wall pressure of reduction, the wall tension force of reduction, the quality of life of raising, the disease related morbidity of reduction or mortality rate or its combination.

The method of 13. 1, the transformation of using the loose centripetal force exhaustion of the described experimenter's cardiac of delay of wherein said miR-29a-c agonist.

14. 1 kinds of methods of preventing pathologic hypertrophy or heart failure having in required experimenter, comprising:

A () identifies the experimenter of risky generation pathological heart hypertrophy or heart failure; And

B () promotes expression or the activity of the miR-29a-c in the heart cell of described experimenter.

The method of 15. 14, wherein promotes the expression of miR-29a-c or activity and comprises and send the agonist of miR-29a-c or the expression vector of coding miR-29a-c to described heart cell.

The method of 16. 15, wherein said miR-29a-c agonist is the polynucleotide of the mature sequence comprising miR-29a, miR-29b, miR-29c or its combination.

The method of 17. 15, wherein said expression vector comprises the sequence being selected from lower group: SEQIDNO:18, SEQIDNO:19 and SEQIDNO:20.

The method of 18. 14, wherein said risky experimenter shows the risk factor that one or more are selected from lower group: long-standing uncontrolled hypertension, the valvular heart disease do not corrected, chronic angina, recent myocardial infarction, to cardiopathic congenital procatarxis and pathologic hypertrophy.

The method of 19. 14, wherein said risky experimenter has been diagnosed as the genetic factor had cardiac hypertrophy.

The method of 20. 14, wherein said risky experimenter has the family history of cardiac hypertrophy.

21. 1 kinds of genetically modified non-human mammals, its cell fails expressive function miR-29a, miR29b and/or miR29c.

The transgene mammal of 22. 21, wherein said mammal is mice.

23. 1 kinds of genetically modified non-human mammals, its cell is included in the miR-29a-c coding region under allogeneic promoter control, and described allogeneic promoter has activity in the cell of described non-human mammal.

The transgene mammal of 24. 23, wherein said mammal is mice.

The transgene mammal of 25. 23, wherein said promoter is tissue-specific promoter.

The transgene mammal of 26. 25, wherein said tissue-specific promoter is muscle specific promoter or fibroblast-like cell specific promoter.

The transgene mammal of 27. 25, wherein said tissue-specific promoter is heart muscle specific promoter.

28. 1 kinds of genetically modified nonhuman mammalian cells, its two Natural allelic lacking miR-29a, miR-29b and/or miR-29c one or both of.

The cell of 29. 28, wherein said cell lacks all described natural miR-29a-c allele.

30. 1 kinds of methods for the treatment of myocardial infarction having in required experimenter, comprise expression or the activity of miR-29a-c in the heart cell promoting described experimenter.

31. 1 kinds of methods of preventing cardiac hypertrophy and DCM (dilated cardiomyopathy) having in required experimenter, comprise expression or the activity of miR-29a-c in the heart cell promoting described experimenter.

32. 1 kinds are having the method suppressing cardiac hypertrophy to be in progress in required experimenter, comprise expression or the activity of miR-29a-c in the heart cell promoting described experimenter.

The method of 33. 1 kinds for the treatment of or prevention tissue fibering in experimenter, comprising:

A () qualification has the experimenter of tissue fibering or fibrosis risk in a organized way; And

B () improves expression and/or the activity of miR-29a-c in the Skeletal Muscle Cell of described experimenter or fibroblast.

The method of 34. 33, wherein said tissue fibering is cardiac fibrosis, scleroderma, skeletal muscle fiber, hepatic fibrosis, renal fibrosis, pulmonary fibrosis or diabetic fibrosis.

The method of 35. 33, the expression and/or the activity that wherein improve miR-29a-c comprise the agonist using miR-29a-c to described experimenter.

The method of 36. 35, wherein said miR-29a-c agonist is the polynucleotide comprising sequence SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.

The method of 37. 33, the expression and/or the activity that wherein improve miR-29a-c comprise the expression vector using coding miR-29a-c to described experimenter.

The method of 38. 37, wherein said expression vector is virus expression carrier.

The method of 39. 38, wherein said virus expression carrier is adenovirus expression carrier.

The method of 40. 37, wherein said expression vector is non-virus expression carrier.

The method of 41. 40, wherein said non-viral expression vector is included in lipid vehicle thing.

The method of 42. 35, wherein said miR-29a-c agonist is included in lipid vehicle thing.

The method of 43. 33, comprises further and uses non-miR-29a-c fibrosis therapy to described experimenter.

44. 1 kinds, for the identification of the method for miR-29a-c modulator, comprising:

A () makes cells contacting candidate compound;

B () assessment miR-29a-c is active or express; And

Activity in (c) comparison step (b) or the activity of miR-29a-c or expression when expressing and there is not described candidate compound,

Wherein measuring active or between expressing the difference of the miR-29a-c that obtains indicates described candidate compound to be the modulator of miR-29.

The method of 45. 44, wherein makes described cell contact with described candidate compound in vitro.

The method of 46. 44, wherein makes described cell contact with described candidate compound in vivo.

The method of 47. 44, wherein said miR-29a-c modulator is the agonist of miR-29a-c.

The method of 48. 44, wherein said miR-29a-c modulator is the antagonist of miR-29a-c.

The method of 49. 44, wherein said candidate compound is protein, peptide, polypeptide, polynucleotide, oligonucleotide or micromolecule.

The method of 50. 44, wherein assesses miR-29a-c activity or expresses the expression comprising assessment miR-29a-c.

The method of 51. 50, the expression wherein assessing miR-29a-c comprises Northern trace or RT-PCR.

The method of 52. 44, wherein assesses miR-29a-c activity or expresses the activity comprising assessment miR-29a-c.

The method of 53. 52, the activity wherein assessing miR-29a-c comprises expression or the activity of the gene that assessment regulates by miR-29a-c.

The method of 54. 53, the wherein said gene by miR-29a-c adjustment is COL1A1, COL1A2, COL1A3 and/or FBN1.

55. 1 kinds of pharmaceutical compositions, it comprises the agonist of miR-29a-c.

The pharmaceutical composition of 56. 55, wherein said agonist is the expression vector of coding miR-29a-c.

The pharmaceutical composition of 57. 55, wherein said agonist is the polynucleotide of the mature sequence comprising miR-29a, miR-29b, miR-29c.

The pharmaceutical composition of 58. 57, wherein said polynucleotide comprise sequence SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.

The pharmaceutical composition of 59. 55, wherein said agonist is included in lipid delivery vehicle.

The pharmaceutical composition of 60. 55, wherein said compositions is prepared for injection.

The pharmaceutical composition of 61. 55, it combines with the test kit used for parenteral.

The pharmaceutical composition of 62. 61, it is intravenous or subcutaneous that wherein said parenteral is used.

The pharmaceutical composition of 63. 55, it combines with the test kit used for conduit.

64. 1 kinds of pharmaceutical compositions, it comprises the antagonist of miR-29a-c.

The pharmaceutical composition of 65. 64, wherein said miR-29a-c antagonist is the tiny RNA antagonist (antagomir) of miR-29a-c.

The pharmaceutical composition of 66. 64, wherein said miR-29a-c antagonist comprises the sequence of the mature sequence complementation of combining with miR-29a, miR-29b, miR-29c or its.

67. 64 pharmaceutical compositions, wherein said compositions is prepared for local application.

The pharmaceutical composition of 68. 67, wherein said compositions is gel, emulsifiable paste, lotion or ointment.

69. 1 kinds of methods of inducing collagen deposition in the tissue, comprise the antagonist making described contact tissue miR-29a-c.

The method of 70. 69, wherein said antagonist is the antagonist of miR-29a, miR-29b or miR-29c.

The method of 71. 69, wherein said antagonist is the tiny RNA antagonist of miR-29a-c.

The method of 72. 69, wherein said antagonist comprises the sequence of the mature sequence complementation of combining with miR-29a, miR-29b, miR-29c or its.

The method of 73. 69, wherein said antagonist comprises the sequence with SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20 complementation.

The method of 74. 69, wherein said tissue is facial tissue.

The method of 75. 74, below wherein said facial tissue volume tissue, lip, cheek, chin, eyebrow, eyelid, eye or near mouth.

The method of 76. 69, wherein said tissue is hands tissue, neck tissue, arm tissue, lower limb tissue, gastric tissue or breast tissue.

The method of 77. 69, wherein said tissue comprises wound, skin graft, scar tissue, wrinkle, cutis laxa, sunburn, chemical damage, scald, cold injury and/or drag line.

The method of 78. 69, wherein contact comprise be injected in described tissue, be injected into supply described tissue vascular system in or topical application.

The method of 79. 78, wherein topical application comprises the use of ointment, emulsifiable paste, gel, ointment or balsam.

The method of 80. 78, comprises compression bandage further or wraps the use of thing.

The method of 81. 69, wherein said antagonist contacts described tissue and exceedes once.

The method of 82. 81, wherein said antagonist contacts described tissue 2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,60,70,80,90 or 100 times.

The method of 83. 81, wherein said antagonist and described contact tissue were more than 2,3,4,5 or 6 days, 1,2,3 or 4 weeks, 1,2,3,4,5,6,7,8,9,10 or 11 months, or 1,2,3,3,4,5,6,7,8,9,10,15,20 or 25 year.

The method of 84. 69, comprises further and makes described contact tissue second medicament.

The method of 85. 84, wherein said second medicament is topical vitamin A, topical vitamin C or vitamin E.

The method of 86. 69, comprises further and carries out the second process to described tissue.

The method of 87. 86, wherein said second process comprises Chemopeel, laser treatment, skin leveling or dermabrasion.

The method of 88. 69, is wherein saidly organized in the experimenter suffering from Ehlers Danlos syndrome or vitamin C deficiency.

Accompanying drawing is sketched

To combine with the detailed description of the specific embodiments presented herein by reference to the one or more in these accompanying drawings, the present invention may be better understood.

Figure 1A-B. miR-208 is encoded by α-mhc gene and specific expressed in heart.(Figure 1A) miR-208 encodes in the intron of α-mhc gene.Asterisk indicator sequence conservative (SEQIDNO:1-5).(Figure 1B) detection to the miR-208 transcript of adult mice tissue is analyzed by Northern.U6mRNA serves as loading contrast.

Fig. 2 A-B. to the adjustment of α-and β-MHC.(Fig. 2 A) thyroxin and TRE are to the adjustment of class transitions.(Fig. 2 B) is fast to the model of the pressure/hypothyroidism in muscle fibers contract sex reversal at a slow speed.

Fig. 3. the detection of miR-208 in human heart.The transcript of α-MHC and miR-208 is detected by the Northern trace from six normal individuals and six with the heart tissue of the individuality of idiopathic cardiomyopathy.Between the expression of α-MHC and pre-miR-208, there is Close relation, and ripe miR-208 expression is maintained after the latter lowers.

Fig. 4 A-B. the generation of miR-208 mutant mice.(Fig. 4 A) generates the strategy of miR-208 mutant mice by homologous recombination.Pre-miRNA sequence (being positioned at the intron 29 of mice α-mhc gene in most of transcript) is replaced with the neomycin resistance box that flank is loxP site.By by chimeric mice with carry the genetically modified transgenic mice breeding of CAG-Cre, remove the neomycin box in mice germline.(Fig. 4 B) is analyzed by the Northern of the heart from wild type and miR-208 mutant mice and detects miR-208 transcript.

Fig. 5. shown in genotypic newborn mice heart in α-MHC and β-MHC protein level western analyzes.Often kind of gene type assay two mices.Detect GAPDH as loading contrast.

Fig. 6. miR-208 ^-/- the cardiac hypertrophy that mice demonstrates response pressure overload alleviates.Wild type and miR-208 ^-/-the Histological section Masson trichrome stain of the heart of mice.The disappearance of miR-208 eliminates the hypertrophy and fibrosis seen in the wild-type mice of acceptance 21 days thoracic aorta colligation (TAB).Gauge bar in the figure of top equals 2mm, and equals 20 μm in base map.

Fig. 7. miR-208 ^-/- the cardiac hypertrophy that mice demonstrates the activation of response calcinerin alleviates.Express heart (CnA-Tg) and the miR-208 of calcinerin mice in genetically modified 6 week age ^-/-; The Histological section Masson trichrome stain of the heart of CnA-Tg.The disappearance of miR-208 eliminates the hypertrophy and fibrosis seen in CnA-Tg mice.Gauge bar=2mm (top figure) or 20 μm (base map).

Fig. 8. miR-208 ^-/- mice fail response TAB and calcinerin activation and raise β-MHC.

Fig. 9. α and β-MHC protein level in adult wild-type and miR-208 transgenic animal western analyzes.Detect GAPDH as loading contrast.

Figure 10. miR-208 ^-/- mice is failed to respond the hypothyroidism of PTU process and raises β-MHC.

Figure 11. the schematic diagram of the effect of miR-208 in control β-MHC expresses.

Figure 12. miR-208 is regulating the effect in β-MHC and quick skeletal muscle gene expression through Thrap1 schematic diagram.

Figure 13. the mechanism of action of Microrna during cardiac hypertrophy.

Figure 14 A-C. cardiac hypertrophy and the miRNA during reinventing express.(Figure 14 A) is from the H & E stained of the mice behind false and TAB21 days and the representative heart from CnATg mice.Gauge bar equals the Venn figure that 2mm (Figure 14 B) shows the number of the vicissitudinous Microrna of expression be presented in often kind of heart type below.The Northern trace of the vicissitudinous Microrna of expression during (Figure 14 C) hypertrophy.Detect U6RNA as loading contrast.

Figure 15. miR-29a-c expresses response cardiac pressure and lowers.On the left side shows from wild-type mice (WT) and the heart with hypertrophy that calcinerin transgenic (CnA) or TAB bring out and fibrosis mice.Show the relative expression levels of miR-29a-c in often kind of heart type on the right.

Figure 16. compared with wild type, from the microarray analysis of the heart of miR-208 knock-out mice.When 6 week age, microarray analysis is implemented to the mRNA be separated with the invalid heart of miR-208 from wild type.Lowering maximum miRNA after occupying miR-208 is miR-499.

Figure 17. miR-29 family significantly raises in the invalid heart of miR-208.

Figure 18. miR-29 family targeting coding collagen and extracellular matrix relate to other composition Fibrotic mRNA.Based on their high sequence homology, miR29 family is by 4 member compositions; MiR-29a, miR29b-l and-2 and miR-29c.Show the sequence (SEQIDNO:18-20) of ripe miRNA.The mature sequence of miR-29b-l and miR-29b-2 is identical.This family relates to Fibrotic many compositions together for extracellular matrix.

Figure 19. the model of miR-208 and miR-29 family listed business cardiac fibrosis.In normal heart, miR-208 suppresses miR-29a-c to express.When not having miR-208, miR-29a-c up-regulated, stops response pressure and the fibrosis that occurs and extracellular matrix are expressed.The function of miR-208, miR-499 and miR-29 is a chain of.Express by stoping miR-499 and raise miR-29a-c and express, barrier fibers thus, the loss of miR-208 can be cardioprotective.

Figure 20 A-D. miR-29a-c regulates the expression of extracellular matrix proteins.The potential binding site of miR-29a-c in the 3'UTR district of (Figure 20 A) key fiber degeneration gene.After (Figure 20 B) MI, in both 3 days marginal zones and distal myocardium layer, the real-time PCR analysis of prediction target gene shows the reduction of miR-29a-c, relevant with the rising of collagen (COL1A1, COL1A2 and COL3A1) and fibrillin (FBN1), and elastin laminin (ELNl) does not have significant change.(Figure 20 C) is through effective process LAN of the Northern engram analysis display miR-29a-b of the COS cell of the CMV expression plasmid transfection of coding miR-29b-l/miR-29a bunch of increasing amounts.The band at top corresponds to pre-miRNA, and band below corresponds to ripe miRNA.The Luciferase assay that the endogenous UTR sequence of (Figure 20 D) usage forecastings target gene is carried out, show the miR-29a-c of response increasing amounts, miR-29a-c contains luciferase expression, and does not have this reduction when using irrelevant miR (i.e. miR-206).

Figure 21 A-B. miR-29a-c expresses response TGF β.The instruction of (Figure 21 A) real-time PCR analysis all three miR-29 family members respond TGF β and lower in fibroblast.(Figure 21 B) shows miR-29a-c and expresses the Northern that raises in miR-208 mutant animals and analyze, with the BNP measured by PCR in real time express raise consistent.

Figure 22 A-G. miR-29a-c suppresses inducing fibrosis in vivo.The structure of (Figure 22 A) anti-miR-29a-c and mispairing (mm) miR-29a-c.(Figure 22 B) Northern engram analysis, shows the saline responding anti-miR-29a-c or mmmiR-29a-c of intravenous injection 80mg/kg or suitable volume for 3 days afterwards and the tissue specificity occurred strikes low.The real-time PCR analysis instruction collagen expression response miR-29a-c of (Figure 22 C) liver extract strikes low remarkable rising, and does not have this effect after pump pickle or mm.The tissue that after the saline of (Figure 22 D) continuous two days intravenous injection 80mg/kg anti-miR-29a-c or mmmiR-29a-c oligonucleotide or quite volume, three weeks collect indicates acutely striking of miR-29a-c in the heart, liver and kidney low, and the miR-29a-c water-glass in lung reveals unaffected.The real-time PCR analysis instruction heart collagen expression response miR-29a-c of (Figure 22 E) heart extract strikes low and raises.After the process of (Figure 22 F) real-time PCR analysis instruction miR-29b analogies, in two days fibroblasts, miR-29b expresses and raises, and miR-29a level does not change, and miR-29c level only has and slightly raises.In (Figure 22 G) fibroblast miR-29b process LAN containment collagen gene expression, as real-time PCR analysis measure.

Figure 23. miR-29 family member responds miR-29b and strikes low expression in various tissue.In different tissues, the anti-miR-29b of low instruction miR-29b display response that strikes of all miR-29 members reduces by 50% in heart, and miR-29a and the change of-c edges only edge.But, in liver and kidney miR-29b respond anti-miR-29b to strike low be almost completely, and miR-29a and-c also shows and in these tissues, responds anti-miR-29b and reduce.

Detailed Description Of The Invention

The expression that cardiac muscle and skeletal muscle shrink each isoform of efficiency by the adjustment regulating and controlling myosin responds the stimulation of multiple Pathophysiology, such as workload, thyroxin intracellular signaling and damage.Recently, inventor reports a kind of heartspecific Microrna, i.e. miR-208, it is encoded by the intron of α-myoglobulin heavy chain (MHC) gene, and in heart, responding cardiac pressure and raising (see common pendent application WO2008/016924, complete income herein by addressing) required for β-MHC expression and containment quick skeletal muscle gene.

At this, inventor extends their previous work, and shows miR-208 and also lower a relevant miRNA family, i.e. miR-29a-c.Because miR-29a-c is all over expressing, and relate to the adjustment to collagen deposition, the strategy therefore regulating miR-29a-c to express can be applicable to prevention Various Tissues fibrosis, comprises cardiac fibrosis, and skeletal muscle, liver, lung, diabetes and renal fibrosis.The adjustment of miR-29a-c in heart cell (such as cardiac fibroblast) is used in experimenter and treats or prevent cardiac hypertrophy or heart failure.So, one aspect of the present invention is the excitement to miR-29a-c expression or activity, optionally combines with suppression miR-208.Excitement can relate to external source miR-29a-c importing heart or other tissue of interest, or directly use naked nucleic acid or delivery vehicle (vehicle) (such as lipid/liposome/nano-particle), or via gene expression, such as by using adenovirus vector or other ectopic expression means, to reduce fibrosis.Also contain the fibrosis function activating miR-29a-c via medicine " micromolecule ", as the screening for the identification of this compounds.

After containment miR-29a-c expresses, the collagen such as occurred after myocardial infarction (MI) and other pressure pattern increases another effect that can indicate miR-29a-c.A focus of the work of inventor is cardiac fibrosis, and the inspection of a key regulatory genes subset (i.e. collagen I, III, elastin laminin and fibrillin) is shown to surprising the increasing of these two kinds of collagens and fibrillin response miR-29a-c downward, and elastin laminin does not increase.Therefore, therapeutic containment miR-29a-c increases collagen deposition is that solution presents a unique option with the situation (such as at cosmetic applications and cicatrization) that collagen loss is feature.

Microrna 29 (miR-29) is a micro-rna family, by 4 known member compositions, i.e. and miR-29a, b1 and 2 (identical) and c.Although miR29b-1 with 29a grows from being derived from the identical transcript of human chromosomal 7 with mouse chromosome 6, all transcribe from chromosome 1 in these two kinds of species for miRNA bunch containing miR29b-2 and miR29c.Following is a list the ripe miRNA sequence of each mankind miR-29 family member:

hsa-miR-29auagcaccaucugaaaucgguua(SEQIDNO:18)

Hsa-miR-29b-l and b-2uagcaccauuugaaaucaguguu (SEQIDNO:19)

hsa-miR-29cuagcaccauuugaaaucgguua(SEQIDNO:20)

These Micrornas based on they sequence homology and form family (Yu etc.; 2006).Owing to only having small difference between each member of family, and each member has 100% conservative seed zone (it contributes to limiting target thing and determines), therefore the mRNA target thing (Figure 18) that their very possible targeting are identical, and reduce the gene expression of these particular target genes.The target thing of miR-29 family determines to disclose miR-29 family and demonstrates height preference targeting being related to gene that collagen formed and other extracellular matrix proteins (such as elastin laminin (ELN), fibrillin 1 (FBN1), Collagen type I α 1 and α 2 (COL1Al, COL1A2) collagen type III α 1 (COL3A1), metallopeptidase and integrin).When responding pathology pressure, cardiac fibroblast and extracellular matrix proteins are disproportionately and exceedingly accumulate.Myocardial fibrosis (feature of the pathologic hypertrophy of form of ownership) causes machinery stiff, and this facilitates contractile dysfunction (Berk etc., 2007).Because miR-29 family lowers during this remodeling process, therefore this family likely plays a positive role in the regulation and control of collagen deposition, and regulates cardiac fibrosis and cardiac contractility thus, and this secondary ground can induce hypertrophy and pathologic to reinvent.

As discussed earlier, miR-208 shows and regulates miR-29 to express, because miR-29 copies in the heart of the mice lacked at two of miR-208 significantly raise (see embodiment 1).So, the expression of miR-29 and the expression of miR-29 target gene can be affected on the regulation and control of miR-208.MiR-208 is the intron miRNA being positioned at α-mhc gene intron.Accurate introne position depends on concrete species and concrete transcript.Such as, in the mankind, miR-208 encodes in the 28th intron of α-mhc gene, and in mice, it encodes in the 29th intron.The pre-miRNA coded sequence of miR-208 of the mankind, mice, rat and dog is each provided in SEQIDNO:14, SEQIDNO:15, SEQIDNO:16, SEQIDNO:17.Ripe miR-208 sequence is provided in SEQIDNO:5.As α-MHC, miR-208 only expresses (Fig. 1) in heart.

People pre-miR-208 (SEQIDNO:14) acgggcgagcttttggcccgggttatacctgatgctcacgtataagacgagcaaaa agcttgttggtcaga

Mice pre-miR-208 (SEQIDNO:15) acgggtgagcttttggcccgggttatacctgactctcacgtataagacgagcaaaa agcttgttggtcaga

Rat pre-miR-208 (SEQIDNO:16) acgggtgagcttttggcccgggttatacctgactctcacgtataagacgagcaaaa agcttgttggtcaga

Dog pre-miR-208 (SEQIDNO:17) acgcatgagcttttggctcgggttatacctgatgctcacgtataagacgagcaaaa agcttgttggtcaga

Use the PicTar algorithm (Krek etc., 2005) for the identification of miRNA target thing, inventor identifies the prediction target thing of Thyroid Hormone Receptors related protein 1 (THRAP1) as miR-208.The THRAP13'UTR sequence from the mankind, chimpanzee, mice, rat, dog, chicken, Fugu ocellatus and Brachydanio rerio is each provided in SEQIDNO:6, SEQIDNO:7, SEQIDNO:8, SEQIDNO:9, SEQIDNO:10, SEQIDNO:11, SEQIDNO:12 and SEQIDNO:13.

People THRAP13'UTR (SEQIDNO:6) uucuugcuuuaaagcaauuggucuaaaauauauguaaucgucuuaauuaaaaaguu gcaguaggguugc

Chimpanzee THRAP13'UTR (SEQIDNO:7) uucuugcuuuaaagcaauuggucuaaaauauauguaaucgucuuaauuaaaacguu gcaguaggguugc

Mice THRAP13'UTR (SEQIDNO:8) uucuugcuuuaaagcaauuggucuaaaauauauguaaucgucuuaauuaaaacguu gcaguaggguugc

Rat THRAP13'UTR (SEQIDNO:9) uucuugcuuuaaagcaauuggucuaaaauauauguaaucgucuuaauuaaaacguu gcaguaggguugc

Dog THRAP13'UTR (SEQIDNO:10) uucuugcuuuaaagcaauuggucuaaaauauauguaaucgucuuaauuaaaacguu gcaguaggguugc

Chicken THRAP13'UTR (SEQIDNO:11) uucuugcuuuaaagcaauuggucuaaaauauauguaaucgucuuaauuaaaacguu gcaguaggguugc

Fugu ocellatus THRAP13'UTR (SEQIDNO:12) uuccugcuuuaagcaauugguugaaaauauauguauguaauggucuuaauuaaaaa aacaaacuaagacaaa

Brachydanio rerio THRAP13'UTR (SEQIDNO:13) uuccugcuuuaaagcaauuggucuaaaauauauguaaucgucuucauuacaaaaac gaaccaucaaacg

The invention provides and having the method for the treatment of cardiac fibrosis, cardiac hypertrophy or heart failure in required experimenter, comprise the experimenter that qualification has cardiac fibrosis, cardiac hypertrophy or heart failure; And described experimenter is used to the agonist of miR-29 expression or function.Described miR-29 agonist can be the agonist of miR-29a, miR-29b and/or miR-29c.

In one embodiment, the agonist of miR-29a-c can be the polynucleotide comprising ripe miR-29a-c sequence.In some embodiments, described polynucleotide comprise sequence SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.In another embodiment, described miR-29a-c agonist can be the polynucleotide of pri-miRNA or the pre-miRNA sequence comprising miR-29a, miR-29b and/or miR-29c.The described polynucleotide comprising ripe miR-29a-c, pre-miR-29a-c or pri-miR-29a-c sequence can be strand or double-strand.Described polynucleotide can contain a place or many places chemical modification, and such as locked nucleic acid, peptide nucleic acid(PNA), sugar-modified (such as 2'-O-alkyl (such as 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluorine and 4'-sulfur modification) (such as one or more thiosulfates, morpholino or phosphine carboxylate are connected with backbone modifications.In one embodiment, the polynucleotide coupling comprising miR-29a-c sequence described in has cholesterol.In another embodiment, described miR-29a-c agonist can be different from miR-29a-c, works the medicament improving, supplement or replace miR-29a-c function.

In another embodiment, can in vivo from miR-29a-c agonist described in vector expression." carrier " refers to can be used for by delivery of nucleic acids interested to the composition of matter of cell interior.Numerous carrier known in the art, includes but not limited to linear polynucleotides, the polynucleotide relevant with ion or amphipathic compound, plasmid and virus.So, term " carrier " comprises the plasmid or virus that independently copy.The example of viral vector include but not limited to adenovirus vector, adeno-associated virus vector, retroviral vector, etc.Expression construct can copy in living cells, or it can synthesize preparation.In order to the application, term " expression construct ", " expression vector " and " carrier " are used interchangeably, and demonstrate application of the present invention with general, exemplary meaning, and are not intended to limit the present invention.

In one embodiment, the expression vector for expressing miR-29a-c comprises the promoter " be operatively connected " with coding miR-29a, miR-29b, miR-29c or its polynucleotide combined.In another embodiment, described polynucleotide codified miR-29b-1/miR-29a bunch.In another embodiment, described polynucleotide codified miR-29b-2/miR-29c bunch.As used herein, phrase " be operatively connected " or " transcribing under control " mean promoter relative to polynucleotide be in correct location and orientation with transcribing of controlling that RNA polymerase carries out with the startup of the expression of polynucleotide.Coding polynucleotide codified one-level Microrna-29a-c sequence (pri-RNA-29a-c) of miR-29a-c, precursor Microrna-29a-c sequence (pre-RNA-29a-c) or mature rna-29a-c sequence.In another embodiment, described expression vector comprises the polynucleotide be operatively connected with promoter, and wherein said polynucleotide comprise sequence SEQIDNO:18.In another embodiment, described expression vector comprises the polynucleotide be operatively connected with promoter, and wherein said polynucleotide comprise sequence SEQIDNO:19.Also having in an embodiment, described expression vector comprises the polynucleotide be operatively connected with promoter, and wherein said polynucleotide comprise sequence SEQIDNO:20.Describedly comprise sequence SEQIDNO:18, the polynucleotide of SEQIDNO:19 or SEQIDNO:20 can be about 18 to about 2000 nucleotide, be about 70 to about 200 nucleotide, be about 20 nucleotide to about 50 nucleotide or be about 18 nucleotide to about 25 nucleotide.

Run through the application, term " expression construct " intention comprises the genetic constructs of any type, and it comprises the nucleic acid of encodes gene product, and wherein part or whole nucleic acid coding sequence can be transcribed.Generally speaking, encodes gene product nucleic acid promoter transcribe control under." promoter " refers to the synthesis machinery being subject to cell or the synthesis machinery identification imported, the DNA sequence required for the specific transcriptional of promotor gene.

Term promoter is used in this article and refers to cluster around the startup site of RNA polymerase one group and transcribe control module.About how, many thinkings of Tissue Promoters are derived from the analysis to several viral promotors, comprise HSV thymidine kinase (tk) and SV40 early transcription unit.These researchs (obtaining the expansion of work recently) show promoter and are made up of discrete functional blocks, and wherein each module is made up of about 7-20bpDNA, and contains one or more recognition sites of transcriptional activator or repressor protein matter.

At least one module in often kind of promoter plays the function that location RNA synthesizes initiation site.This example knowing is at most TATA box, but lack in the promoter of TATA box at some, the promoter of such as mammalian terminal deoxynucleotidyl transferase gene and the promoter of SV40 late gene, contribute to fixing enable position with the discrete elements that initiation site self is overlapping.

Other promoter element regulates the frequency of transcription initiation.Typically, these are arranged in the region of initiation site upstream 30-110bp, although many promoteres demonstrate in initiation site downstream recently also containing function element.Spacing between each promoter element normally flexibly, makes the promoter function when each element is squeezed toward each other or is mobile be retained.In tk promoter, the spacing between each promoter element can be increased at a distance of 50bp, and active just beginning declines afterwards.Depend on promoter, each element shows the function that can play activated transcription synergistically or independently.

In other embodiments, human cytomegalic inclusion disease virus (CMV) immediate early gene promoter, SV40 early promoter, rous sarcoma virus long terminal repetition, rat insulin promoter, RNApolIII promoter and glyceraldehyde-3-phosphate dehydrogenase promoter can be used for the high level expression obtaining polynucleotide interested.Also contain well known in the art for realizing other viral or mammalian cell or bacteriophage promoters use that polynucleotide interested are expressed, as long as expression is enough for given object.

By adopting the promoter with known properties, expression and the pattern of transfection or the rear polynucleotide interested of conversion can be optimized.In addition, specific physiological is responded and the selection of the promoter regulated can allow the inducible expression of gene outcome.Table 1 and table 2 list several regulating elements that can adopt in the background of the invention to regulate gene of interest to express.This list is not intended to be all possible element that limit improves involved by gene expression, but is only their illustration.

Enhancer improves the genetic elements of transcribing from the promoter being positioned at diverse location place on same DNA molecular.The tissue of enhancer and promoter the spitting image of.That is, they are made up of many independent elements, wherein one or more transcription factors of each combination of elements.

Basic distinction between enhancer and promoter is running.Strengthen subarea and must can stimulate transcribing of distant place as a whole; And promoter region or its composed component need not be like this.On the other hand, promoter must have the element that one or more RNA synthesis instructing specific site place and specific orientation start, and enhancer lacks these specificitys.Promoter and enhancer are usually overlapping and adjoin, and usually show and have closely similar ground module group structure.

It is hereafter the list (table 1 and table 2) of viral promotors, cellular promoters/enhancer and the inducible promoter/enhancer that can use with the Nucleic acid combinations of interest encodes gene in expression construct.In addition, any promoter/enhancer combination (according to Eukaryotic Promoter Database EPDB) also can be used to drive the expression of described gene.If provide suitable bacterial polymerase (or as part of delivery complexes or as other gene expression construct), eukaryotic cell can support the cytoplasmic transcription from some promoters.In a preferred embodiment, the polynucleotide of miR-29a-c or miR-29a-c antagonist and the fibroblast-like cell specific promoter of encoding is operatively connected.

When adopting cDNA insert, usually can wish to comprise polyadenylation signal to realize the correct polyadenylation of genetic transcription thing.Think that the essence of polyadenylation signal is not vital for successful implementation of the present invention, and this type of sequence any can be adopted, such as human growth hormone and SV40 polyadenylation signal.Also terminator is contained as expression cassette element.These elements can be used for strengthening information level and entering reading over of other sequence from this box minimizing.

In certain embodiments of the invention, the cell containing nucleic acid construct of the present invention can in vitro or in vivo by comprising mark to identify in expression construct.This type of mark can give cell with appraisable change, allows the easily cell of qualification containing expression construct.Usually, comprise drug selectable markers and contribute to clone and select transformant, the gene such as given for the resistance of neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol is useful selection marker.Or, can enzyme be adopted, such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT).Immunological hallmark thing can also be adopted.Think that adopted selection marker is not important, as long as it can be expressed with the nucleic acid of encodes gene product simultaneously.Other example of selection marker well known to a person skilled in the art.

There is various ways can by expression vector transfered cell.In certain embodiments of the invention, the expression construct engineered construct that comprises virus or derive from viral genome.Some virus enters cell through receptor-mediated endocytosis, be integrated into tempting candidate (Ridgeway, 1988 that host cell gene group and the stable and ability of high-efficiency expression of virus gene make them become to be transferred to by alien gene in mammalian cell; Nicolas and Rubinstein, 1988; Baichwal and Sugden, 1986; Temin, 1986).

Use adenovirus expression carrier is related to for one of method for optimizing of sending in body." adenovirus expression carrier " intention comprises those and contains and be enough to (a) and support that the packaging of construct and (b) express the construct of the adenoviral sequence of the polynucleotide of wherein cloning.Expression vector comprises the adenovirus of genetic engineering form.Knowledge about the heredity group structure of adenovirus (a kind of 36kB, linearly, double-stranded DNA virus) is allowed and is substituted large section adenovirus DNA (Grunhaus and Horwitz, 1992) with the foreign sequence reaching 7kB.Formed with retrovirus and contrast, the adenovirus infection of host cell does not cause chromosomal integration, because adenovirus DNA can copy in episome mode, does not have potential genetoxic.And adenovirus is structurally stable, and genome rearrangement do not detected after extensively increasing.Adenovirus can infect in fact all epithelial cells, regardless of their cell cycle phase.

Adenovirus is particularly suitable for being used as gene transfer vector because it have medium sized genome, be easy to operation, titre is high, target cell-range is wide and infectious high.These virus genomic two ends all contain the inverted repeat (ITR) of 100-200 base pair, and they are viral dna replication and the necessary cis element of packaging.

At adenovirus vector be replication defective or at least conditionality defect requirement outside, think that the essence of adenovirus vector is not vital for successful implementation of the present invention.Described adenovirus can be any one in 42 kinds of different known serotypes or subgroup A-F.In order to obtain for the conditionality replication-defective adenoviral vector in the present invention, the 5 type adenoviruss of subgroup C are preferred parent materials.This is because 5 type adenoviruss are adenovirus hominiss, know extremely many biochemistry and hereditary information about it, and it adopts adenovirus as the structure of carrier for great majority in history.

As mentioned above, be replication defective according to typical carriers of the present invention, and adenovirus E 1 district can not be had.So, the polynucleotide importing interest encodes gene in the position of eliminating E1 coded sequence can be most convenients.But the position of inserting construct in adenoviral sequence is not vital for the present invention.Also the polynucleotide of interest encodes gene can be inserted in E3 replacement vector, replace deleted E3 district, as described in (1986) such as Karlsson, or in E4 district, auxiliary cell line or helper virus supply E4 defect in this case.

Adenovirus vector is for eukaryotic gene expression (Levrero etc., 1991; Gomez-Foix etc., 1992) and vaccine development (Grunhaus and Horwitz, 1992; Graham and Prevec, 1991).Recently, zooscopy prompting recombinant adenovirus can be used for gene therapy (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Perricaudet etc., 1990; Rich etc., 1993).Tracheal instillation (Rosenfeld etc., 1991 are comprised to the research of different tissues administered recombinant adenovirus; Rosenfeld etc., 1992), intramuscular injection (Ragot etc., 1993), in peripheral vein, injection (Herz and Gerard, 1993) and directed (stereotactic) inoculate (LeGalLaSalle etc., 1993) in brain.

Retroviral vector is also suitable at cells polynucleotide of the present invention.Retrovirus is their RNA is transformed into by process of reverse-transcription one group of single strand RNA virus (Coffin, 1990) that the ability of double-stranded DNA is feature in infected cell.Then gained DNA stable integration enters in cell chromosome, as provirus, and guides the synthesis of virus protein.Described integration causes the maintenance of virus gene sequence in recipient cell and offspring thereof.Reverse transcription virus gene group contains three kinds of genes, i.e. gag, pol and env of encoding capsid protein, polymerase and envelope components respectively.The one section of sequence found at gag upstream region of gene contains the signal be packaged into by genome in virion.Two segment lengths terminal repetition (LTR) sequence is there is at virus genomic 5' and 3' end.These contain strong promoter and enhancer sequence, but also are (Coffin, 1990) that are integrated into required for host cell gene group.

In order to build retroviral vector, the nucleic acid of interest encodes gene being inserted in viral genome, replaces some virus sequence, to generate replication-defective virus.In order to generate virion, building and containing gag, pol and env gene but the package cell line (Mann etc., 1983) not having LTR and packaging element.When the recombiant plasmid containing cDNA and retrovirus LTR and packaging sequence is imported into this cell line (such as passing through calcium phosphate precipitation), packaging sequence allows that the rna transcription thing of recombiant plasmid is packed in virion, then (Nicolas and Rubenstein, 1988 in the culture medium of culture are secreted into; Temin, 1986; Mann etc., 1983).Then collect the culture medium containing recombinant retrovirus, optionally concentrate, and for gene transfer.Retroviral vector can infect extremely various kinds of cell type.But, integrate and stably express requirement division of host cells (Paskind etc., 1975).

Other viral vector can be adopted as the expression construct in the present invention.Can adopt from such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar etc., 1988), adeno associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and the derivative carrier of the virus such as herpesvirus.They provide several tempting feature (Friedmann, 1989 for various mammalian cell; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar etc., 1988; Horwich etc., 1990).

In order to realize the expression of sense or antisense gene construct, expression construct must be sent in cell.This send can in vitro (as in the laboratory protocols of transformation cell lines) or in vivo or ex vivo (as in the treatment of some morbid state) realize.A kind of delivery mechanism is through viral infection, wherein expression construct is wrapped in the housing of infectious viral particle.

Several non-viral methods for expression construct being transferred in the mammalian cell of cultivation are also contained in the present invention.These comprise calcium phosphate precipitation (Graham and VanDerEb, 1973; Chen and Okayama, 1987; Rippe etc., 1990), DEAE-dextran (Gopal, 1985), electroporation, (Tur-Kaspa etc., 1986; Potter etc., 1984), directly microinjection, (Harland and Weintraub, 1985), be loaded with liposome (NicolauandSene, 1982 of DNA; Fraley etc., 1979) and Lipofectamine-DNA complex, cell supersound process (Fechheimer etc., 1987) gene bombardment (Yang etc., 1990), using the micro-bullet of high speed to carry out and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988).Some in these technology can successfully adapt in body or ex vivo use.

Once send in cell by expression construct, the nucleic acid of interest encodes gene in different parts location and can be expressed.In certain embodiments, the nucleic acid of encoding gene can enter in the genome of cell by stable integration.This integration can be in located in connection and orientation (gene substitution) through homologous recombination, or it can with random, nonspecific position integration (genes amplification).Also having in some embodiments, nucleic acid can as separate, region of DNA section stable maintenance in cell of additive type.This type of nucleic acid segment " episome " coding is enough to allow and does not rely on host cell cycle ground or the sequence with host cell cycle synchronously Maintenance and Replication.How expression construct is delivered to cell and nucleic acid remains on the type depending on adopted expression construct in where in cell.

Also have in an embodiment of the present invention, expression construct can only be made up of naked recombinant DNA or plasmid.The transfer of described construct can be implemented by any method of physics mentioned above or chemistry saturatingization cell membrane.This is specially adapted to external transfer, but it also can be applicable to use in body.Polyoma virus DNA to be successfully injected into the form of calcium phosphate precipitation thing and to grow up and in the liver of newborn mice and spleen, show active virus replication and actute infection by Dubensky etc. (1984).The plasmid that Benvenisty and Neshif (1986) also demonstrates direct peritoneal injection calcium phosphate precipitation causes the expression of institute's rotaring redyeing gene.Also the DNA of interest encodes gene can be shifted in vivo in a similar manner and expressing gene product.

Also have in an embodiment of the present invention, naked DNA expression construct is transferred in cell and can relates to partickle bombardment.The method depends on the Particle acceleration ability extremely at a high speed of DNA being wrapped quilt, and described high speed is allowed micro-bullet permeates cell membranes and entered cell, but does not kill their (Klein etc., 1987).Several are developed for accelerating short grained device.Such device depends on electrion and carrys out a generation current, and this electric current provides motive power (Yang etc., 1990) then.The micro-bullet used is made up of any biological inert material, such as tungsten or gold bead.

Bombard the selected organs of rat and mouse in vivo, comprise liver, skin and muscular tissue (Yang etc., 1990; Zelenin etc., 1991).This may require surgical exposure tissue or cell, to eliminate any intervening tissue between rifle and target organ, i.e. ex vivo process.Again, the DNA of selected gene can send through the method, and still takes in the present invention.

In yet another embodiment of the present invention, expression construct can be encapsulated in liposome.The imitated vesicle structure that liposome is is feature with Lipid bilayer membranes and internal water medium.Multilamellar liposome has multiple lipid layer separated by aqueous medium.They are spontaneous formation when being suspended in excessive aqueous solution by phospholipid.Lipid components experience oneself before forming closed structure reset and the solute of packaged water and dissolving between double-layer of lipoid (Ghosh and Bachhawat, 1991).Also contain Lipofectamine-DNA complex.

External liposome-mediated delivery of nucleic acids and foreign DNA are expressed extremely successful.Wong etc., (1980) demonstrate the feasibility that liposome-mediated foreign DNA is sent and expressed in the Embryo Gallus domesticus cultivated, HeLa and liver tumor cell.Nicolau etc., (1987) achieve successfully liposome-mediated gene transfer in rats after intravenous injection.

In certain embodiments of the invention, can by liposome and hemagglutination virus (HVJ) compound.This demonstrates and promotes with cell membrane warm and promote the DNA that liposome encapsulates and enter cell (Kaneda etc., 1989).In other embodiments, liposome and chromosomal protein nonhistones in nucleus (HMG-I) compound or combine can be adopted (Kato etc., 1991).Also having in some embodiments, can by liposome with both HVJ and HMG-I compound or combine employing.Be used successfully to the transfer of in vitro and in vivo nucleic acid due to this type of expression construct and expressed, so they are applicable to the present invention.Adopt in DNA construct in the situation of promoters, also can wish to comprise suitable bacterial polymerase in liposome.

Other can adopt the expression construct that the delivery of nucleic acids of selected gene enters in cell is receptor-mediated delivery vehicle.These utilize the receptor-mediated endocytosis almost in all eukaryotic cells to absorb high molecular selectivity.Because the cell type specificity distribution of various receptor, thus described in send can be high degree of specificity (Wu and Wu, 1993).

Receptor-mediated gene target vehicle is generally grouped into by two kinds of one-tenth: cell receptor specificities part and DNA bonding agent.Several parts are for receptor-mediated gene transfer.The part the most extensively characterized is asialoorosomucoid (ASOR) (ASOR) (Wu and Wu, 1987) and transferrin (Wagner etc., 1990).Recently, a kind of Neoglycoproteins (neoglycoprotein) (itself and ASOR identify same receptor) of synthesis is used as gene delivery vehicle (Ferkol etc., 1993; Perales etc., 1994), and epidermal growth factor (EGF) also for by gene delivery to squamous cell carcinoma (Myers, EPO0273085).

In other embodiments, delivery vehicle can comprise part and liposome.Such as, Nicolau etc. (1987) adopt the lactose base-ceramide (a kind of end is the de-sialic ganglioside of galactose) mixed in liposome, and observe hepatocyte and increase the picked-up of insulin gene.So, it is possible that also can by multiple Receptor-ligand system when having or without when liposome, the nucleic acid specificity of selected gene is sent in certain cell type.Such as, epidermal growth factor (EGF) can be used as receptor, enters to show in the cell of EGF receptor up-regulation by delivery of nucleic acids for mediating.Mannose can be used for the mannose receptor on hepatocytes-targeting.And the antibody capable for CD5 (CLL), CD22 (lymphoma), CD25 (T cell leukemia) and MAA (melanoma) is used as targeting module similarly.

In a concrete example, oligonucleotide can be used in combination with cation lipid.The example of cation lipid includes but not limited to Lipofectin, DOTMA, DOPE and DOTAP.The open text of WO/0071096 (clearly taking in herein by addressing) describes different preparaton, all if be effective to the DOTAP of gene therapy: cholesterol or cholesterol derivative preparaton.Other open text also discuss different lipid or liposome formulation agent, comprises nano-particle and application process; These include but not limited to U.S. Patent Publication text 20030203865,20020150626,20030032615, and 20040048787, clearly take in herein by addressing, its degree is which discloses to use and the preparaton of nucleic acid delivery and other related fields.Method for the formation of granule is also recorded in United States Patent (USP) 5,844,107,5,877,302,6,008,336,6,077,835,5,972,901,6,200,801, and 5,972,900, those aspects are taken in by addressing herein.

In certain embodiments, under ex vivo (exvivo) condition, more easily gene transfer can be implemented.Ex vivo gene therapy refers to, from animal isolated cell, enter in cell in vitro by delivery of nucleic acids, is then returned in animal by modified cell.This can relate to the original cuiture taking out tissue/organ or biological cells and tissues from animal surgery.

In some embodiments of the present invention, it is desirable to suppress the expression of miR-29a-c or activity to improve collagen deposition.Such as, in one embodiment, the invention provides the method for the collagen deposition in induced tissue, comprise the antagonist making described contact tissue miR-29a-c.The antagonist of miR-29a-c function or inhibitor can be for miR-29a, miR-29b and/or miR-29c.

The function of miRNA suppresses by using of tiny RNA antagonist.Recorded by Krutzfeldt and colleague (Kr ü tzfeldt etc., 2005) thereof at first, " tiny RNA antagonist " refer to strand, through chemical modification, at least partly and the ribonucleotide of miRNA sequence complementation.Tiny RNA antagonist can contain one or more modified nucleotide, such as 2'-O-methyl-sugar-modified.In some embodiments, tiny RNA antagonist only comprises modified nucleotide.Tiny RNA antagonist also can comprise one or more thiophosphate and connect, and causing is partially or completely the main chain of thiophosphate.In order to promote to send in body and stability, at its 3' end, tiny RNA antagonist can be connected to cholesterol module.Be suitable for suppressing the tiny RNA antagonist of miRNA can be about 15 to about 50 nucleotide, be more preferably about 18 to about 30 nucleotide, and be most preferably about 20 to about 25 nucleotide." partial complementarity " refers to that certain sequence and target polynucleotide sequence are at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% complementation.Tiny RNA antagonist can be complementary at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% with ripe miRNA sequence.In some embodiments, tiny RNA antagonist can be substantially complementary with ripe miRNA sequence, namely complementary at least about 95%, 96%, 97%, 98% or 99% with target polynucleotide sequence.In other embodiments, tiny RNA antagonist and ripe miRNA sequence 100% complementation.

In one embodiment, miR-29a-c antagonist is tiny RNA antagonist.Tiny RNA antagonist can comprise the sequence complementary at least partly with the ripe miRNA sequence of miR-29a, miR-29b or miR-29c.In another embodiment, tiny RNA antagonist comprises the sequence complementary at least partly with sequence SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.In another embodiment, tiny RNA antagonist comprises the sequence with SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20100% complementation.

The suppression of Microrna function also can be realized by the antisense oligonucleotide using ripe miR-29a, miR-29b or miR-29c sequence of targeting.Described antisense oligonucleotide can be ribonucleotide or deoxyribonucleotide.Preferably, described antisense oligonucleotide has the chemical modification of at least one place.Antisense oligonucleotide can comprise one or more " locked nucleic acid (lockednucleicacid) "." locked nucleic acid " (LNA) refers to modified ribonucleotide, and it containing extra bridge joint, causes the oligonucleotide of imparting containing LNA with " locking " conformation of the heat stability strengthened between 2' and the 4' carbon of ribose sugar module.Or described antisense oligonucleotide can comprise peptide nucleic acid(PNA) (PNA), and it contains the main chain based on peptide, and non-saccharide-phosphate backbone.Other chemical modification that antisense oligonucleotide can contain includes but not limited to sugar-modified, such as 2'-O-alkyl (alkyl) (such as 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluorine and 4'-sulfur modification, and backbone modifications, such as one or more thiophosphate, morpholino or phosphine carboxylate (phosphonocarboxylate) connect (participates in such as U.S. Patent No. 6,693,187 and 7,067,641, by addressing, complete income herein).In some embodiments, suitable antisense oligonucleotide is 2'-O-methoxyethyl " breach polymers " (gapmer), it all contains the ribonucleotide of 2'-O-methoxyethyl modification at 5' and 3' end, and there are at least ten deoxyribonucleotides in central authorities.These " breach polymers " can trigger the dependent degradation mechanism to RNA target thing of RNA enzyme H.Other modification (such as U.S. Patent No. 6 to antisense oligonucleotide of enhanced stability and raising effect, 838, record in 283 those, complete income this paper by addressing) be known in the art, and be suitable for using in the method for the invention.19 to about 25 nucleotide are about to suppressing the useful preferred antisense oligonucleotide of the activity of Microrna.Antisense oligonucleotide can comprise at least partly and the sequence of ripe miRNA sequence complementation, such as complementary at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% with ripe miRNA sequence.In some embodiments, described antisense oligonucleotide can be substantially complementary with ripe miRNA sequence, namely complementary at least about 95%, 96%, 97%, 98% or 99% with target polynucleotide sequence.In one embodiment, described antisense oligonucleotide comprises the sequence with the complementation of ripe miRNA sequence 100%.

In another embodiment of the invention, miR-29a-c antagonist is the antisense oligonucleotide through chemical modification.The described antisense oligonucleotide through chemical modification can comprise the sequence complementary at least partly with the ripe miRNA sequence of miR-29a, miR-29b or miR-29c.In still another embodiment, the described antisense oligonucleotide through chemical modification comprises the sequence complementary at least partly with sequence SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.In another embodiment, the described antisense oligonucleotide through chemical modification comprises the sequence with SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20100% complementation.

Antisense oligonucleotide can comprise the sequence substantially complementary with the precursor miRNA sequence (pre-miRNA) of miR-29a-c.In some embodiments, described antisense oligonucleotide comprise with the Jing Huan district being positioned at pre-miR-29a, pre-miR-29b or pre-miR-29c sequence beyond the substantially complementary sequence of sequence.

Use the inhibitory RNA molecules with ripe miR-29a, miR-29b and miR-29c sequence with at least part of sequence iden for suppressing the another kind of way of the function of miR-29a-c.Described inhibitory RNA molecules can be double-chain small disturbance RNA (siRNA) or the short hairpin RNA molecule (shRNA) comprising loop-stem structure.The double stranded region of described inhibitory RNA molecules can comprise identical at least partly with ripe miRNA sequence, such as about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical sequence.In some embodiments, the double stranded region of described inhibitory RNA comprises the sequence at least substantially the same with ripe miRNA sequence." substantially the same " refer to certain sequence and target polynucleotide sequence at least about 95%, 96%, 97%, 98% or 99% identical.In other embodiments, the double stranded region of described inhibitory RNA molecules can be identical with target miRNA sequence 100%.

In one embodiment, the antagonist of miR-29a-c is the inhibitory RNA molecules comprising double stranded region, and wherein said double stranded region comprises the sequence with ripe miR-29a (SEQIDNO:18), miR-29b (SEQIDNO:19) or miR-29c (SEQIDNO:20) sequence with 100% homogeneity.In some embodiments, the antagonist of miR-29a-c is the inhibitory RNA molecules comprising double stranded region, and wherein said double stranded region comprises the sequence had with ripe miR-29a, miR-29b or miR-29c sequence at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homogeneity.

In another embodiment, inhibitory RNA molecules can be ribozyme.Ribozyme refers to the catalytic RNA of the phosphodiester bond being hydrolyzed RNA molecule.Ribozyme can be designed in targeting miR-29a, miR-29b and miR-29c one or more, cause their hydrolysis.

In certain embodiments, expression vector is adopted to express the antagonist (such as tiny RNA antagonist, antisense oligonucleotide and inhibitory RNA molecules) of miR-29a-c.In one embodiment, expression vector for expressing miR-29a-c antagonist comprises the promoter be operatively connected with the polynucleotide of encoding antisense oligonucleotide, and sequence and ripe miR-29a, miR-29b or miR-29c sequence of wherein expressed antisense oligonucleotide are complementary at least partly.In still another embodiment, expression vector for expressing miR-29a-c inhibitor comprises the one or more promoteres be operatively connected with the polynucleotide of coding shRNA or siRNA, and wherein expressed shRNA or siRNA comprises the sequence identical with ripe miR-29a, miR-29b or miR-29c sequence, part is identical or substantially the same." part is identical " refer to certain sequence and target polynucleotide sequence at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical." substantially the same " refer to certain sequence and target polynucleotide sequence at least about 95%, 96%, 97%, 98% or 99% identical.

The Medical management of the cardiac hypertrophy in cardiovascular disorder background comprises the medicine of use at least two type: the inhibitor of renin-angiotensin system, and beta-adrenergic blocking agent (Bristow, 1999).The therapeutic agent being used for the treatment of the pathologic hypertrophy in heart failure background comprises Angiotensin II invertase (ACE) inhibitor and B-adrenergic receptor blocker (Eichhorn and Bristow, 1996).Other medicament being used for the treatment of cardiac hypertrophy comprises angiotensin ii receptor antagonist (United States Patent (USP) 5,604,251) and neuropeptide y antagonists (WO98/33791).Regardless of current available medicinal compound, continue to present treatment test to the prevention and therapy of cardiac hypertrophy and follow-up heart failure.

Non-pharmacological treatment uses mainly as the householder method of pharmacological treatment.A kind of means of non-pharmacological treatment relate to the sodium in cutting down one's diet.In addition, non-pharmacological treatment also needs to eliminate some precipitability medicine, comprises negative inotropic action medicine (such as some calcium channel blocker and anti-arrhythmia medicine are as disopyramide (disopyramide)), cardiotoxin (such as amphetamine (amphetamine) and plasma volume expander (plasmavolumeexpander) (such as nonsteroid anti-inflammatory drugs and glucocorticoid).

The invention provides and having the method for the treatment of cardiac fibrosis, cardiac hypertrophy or heart failure in required experimenter, comprise the experimenter that qualification has cardiac fibrosis, cardiac hypertrophy or heart failure; And described experimenter is used to the agonist of miR-29 expression or function.Preferably, the improvement of using one or more symptoms causing pathological heart fibrosis, hypertrophy or heart failure in experimenter of miR-29 agonist, or cardiac hypertrophy is transformed into heart failure delay.One or more improved symptoms described can be the motor capacitys improved, the cardiac ejection volume raised, the ventricular end diastolic pressure reduced, the pulmonary capillary wedge pressure reduced, the cardiac output raised or cardiac index, the pulmonary artery pressure reduced, the left ventricular contraction reduced and diastolic dimensions, the cardiac fibrosis reduced, the deposition of collagen in cardiac muscle reduced, the left and right ventricle wall pressure reduced, the wall tension force reduced, the quality of life improved, with the disease related morbidity reduced or mortality rate.In addition, the use of miR-29a-c agonist can directly or indirectly prevent cardiac hypertrophy and related symptoms thereof to occur.

In another embodiment, provide and having the method for preventing pathologic hypertrophy or heart failure in required experimenter, comprise the experimenter of the risky generation pathological heart hypertrophy of qualification or heart failure; And improve expression or the activity of miR-29a-c in the heart cell of described experimenter.Heart cell comprises cardiac myocyte, fibroblast, smooth muscle cell, endotheliocyte and any cell type that other finds in normal condition in heart tissue.MiR-29a-c agonist can be the agonist of miR-29a, miR-29b and/or miR-29c.Risky experimenter can show in risk factor list one or more, comprise cardiac fibrosis, low miR-29 expression, long-standing uncontrolled hypertension, the valvular heart disease do not corrected, chronic angina, recent myocardial infarction, have the genetic factor of cardiac hypertrophy and/or the family history can with cardiac hypertrophy cardiopathic congenital procatarxis and/or pathologic hypertrophy and/or can be diagnosed as.

In another embodiment, provide and having the method for the treatment of myocardial infarction in required experimenter, comprise the expression or activity that improve miR-29a-c in described experimenter's heart cell.In another embodiment, the invention provides and having the method for preventing cardiac hypertrophy and DCM (dilated cardiomyopathy) in required experimenter, comprise expression or the activity of miR-29a-c in the heart cell improving described experimenter.In another embodiment, the invention provides and having the method suppressing cardiac hypertrophy to be in progress in required experimenter, comprise expression or the activity of miR-29a-c in the heart cell improving described experimenter.Another embodiment is in the experimenter with heart failure or cardiac hypertrophy, improve the method for exercise tolerance, comprises expression or the activity of miR-29a-c in the heart cell improving described experimenter.Another embodiment is in the experimenter with heart failure or cardiac hypertrophy, reduce the method for hospitalization, comprises expression or the activity of miR-29a-c in the heart cell improving described experimenter.In some embodiments, the invention provides the method improving quality of life and reduction sickness rate or mortality rate in the experimenter with heart failure or cardiac hypertrophy, comprise expression or the activity of miR-29a-c in the heart cell improving described experimenter.

Therapeutic scheme can change with clinical scenarios.But long term maintenance can be suitable in most of situation.Also may wish that the agonist treatment using miR-29a-c is off and on loose, in the of short duration window such as during progression of disease.

In addition, miR-29 family relates to the adjustment to cardiac fibrosis.Due to the more enrichment compared with in myocyte in fibroblast of this miR family; therefore possible is a kind of factor of muscle cells secrete; may be BNP, it raises the miR-29 family in fibroblast, and so provides protection for the formation of cardiac fibrosis.This factor is very high in miR-208KO mice, relevant with the Fibrotic containment of upper mediation of miR-29a-c.MiR-29a-c level raises in general heart disease, and this is likely a kind of protective effect of restriction collagen deposition.So, the concrete purposes in miR-29a-c and the collagen deposition of agonist in containment cardiac fibrosis and heart tissue thereof is contained.Equally, the corresponding mechanism activating miR-29 family can be applicable to skeletal muscle fiber.MiR-29a-c regulates the expression of various kinds of cell epimatrix gene, such as fibrillin 1 (FBN1), Collagen type I α 1 (COL1A1), Collagen type I α 2 (COL1A2) and collagen type III α 1 (COL3A1) (see embodiment 4).Thus, present invention also offers the method for one or more extracellular matrixes regulated in cell.

In one embodiment, described method comprises the agonist making cells contacting miR-29a-c.In another embodiment, described method comprises the antagonist making cells contacting miR-29a-c.Also having in an embodiment, one or more extracellular matrixes described comprise fibrillin 1 (FBN1), Collagen type I α 1 (COL1A1), Collagen type I α 2 (COL1A2) and collagen type III α 1 (COL3A1).In some embodiments, one or more extracellular matrixes described raise after cells contacting miR-29a-c antagonist.In other embodiments, one or more extracellular matrixes described are lowered after cells contacting miR-29a-c agonist.

Inventors have demonstrated that miR-29a-c expresses to reduce in the cardiac fibroblast being exposed to TGF β, the miR-29a-c after prompting myocardial infarction reduces and may regulate (embodiment 5) by TGF β.What is interesting is, natriuretic peptide (as B-typeNatriuretic Peptide (BNP)) demonstrates and suppresses the gene expression (Kapoun etc., 2004) that by TGF β regulates relevant with fibrosis and transformation of myofibroblasts.In this, the mice that lacks of inventor's previous report heartspecific miRNAmiR-208 is to cardiac fibrosis with reinvent resistance and the BNP showing rising when baseline expresses (vanRooij etc., 2007).Due to the effect of known BNP antagonistic TGF beta, the BNP level that therefore inventor proposes to raise in these mices may strengthen the expression of miR-29a-c.Really, after eliminating miR-208, observe the dose dependent rising that miR-29a-c expresses, raise consistent (embodiment 5) with BNP expression.The expression of collagen related gene in the beta induced fibroblast of these data instruction TGF, this carries out via reduction miR-29a-c level at least partly, and miR-29a-c suppresses by the BNP secreted by myocardial cell.So, the invention provides the method improving miR-29a-c expression and/or activity by using at least one TGF beta inhibitor in experimenter.TGF beta inhibitor can comprise the anti-TGF β antibody, TGF β antisense molecule and the micromolecule that suppress TGF 'beta ' activity, as U.S. Patent No. 6, and 509, described in 318, by addressing complete income herein.TGF beta inhibitor also can with miR-29a-c agonist conbined usage, as combination treatment be used in experimenter, treat cardiac fibrosis, cardiac hypertrophy or heart failure.TGF beta inhibitor also can be used with miR-29a-c agonist altogether, in order to treatment in experimenter or prevention tissue fibering.

Except except controlling to play a significant role in the fibrosis in heart, miR-29 family all in expression prompting, it also may play a role in other fibre modification indication, such as those relate to kidney, liver and lung.Also observe the fibrosis of diabetes with secondary.1 type and type 2 diabetes mellitus patient are in the cardiomyopathy risk of rising.Cardiomyopathy in diabetes is relevant with cluster feature, and (diastoliccompliance), interstitial fibrosis and myocyte hypertrophy are complied with in the diastole comprising reduction.

Present invention also offers the method subject or prevention tissue fibering.In one embodiment, described method comprises the experimenter that qualification has tissue fibering or fibrosis risk in a organized way; And improve expression and/or the activity of the miR-29a-c in the Skeletal Muscle Cell of described experimenter or fibroblast.In another embodiment, described tissue fibering is cardiac fibrosis, scleroderma (circumscribed or systematic), skeletal muscle fiber, hepatic fibrosis, renal fibrosis, pulmonary fibrosis or diabetic fibrosis.In some embodiments, the expression and/or the activity that improve miR-29a-c comprise the agonist using miR-29a-c to described experimenter.In other embodiments, the expression and/or the activity that improve miR-29a-c comprise the expression vector using coding miR-29a-c to described experimenter.In another embodiment, described method comprises further and uses non-miR-29a-c fibre modification therapy to described experimenter.

The present invention is encompassed in the method for the tissue fibering that treatment is relevant with one or more illness or disease in required experimenter.In one embodiment, described method comprises the agonist using miR-29a-c to described experimenter.In another embodiment, described method comprises the expression vector using coding miR-29a-c to described experimenter.Described one or more illness relevant with tissue fibering or disease can include but not limited to congenital hepatic fibrosis (CHF); Renal tubular interstitium fibrosis; The pulmonary fibrosis relevant with autoimmune conditions (such as rheumatoid arthritis, lupus and sarcoidosis); The interstitial fibrosis relevant with diabetic cardiomyopathy; The skeletal muscle fiber relevant with muscular dystrophy (such as Duchenne muscular dystrophy and duchenne muscular dystrophy), denervation atrophy and neuromuscular disease (such as acute polyneuritis, poliomyelitis, Werdig/Hoffman disease, amyotrophic lateral sclerosis and Progressive symmetric erythrokeratodermia oblongata atrophy disease).

The present invention is also contained treatment and is run off, lacks or generate the method that deficiency is the pathology/defect of feature with collagen.Use the antagonist of miR-29a-c, the expression of collagen can be improved in order to replace the collagen or supplementary existing collagen that run off at position in need.So, the invention provides the method for the collagen deposition in induced tissue, comprise the antagonist making described contact tissue miR-29a-c.Described antagonist can for miR-29a, miR-29b and/or miR-29c.In one embodiment, described antagonist comprises the sequence with SEQIDNO:18 complementation.In another embodiment, described antagonist comprises the sequence with SEQIDNO:19 complementation.In another embodiment, described antagonist comprises the sequence with SEQIDNO:20 complementation.Described antagonist can be the tiny RNA antagonist of miR-29a-c, the antisense oligonucleotide of the ripe miR-29a-c sequence of targeting or comprise the inhibitory RNA molecules (such as siRNA or shRNA) of the sequence identical with ripe miR-29a-c sequence, ribozyme or other inhibition nucleic acid any.Described antagonist can connect or coupling has the described antagonist of promotion to enter the medicament of cell or tissue.To improve collagen deposition can be useful and include but not limited to Ehlers Danlos syndrome (EDS) by the various illness using miR-29a-c antagonist to treat and disease; Vitamin C deficiency (also referred to as vitamin C deficiency); Skin aging (such as natural aging and the photoaging due to sunburn); With drag line (stretchmark) (rill (striae)).

Ehlers Danlos syndrome (EDS) is one group of that caused by collage synthesis defect, to affect the mankind and domestic animal rare inherited disorder.According to idiovariation, the order of severity of disease can from slightly changing to threat to life.Sudden change in ADAMTS2, COL1A1, COL1A2, COL3A1, COL5A1, COL5A2, PLOD1 and TNXB gene causes EDS.Sudden change in these genes usually change collagen or with structure, the generation of the interactional protein of collagen or process.Collagen defect can weaken the connective tissue in skin, skeleton, blood vessel and organ, causes the feature of disease.So, the collagen deposition of being induced by miR-29a-c antagonist of the present invention can play the normal collagen level in supplementary EDS patient and the symptom that palliates a disease.Similarly, the antagonist using miR-29a-c can be of value to suffers from vitamin C deficiency or scorbutic experimenter.Vitamin C deficiency is a kind ofly derived from the not enough disease of vitamin C picked-up, and vitamin C is in the mankind required for normal collage synthesis.

Being derived from the collagen deposition that miR-29a-c antagonist uses in tissue also can be useful in various cosmetic applications.By natural aging process or the effect that is excessively exposed to the skin aging that photic damage caused by sunlight produces by there being required experimenter to use miR-29a-c antagonist to reduce.Use the disappearance that miR-29a-c antagonist also can promote drag line.Drag line is that skin tears by corium a kind of cicatrization form caused.Drag line is and grows (adolescence is common) fast or body weight increases the result of (such as gestation) relevant skin Rapid stretching.

The applicable tissue of method of the present invention comprises facial tissue, such as volume tissue, lip, cheek, chin, eyebrow, eyelid, now or mouth near, hands tissue, neck tissue, arm tissue, lower limb tissue, gastric tissue or breast tissue.In some embodiments, described tissue can comprise wound, skin graft, scar tissue, wrinkle, cutis laxa, sunburn, chemical damage, scald, cold injury and/or drag line.

In another embodiment of the invention, contact tissue miR-29a-c antagonist is comprised be injected in described tissue, be injected into supply described tissue vascular system in or topical application.Topical application can be ointment, emulsifiable paste, gel, ointment or balsam.In another embodiment, described method comprises use compression bandage further or wraps thing (dressing).MiR-29a-c antagonist can be made to contact described tissue exceed once.In some embodiments, antagonist contacts described tissue 2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,60,70,80,90 or 100 times.In other embodiments, antagonist contacted described tissue more than 2,3,4,5 or 6 days, 1,2,3 or 4 weeks, 1,2,3,4,5,6,7,8,9,10 or 11 months, or 1,2,3,3,4,5,6,7,8,9,10,15,20 or 25 year.

Also having in an embodiment, described method comprises further makes described contact tissue second medicament.Described second medicament can include but not limited to topical vitamin A, topical vitamin C or vitamin E.In another embodiment, described method comprises further and carries out the second process to described tissue.Described second process can comprise Chemopeel, laser treatment, skin leveling or dermabrasion.In another embodiment, be organized in described in the experimenter suffering from Ehlers Danlos syndrome or vitamin C deficiency.

The present invention also contains miR-29a-c antagonist as short fibre modification agent for the soft speckle in vascular system is transformed into fibrotic tissue to prevent the purposes of myocardial infarction.Soft speckle be positioned at arterial wall leather lining below, the structure of the main lipid containing cholesterol.Recently, recognize that these soft speckles tend to break, cause the formation of blood clot, it can block the blood flow by this tremulous pulse potentially and cause heart attack (i.e. myocardial infarction).These soft speckles are usually responsible for causing and are not had Symptomatic health volunteer to suffer unexpected heart attack on the surface just.After soft speckle breaks, blood vessel wall heals and soft speckle becomes hard speckle, and this rarely causes further problem.So, the strategy making soft speckle be transformed into fibrotic tissue can prevent soft speckle to break and the myocardial infarction that may bring out.

Just as described in detail above, that collagen deposition is caused to the suppression of miR-29a-c and that fibrotic tissue is formed increase.Thus, the invention provides the method formed for increasing the fibrotic tissue in blood vessel wall, comprise the one or more soft speckle position be delivered to by the antagonist of miR-29a-c in blood vessel wall, wherein after sending described miR-29a-c antagonist, described soft speckle is transformed into fibrotic tissue.Soft speckle can be identified by means known in the art, includes but not limited to intravascular ultrasound and computerized tomography (Sahara etc. (2004) EuropeanHeartJournal, Vol.25:2026-2033; Budhoff (2006) J.Am.Coll.Cardiol, Vol.48:319-321; Hausleiter etc. (2006) J.Am.Coll.Cardiol, Vol.48:312-318).Any miR-29a-c antagonist described herein is suitable for using in the process.

Can by direct injection or by using the device of conduit or separation coronary circulation that miR-29a-c antagonist is delivered to one or more soft speckle position.In one embodiment, miR-29a-c antagonist is delivered to one or more soft speckle position by the medical apparatus (such as support or sacculus) by using in vascular surgery.MiR-29 antagonist can be coated on metal rack to form bracket for eluting medicament.Bracket for eluting medicament be keep narrowing or ill artery open discharge compound to prevent the support of cell proliferation and/or inflammation.MiR-29a-c antagonist can be applied to and be imbedded in metal rack in thin polymer to discharge miR-29a-c in time.Known in the art by the method for therapeutic compound coating stent.Participate in such as U.S. Patent No. 7,144,422; U.S. Patent No. 7,055,237; And WO2004/004602, by addressing complete income herein.In some embodiments, miR-29a-c can combinationally use to generate the preparaton for mixing in bracket for eluting medicament and sacculus with other anti-restenosis compound.The compound being applicable to using with miR-29a-c antagonist-combination includes but not limited to Taxol (paclitaxel), rapamycin (rapamycin) (sirolimus (sirolimus)), tacrolimus (tacrolimus), 40-epi-(1-tetrazolyl)-rapamycin (zotarolimus), everolimus (everolimus), Taxotere (docetaxel), pimecrolimus (pimecrolimus) and derivant thereof.

The method for removing or eliminate miR-29a-c agonist after the treatment is also contained in the present invention.In one embodiment, described method comprises the binding site district using fibroblast-like cell specific promoter process LAN miR-29a-c in fibroblast.The sequence of the seed zone of described binding site district preferably containing miR-29a-c.In some embodiments, described binding site can containing the sequence from one or more target things 3'UTR of miR-29a-c, such as COL1A1, COL1A2, COL1A3 and/or FBN1.In another embodiment, miR-29a-c antagonist can be used to weaken or to stop the function of Microrna after miR-29a-c agonist.In another embodiment, the invention provides the method for removing or eliminate miR-29a-c antagonist after the treatment.Described method can be included in the binding site of process LAN miR-20a-c antagonist in the fibroblast or other tissue that application of miR-29a-c antagonist.

Combination treatment

In another embodiment, the agonist of miR-29a-c be used for the treatment of the treatment form families of cardiac hypertrophy, heart failure and myocardial infarction with other is used.So, more " standard " pharmacopedics cardiac therapies with miR-29a-c agonist combinations can also be provided to experimenter.The example of other therapies includes but not limited to so-called " beta-Blocking agent ", antihypertensive, cardiac tonic, antithrombotic, vasodilator, hormone antagonist, muscular strength medicine (iontrope), diuretic, endothelin receptor antagonists, calcium channel blocker, phosphodiesterase inhibitor, ACE inhibitor, hypertensin 2 type antagonist and cytokine blocker/inhibitor and hdac inhibitor.

Combination can be realized as follows, even if heart cell contact comprises the agonist of miR-29a-c and the single compositions of standard agent or pharmacology's preparaton, or make cell contact two kinds of different components or preparaton simultaneously, wherein compositions comprises an agonist of miR-29a-c, and another kind comprises standard agent.Or the therapy of described use miR-29a-c agonist can before or after the using of another medicament, interval be several minutes to several weeks.Separately in the embodiment of cell application standard medicament and miR-29a-c agonist, generally to guarantee between time of at every turn sending not through significant a period of time, make described medicament and miR-29a-c agonist can still can advantageously to cells play combined effect.In this type of situation, usually can make cell at a distance of about 12-24 hour, more preferably in contact two kinds of forms in about 6-12 hour, time delay most preferably only has an appointment 12 hours.But, in some cases, significant prolongation treatment time section may be wished, between wherein respectively using through a couple of days (2,3,4,5,6 or 7) to several weeks (1,2,3,4,5,6,7 or 8).

Also conceivable is can wish to exceed once to use miR-29a-c agonist or another medicament.In this, various combination can be adopted.For example, when miR-29a-c agonist is " A ", another medicament is " B ", the following arrangement based on altogether using for 3 times and 4 times is exemplary:

A/B/AB/A/BB/B/AA/A/BB/A/AA/B/BB/B/B/AB/B/A/B

A/A/B/BA/B/A/BA/B/B/AB/B/A/AB/A/B/AB/A/A/BB/B/B/A

A/A/A/BB/A/A/AA/B/A/AA/A/B/AA/B/B/BB/A/B/BB/B/A/B

Contain other combination equally.

Pharmacological treatment agent and application process, dosage, etc. be well known to a person skilled in the art (to participate in such as " PhysiciansDeskReference ", Klaassen " ThePharmacologicalBasisofTherapeutics ", " Remington'sPharmaceuticalSciences " and " TheMerckIndex " the 11st edition, by addressing by relevant portion income herein), and can combine according to disclosure herein and the present invention.Depending on the situation of treated experimenter, will inevitably there are some changes in dosage.The people being responsible for using in any situation can be the dosage that each experimenter determines to be suitable for, and this type of individual decision is in the technical scope of those of ordinary skill in the art.

The non-limitative example of the pharmacological treatment agent that can use in the present invention comprises antihyperlipoproteinemic, arteriosclerosis medicine, antithrombotic/fibrinolytic, coagulant, anti-arrhythmia medicine, antihypertensive, vasopressor, therapeutic agent for congestive heart failure, anti-anginal drug, antibacterial or its combination.

In addition, it should be noted that and can use any following every new set of developing cardiac therapies target gene, as using beta-Blocking agent (seeing below) in this example.Although expecting manyly in these genes may have overlapping, the gene target made new advances likely can be developed.

In certain embodiments, the using of medicament (being called in this article " antihyperlipoproteinemic ") of the concentration reducing one or more blood fat and/or lipoprotein can be combined with according to cardiovascular therapy of the present invention, particularly in the treatment thickening or block of atherosclerosis and vascular tissue.In certain embodiments, antihyperlipoproteinemic can comprise fragrant oxygen alkanoic acid/fiber acid derivative, resin/bile acid masking agent (sequesterant), HMGCoA reductase inhibitor, nicotinic acid derivates, thyroxin or thyroid hormone analogs, mix agent or its combination.

The non-limitative example of virtue oxygen alkanoic acid/fiber acid derivative comprises beclobrate (beclobrate), enzafibrate, binifibrate (binifibrate), ciprofibrate (ciprofibrate), clinofibrate (clinofibrate), CLOF (clofibrate) (clofibrate (atromide)-S), clofibric acid (clofibricacid), etofibrate (etofibrate), fenofibrate (fenofibrate), gemfibrozil (gemfibrozil) (lobid), nicofibrate (nicofibrate), pirifibrate (pirifibrate), Ronifibrate (ronifibrate), simfibrate (simfibrate) and etofylline clofibrate (theofibrate).

The non-limitative example of resin/bile acid masking agent comprises colestyramine (cholestyramine) (cholybar, questran), colestipol (colestipol) (colestid) and DEAE-sephadex (polidexide).

The non-limitative example of HMGCoA reductase inhibitor comprises lovastatin (lovastatin) (lovastatin (mevacor)), pravastatin (pravastatin) (pravochol) or simvastatin (simvastatin) (zocor).

The non-limitative example of nicotinic acid derivates comprises nicotinic acid, acepimox, niceritrol (niceritrol), nicoclonate (nicoclonate), nicomol (nicomol) and oxiniacic acid (oxiniacicacid).

The non-limitative example of thyroxin and analog thereof comprises etoroxate, thyropropic acid and thyroxine.

The non-limitative example mixing antihyperlipoproteinemic comprises acifran (acifran), azacosterol (azacosterol), benfluorex (benfluorex), β-benzyl butyramide (β-benzalbutyramide), carnitine (carnitine), chondroitin sulfate (chondroitinsulfate), clomestrone (clomestrone), detaxtran, Dextran Sodium Sulfate (dextransulfatesodium), EPA, the fast quinoline of red ketone (eritadenine), furazabol (furazabol), meglutol (meglutol), AC-233 (melinamide), mytatrienediol (mytatrienediol), ornithine (ornithine), gamma oryzanol (γ-oryzanol), pantethine (pantethine), tetraacethyl pentaerythritol ester (pentaerythritoltetraacetate), phenylbutyramide (α-phenylbutyramide), pirozadil (pirozadil), probucol (probucol) (lorelco), cupreol (β-sitosterol), sultosilic acid-piperazine salt (sultosilicacid-piperazinesalt), tiadenol (tiadenol), triparanol (triparanol) and xenbucin (xenbucin).The non-limitative example of arteriosclerosis medicine comprises anginin phenolic ester (pyridinolcarbamate).

In certain embodiments, can eliminate contributing to or preclude blood grumeleuse medicament use with modulator use combination, in the treatment particularly blocked in atherosclerosis and vascular system (such as tremulous pulse).The non-limitative example of antithrombotic and/or fibrinolytic comprises anticoagulant, anticoagulant antagonist, antiplatelet drug, thrombolytic, thrombolytic antagonist or its combination.

In certain embodiments, the antithrombotic that preferred oral is used, such as such as aspirin (aspirin) and warfarin (wafarin) (Coumadin).

The non-limitative example of anticoagulant comprises acenocoumarol (acenocoumarol), ancrod (ancrod), anisindione (anisindione), bromindione (bromindione), clorindione (clorindione), coumetarol (coumetarol), cyclocoumarol (cyclocumarol), Dextran Sodium Sulfate (dextransulfatesodium), dicoumarol (dicumarol), diphenadione (diphenadione), biscoumacetate (ethylbiscoumacetate), ethylene dicoumarol (ethylidenedicoumarol), Fluindione (fluindione), heparin (heparin), hirudin (hirudin), sodium apolate (lyapolatesodium), oxazidione (oxazidione), the many sulphuric acid of pentosan (pentosanpolysulfate), phenindione (phenindione), phenprocoumon (phenprocoumon), phosvitin (phosvitin), G-137 (picotamide), tioclomarol (tioclomarol) and warfarin (warfarin).

The non-limitative example of antiplatelet drug comprises aspirin (aspirin), dextran (dextran), dipyridamole (dipyridamole) (persantin (persantin)), heparin (heparin), sulfinpyrazone (sulfmpyranone) (Antorane (anturane)) and ticlopidine (ticlopidine) (resisting bolt (ticlid) strenuously).

The non-limitative example of thrombolytic comprises tissue plasminogen activator (activase), fibrinolysin, prourokinase, urokinase (abbokinase) streptokinase (streptase), anistreplase (anistreplase)/APSAC (Eminase (eminase)).

Experimenter suffers from some embodiment of hemorrhage or hemorrhage probability rising wherein, can use the medicament that can strengthen blood clotting.The non-limitative example of blood clotting promoter comprises thrombolytic antagonist and anticoagulant antagonist.

The non-limitative example of anticoagulant antagonist comprises protamine (protamine) and vitamin K1.

The non-limitative example of thrombolytic antagonist comprises aminocaproic acid (amiocaproicacid) (amicar) and tranexamic acid (tranexamicacid) (amstat).The non-limitative example of antithrombotic comprises anagrelide (anagrelide), argatroban (argatroban), cilutazoline (cilstazol), daltroban (daltroban), defibrotide (defibrotide), Enoxaparin (enoxaparin), fraxiparine (fraxiparine), indobufen (indobufen), lamoparan, ozagrel (ozagrel), G-137 (picotamide), plafibride (plafibride), Fragmin (tedelparin), ticlopidine (ticlopidine) and triflusal (triflusal).

The non-limitative example of anti-arrhythmia medicine comprises I class anti-arrhythmia medicine (sodium channel inhibitor), II class anti-arrhythmia medicine (beta-adrenergic blocking agent), III class anti-arrhythmia medicine (repolarization prolongation medicine), IV class anti-arrhythmia medicine (calcium channel blocker) and mixes the anti-arrhythmia medicine of type.

The non-limitative example of sodium channel inhibitor comprises the anti-arrhythmia medicine of IA class, IB class and IC class.The non-limitative example of the anti-arrhythmia medicine of IA class comprises disopyramide (disppyramide) (norpace), procainamide (procainamide) (pronestyl) and quinidine (quinidine) (quinidex).The non-limitative example of the anti-arrhythmia medicine of IB class comprises lignocaine (lidocaine) (xylocaine), tocainide (tocainide) (tonocard) and mexiletine (mexiletine) (mexitil).The non-limitative example of the anti-arrhythmia medicine of IC class comprises encainide (encainide) (enkaid) and flecainide (flecainide) (tambocor).

Beta-Blocking agent is (also referred to as beta-adrenergic blocking agent, beta-adrenergic antagonist or the anti-arrhythmia medicine of II class) non-limitative example comprise acebutolol (acebutolol) (sectral), alprenolol (alprenolol), amosulalol (amosulalol), arotinolol (arotinolol), atenolol (atenolol), befunolol (befunolol), betaxolol (betaxolol), bevantolol (bevantolol), bisoprolol (bisoprolol), bopindolol (bopindolol), bucumolol (bucumolol), bufetolol (bufetolol), bufuralol (bufuralol), bunitrolol (bunitrolol), bupranolol (bupranolol), butydrine hydrochloride (butidrinehydrochloride), butofilolol (butofilolol), carazolol (carazolol), carteolol (carteolol), carvedilol (carvedilol), celiprolol (celiprolol), cetamolol (cetamolol), cloranolol (cloranolol), dilevalol (dilevalol), epanolol (epanolol), esmolol (esmolol) (brevibloc), indenolol (indenolol), labetalol (labetalol), levobunolol (levobunolol), mepindolol (mepindolol), metipranolol (metipranolol), metoprolol (metoprolol), moprolol (moprolol), nadolol (nadolol), nadoxolol (nadoxolol), nifenalol (nifenalol), nipradilol (nipradilol), oxprenolol (oxprenolol), penbutolol (penbutolol), pindolol (pindolol), practolol (practolol), pronetalol (pronethalol), Propranolol (propanolol) (inderal), sotalol (sotalol) (betapace), sulfinalol (sulfinalol), talinolol (talinolol), tertatolol (tertatolol), timolol (timolol), toliprolol (toliprolol) and xibornol (xibinolol).In certain embodiments, beta-Blocking agent comprises aryloxy propanol amine derivative.The non-limitative example of aryloxy propanol amine derivative comprises acebutolol (acebutolol), alprenolol (alprenolol), arotinolol (arotinolol), atenolol (atenolol), betaxolol (betaxolol), bevantolol (bevantolol), bisoprolol (bisoprolol), bopindolol (bopindolol), bunitrolol (bunitrolol), butofilolol (butofilolol), carazolol (carazolol), carteolol (carteolol), carvedilol (carvedilol), celiprolol (celiprolol), cetamolol (cetamolol), epanolol (epanolol), indenolol (indenolol), mepindolol (mepindolol), metipranolol (metipranolol), metoprolol (metoprolol), moprolol (moprolol), nadolol (nadolol), nipradilol (nipradilol), oxprenolol (oxprenolol), penbutolol (penbutolol), pindolol (pindolol), Propranolol (propanolol), talinolol (talinolol), tertatolol (tertatolol), timolol (timolol) and toliprolol (toliprolol).

The non-limitative example extending the medicament (also referred to as the anti-arrhythmia medicine of III class) of repolarization comprises amiodarone (amiodarone) (amiodaronum (cordarone)) and sotalol (sotalol) (betapace).

The non-limitative example of calcium channel blocker (also referred to as the anti-arrhythmia medicine of IV class) comprises Arylalkvl amine (such as bepridile, diltiazem (diltiazem), fendiline (fendiline), gallopamil (gallopamil), prenylamine (prenylamine), terodiline (terodiline), verapamil (verapamil)), dihydrogen pyridine derivative (felodipine (felodipine), isradipine (isradipine), nicardipine (nicardipine), nifedipine (nifedipine), nimodipine (nimodipine), nisoldipine (nisoldipine), nitrendipine (nitrendipine)), bridged piperazine derivatives (such as cinnarizine (cinnarizine), flunarizine (flunarizine), lidoflazine (lidoflazine)) or mix type calcium channel blocker (such as bencyclane (bencyclane), etafenone (etafenone), magnesium (magnesium), mibefradil (mibefradil) or perhexiline (perhexiline)).In certain embodiments, calcium channel blocker comprises long-acting dihydropyridine (nifedipine type) calcium antagonist.

The non-limitative example mixing the anti-arrhythmia medicine of type comprises vidarabine (adenosine) (adenocard), digoxin (digoxin) (lanoxin (lanoxin)), acecainide (acecainide), ajmaline (ajmaline), amoproxan (amoproxan), aprindine (aprindine), toluenesulfonic acid bretylium tosylate (bretyliumtosylate), bunaftine (bunaftine), butobendine (butobendine), capobenic acid (capobenicacid), cibenzoline (cifenline), Dimpyramidum (disopyranide), dihydrochinidin (hydroquinidine), indecainide (indecainide), SCH 1000 (ipatropiumbromide), lignocaine (lidocaine), lorajmine (lorajmine), lorcainide (lorcainide), meobentine (meobentine), moracizine (moricizine), pirmenol (pirmenol), neo-gilurytmal (prajmaline), Propafenone (propafenone), pyrinoline (pyrinoline), quinidine polygalacturonate (quinidinepolygalacturonate), quinidine sulfate (quinidinesulfate) and viquidil (viquidil).

The non-limitative example of antihypertensive comprises sympatholytic, α/β blocker, alpha blocker, antiangiotensin II medicine, beta-blocker, calcium channel blocker, vasodilator and mixes type antihypertensive.

The non-limitative example of alpha blocker (also referred to as alpha-adrenergic blocking agent or alpha-adrenergic antagonist) comprises amosulalol (amosulalol), arotinolol (arotinolol), dapiprazole (dapiprazole), doxazosin (doxazosin), Dihydroergotoxine Mesylate (ergoloidmesylate), fenspiride (fenspiride), indoramine (indoramin), labetalol (labetalol), nicergoline (nicergoline), prazosin (prazosin), terazosin (terazosin), tolazoline (tolazoline), trimazosin (trimazosin) and Yohimbine (yohimbine).In certain embodiments, alpha blocker can comprise quinazoline derivant.The non-limitative example of quinazoline derivant comprises alfuzosin (alfuzosin), bunazosin (bunazosin), doxazosin (doxazosin), prazosin (prazosin), terazosin (terazosin) and trimazosin (trimazosin).

In certain embodiments, antihypertensive is alpha-1 adrenergic antagonists and Beta-3 adrenergic antagonist.The non-limitative example of α/β blocker comprises labetalol (labetalol) (normodyne, trandate).

The non-limitative example of antiangiotensin II medicine comprises angiotensin-convertion enzyme inhibitor and angiotensin ii receptor antagonist.The non-limitative example of angiotensin-convertion enzyme inhibitor (ACE inhibitor) comprises alacepril (alacepril), enalapril (enalapril) (vasotec), captopril (captopril), cilazapril (cilazapril), delapril (delapril), according to Na Pulali (enalaprilat), fosinopril (fosinopril), lisinopril (lisinopril), moveltopril, perindopril (perindopril), quinapril (quinapril) and ramipril (ramipril).The non-limitative example of angiotensin-ii receptor blocker (also referred to as angiotensin ii receptor antagonist, ANG receptor blocking agent or ANG-II1 receptor blocker (ARBS)) comprises blood vessel Candesartan (angiocandesartan), Eprosartan (eprosartan), irbesartan (irbesartan), losartan (losartan) and valsartan (valsartan).

The non-limitative example of sympatholytic comprises the sympatholytic of the maincenter of acting on or acts on the sympatholytic of surrounding.The non-limitative example acting on the sympatholytic (also referred to as central nervous system (CNS) sympatholytic) of maincenter comprises clonidine (clonidine) (catapres), guanabenz (guanabenz) (wytensin) guanfacine (guanfacine) (tenex) and methyldopa (methyldopa) (aldomet).The non-limitative example acting on the sympatholytic of surrounding comprises ganglioplegic, adrenergic neuron blocker, beta-adrenergic blocking agent or alpha 1 adrenergic blocker.The non-limitative example of ganglioplegic comprises mecamylamine (mecamylamine) (inversine) and Trimethaphan (trimethaphan) (arfonad).The non-limitative example of adrenergic neuron blocker comprises guanethidine (guanethidine) (ismelin) and reserpine (reserpine) (serpasil).The non-limitative example of beta-adrenergic blocking agent comprises acebutolol (acenitolol) (sectral), atenolol (atenolol) (Tenormin (tenormin)), betaxolol (betaxolol) (Kerlone (kerlone)), carteolol (carteolol) (cartrol), labetalol (labetalol) (normodyne, trandate), metoprolol (metoprolol) (lopressor), nadolol (nadanol) (corgard), penbutolol (penbutolol) (levatol), pindolol (pindolol) (pindolol (visken)), Propranolol (propranolol) (propranolol (inderal)) and timolol (timolol) (blocadren).The non-limitative example of Alpha 1 adrenergic blocking agent comprises prazosin (prazosin) (Prazosin (minipress)), doxazosin (doxazocin) (Ka Dulei (cardura)) and terazosin (terazosin) (hytrin (hytrin)).

In certain embodiments, cardiovascular treatment agent can comprise vasodilator (such as cerebral vasodilator, coronary vasodilation medicine or peripheral vasodilator).In certain preferred aspects, vasodilator comprises coronary vasodilation medicine.The non-limitative example of coronary vasodilation medicine comprises Win-5494 (amotriphene), bendazol (bendazol), hemisuccinic acid benfurodil (benfurodilhemisuccinate), benziodarone (benziodarone), chlorazisin (chloracizine), carbocromene (chromonar), clobenfurol (clobenfurol), clonitrate (clonitrate), dilazep (dilazep), dipyridamole (dipyridamole), droprenilamine (droprenilamine), efloxate (efloxate), pentaerithrityl tetranitrate (erythrityltetranitrane), etafenone (etafenone), fendiline (fendiline), floredil (floredil), ganglefene (ganglefene), hexestrol two (β-diethyl amino benzyl ethyl ether) (herestrolbis (β-diethylaminoethylether)), hexobendine (hexobendine), toluenesulfonic acid itramine tosylate (itramintosylate), khellin (khellin), lidoflazine (lidoflanine), hexanitro-mannite (mannitolhexanitrane), medibazine (medibazine), nicorglycerin, four pentaerythritol tetranitrates (pentaerythritoltetranitrate), pentrinitrol (pentrinitrol), perhexiline (perhexiline), pimefylline (pimefylline), trapidil (trapidil), Tricromyl (tricromyl), trimetazidine (trimetazidine), triethanolamine trinitrate biphosphate (trolnitratephosphate) and Wei Sinading (visnadine).

In certain embodiments, vasodilator can comprise extended regimen vasodilator or hypertension burst vasodilator.The non-limitative example of extended regimen vasodilator comprises hydralazine (hydralazine) (apresoline) and minoxidil (minoxidil) (loniten).The non-limitative example of hypertension burst vasodilator comprises Nitroprusside (nitroprusside) (nipride), diazoxide (diazoxide) (hyperstatIV), hydralazine (hydralazine) (apresoline), minoxidil (minoxidil) (loniten) and verapamil (verapamil).

The non-limitative example mixing type antihypertensive comprises ajmaline (ajmaline), γ-aminobutyric acid (γ-aminobutyricacid), butylbenzene iodine ammonia (bufeniode), cicletanine (cicletainine), ciclosidomine (ciclosidomine), the green Herba chenopodii amine (cryptenaminetannate) of tannic acid, fenoldopam (fenoldopam), flosequinan (flosequinan), ketanserin (ketanserin), mebutamate (mebutamate), mecamylamine (mecamylamine), methyldopa (methyldopa), methyl 4-pyridyl ketone thiacetazone (methyl4-pyridylketonethiosemicarbazone), muzolimine (muzolimine), pargyline (pargyline), pempidine (pempidine), pinacidil (pinacidil), piperoxan (piperoxan), primaperone (primaperone), protoveratrine (protoveratrine), Luo Baxin (raubasine), rescimetol (rescimetol), rilmenidine (rilmenidene), Saralasin (saralasin), sodium nitroprusside (sodiumnitrorusside), ticrynafen (ticrynafen), camphorsulfonic acid Trimethaphan (trimethaphancamsylate), tryrosinase (tyrosinase) and urapidil (urapidil).

In certain embodiments, antihypertensive can comprise aryl ethanol amine derivative, benzothiadiazine derivatives, N-carboxyalkyl (peptide/lactams) derivant, dihydrogen pyridine derivative, guanidine derivatives, hydrazine/phthalazines, imdazole derivatives, quaternary ammonium compound, reserpine derivant or sufosfamide derivant.

The non-limitative example of aryl ethanolamines comprises amosulalol (amosulalol), bufuralol (bufuralol), dilevalol (dilevalol), labetalol (labetalol), pronetalol (pronethalol), sotalol (sotalol) and sulfinalol (sulfinalol).

The non-limitative example of benzothiadiazine derivatives comprises althiazide (althizide), bendroflumethiazide (bendroflumethiazide), benzthiazide (benzthiazide), behyd (benzylhydrochlorothiazide), butizide (buthiazide), chlorothiazide (chlorothiazide), chlortalidone (chlorthalidone), cyclopenthiazide (cyclopenthiazide), cyclothiazide (cyclothiazide), diazoxide (diazoxide), epitizide (epithiazide), ethiazide (ethiazide), fragrant thiazine (fenquizone), hydrochlorothiazide (hydrochlorothizide), hydroflumethiazide (hydroflumethizide), methyclothiazide (methyclothiazide), meticrane (meticrane), metolazone (metolazone), paraflutizide (paraflutizide), polythiazide (polythizide), teclothiazide (tetrachlormethiazide) and trichlormethiazide (trichlormethiazide).

The non-limitative example of N-carboxyalkyl (peptide/lactams) derivant comprises alacepril (alacepril), captopril (captopril), cilazapril (cilazapril), delapril (delapril), enalapril (enalapril), enalaprilat (enalaprilat), fosinopril (fosinopril), lisinopril (lisinopril), moveltipril (moveltipril), perindopril (perindopril), quinapril (quinapril) and ramipril (ramipril).

The non-limitative example of dihydrogen pyridine derivative comprises amlodipine (amlodipine), felodipine (felodipine), isradipine (isradipine), nicardipine (nicardipine), nifedipine (nifedipine), nilvadipine (nilvadipine), nisoldipine (nisoldipine) and nitrendipine (nitrendipine).

The non-limitative example of guanidine derivatives comprises betanidine (bethanidine), debrisoquine (debrisoquin), guanabenz (guanabenz), guanacline (guanacline), guanadrel (guanadrel), guanazodine (guanazodine), guanethidine (guanethidine), guanfacine (guanfacine), guanoclor (guanochlor), guanoxabenz (guanoxabenz) and guanoxan (guanoxan).

The non-limitative example of hydrazine/phthalazines comprises budralazine (budralazine), cadralazine (cadralazine), dihydralazine (dihydralazine), endralazine (endralazine), hydracarbazine (hydracarbazine), hydralazine (hydralazine), pheniprazine (pheniprazine), pildralazine (pildralazine) and todralazine (todralazine).

The non-limitative example of imdazole derivatives comprises clonidine (clonidine), lofexidine (lofexidine), phentolamine (phentolamine), tiamenidine (tiamenidine) and tolonidine (tolonidine).

The non-limitative example of quaternary ammonium compound comprises bromination nitrogen penta ammonium (azamethoniumbromide), chlorisondamine chloride (chlorisondaminechloride), hexamethonium (hexamethonium), diformazan sulphuric acid cyanogen penta morpholine (pentacyniumbis (methylsulfate)), pentamethonium bromide (pentamethoniumbromide), pentolinium tartrate (pentoliniumtartrate), phenactropinium chloride (phenactropiniumchloride) and trimethidinium methosulfate (trimethidiniummethosulfate).

The non-limitative example of reserpine derivant comprises bietaserpine (bietaserpine), deserpidine (deserpidine), rescinnamine (rescinnamine), reserpine (reserpine) and syrosingopine (syrosingopine).

The non-limitative example of sulphone amide derivative comprises ambuside (ambuside), clopamide (clopamide), furosemide (furosemide), indapamide (indapamide), quinethazone (quinethazone), tripamide (tripamide) and xipamide (xipamide).

Vasopressor is generally used for improving blood pressure between the contingent shock stage of intra-operative.The non-limitative example of vasopressor (also referred to as antihypotensive) comprises amezinium Methylsulfate (ameziniummethylsulfate), angiotensinamide (angiotensinamide), dimetofrine (dimetofrine), dopamine (dopamine), etifelmine (etifelmin), etilefrine (etilefrin), gepefrine (gepefrine), metaradrine (metaraminol), midodrine (midodrine), norepinephrine (norepinephrine), pholedrine (pholedrine) and synephrine (synephrine).

The non-limitative example being used for the treatment of the medicament of congestive heart failure comprises antiangiotensin II medicine, afterload-preload alleviates process (afterload-preloadreductiontreatment), diuretic and muscular strength medicine (inotropicagent).

In certain embodiments, the animal subjects that can not tolerate angiotensin antagonist can be treated with combination treatment.This type of therapy may be combined with using of hydralazine (hydralazine) (Aprelazine (apresoline)) and isosorbide dinitrate (isosorbidedinitrate) (isordil, sorbitrate).

The non-limitative example of diuretic comprises thiazine or benzothiadiazine derivatives (such as althiazide (althiazide), bendroflumethiazide (bendroflumethazide), benzthiazide (benzthiazide), behyd (benzylhydrochlorothiazide), butizide (buthiazide), chlorothiazide (chlorothiazide), chlorothiazide (chlorothiazide), chlortalidone (chlorthalidone), cyclopenthiazide (cyclopenthiazide), epitizide (epithiazide), ethiazide (ethiazide), ethiazide (ethiazide), fenquizone (fenquizone), hydrochlorothiazide (hydrochlorothiazide), hydroflumethiazide (hydroflumethiazide), methyclothiazide (methyclothiazide), meticrane (meticrane), metolazone (metolazone), paraflutizide (paraflutizide), polythiazide (polythizide), teclothiazide (tetrachloromethiazide), trichlormethiazide (trichlormethiazide)), organic mercury (such as chlormerodrin (chlormerodrin), meralluride (meralluride), mercurophylline (mercamphamide), Diucardyn sodium (Ayerst) (mercaptomerinsodium), mercumallylic acid (mercumallylicacid), mercumatilin sodium (mercumatilindodium), calomel (mercurouschloride), mersalyl (mersalyl)), pteridine (such as furterene (furterene), triamterene (triamterene)), purine (such as acefylline, 7-xanturil (7-morpholinomethyltheophylline), pamobrom, protheobromine (protheobromine), theobromine (theobromine)), steroid comprises aldosterone antagonist (such as canrenone (canrenone), oleandrine (oleandrin), spironolactone (spironolactone)), sulphone amide derivative (such as acetazolamide (acetazolamide), ambuside (ambuside), azosemide (azosemide), bumetanide (bumetanide), butazolamide (butazolamide), chloraminophenamide (chloraminophenamide), clofenamide (clofenamide), clopamide (clopamide), clorexolone (clorexolone), diphenyl-methane-4,4'-bis-sulfanilamide (diphenylmethane-4,4'-disulfonamide), disulfamide (disulfamide), ethoxzolamide (ethoxzolamide), furosemide (furosemide), indapamide (indapamide), mefruside (mefruside), methazolamide (methazolamide), piretanide (piretanide), quinethazone (quinethazone), torasemide (torasemide), tripamide (tripamide), xipamide (xipamide)), uracil (such as aminometradine (aminometradine), amisometradine (amisometradine)), protect potassium antagonist (potassiumsparingantagonist) (such as amiloride (amiloride), triamterene (triamterene)) or mix diuretic (such as aminozine, arbutin (arbutin), chlorazanil (chlorazanil), Ethacrynic (ethacrynicacid), etozolin (etozolin), hydracarbazine (hydracarbazine), isosorbide (isosorbide), mannitol (mannitol), metochalcone (metochalcone), muzolimine (muzolimine), perhexiline (perhexiline), ticrynafen (ticrnafen) and carbamide).

The non-limitative example of inotropic agent (also referred to as cardiac tonic) comprises acefylline, acetyldigitoxin (acetyldigitoxin), 2-amino-4-picoline (2-amino-4-picoline), amrinone (amrinone), benfurodil hemisuccinate (benfurodilhemisuccinate), bucladesine (bucladesine), cerberosine, Camphotamide (camphotamide), convallatoxin (convallatoxin), cymarin (cymarin), denopamine (denopamine), deslanoside (deslanoside), gitalin (digitalin), Folium Digitalis Purpureae (digitalis), Digitoxin (digitoxin), digoxin (digoxin), dobutamine (dobutamine), dopamine (dopamine), dopexamine (dopexamine), enoximone (enoximone), erythrophleine (erythrophleine), fenalcomine (fenalcomine), gitalin (gitalin), gitoxin (gitoxin), glycocyamine (glycocyamine), Heptaminol (heptaminol), hydrastinine (hydrastinine), ibopamine (ibopamine), lanatoside (lanatoside), metamivanum (metamivam), milrinone (milrinone), cerberoside (nerifolin), oleandrine (oleandrin), Wu Bayin (ouabain), oxyfedrine (oxyfedrine), prenalterol (prenalterol), proscillaridine, resibufogenin (resibufogenin), Scillaren (scillaren), Scillaren (scillarenin), strphanthin, sulmazole (sulmazole), theobromine (theobromine) and xamoterol (xamoterol).

In particular embodiments, muscular strength medicine is heart glucosides, beta-adrenergic agonist or phosphodiesterase inhibitor.The non-limitative example of heart glucosides comprises digoxin (digoxin) (lanoxin (lanoxin)) and Digitoxin (digitoxin) (crystodigin).The non-limitative example of beta-adrenergic agonist comprises albuterol (albuterol), bambuterol (bambuterol), bitolterol (bitolterol), carbuterol (carbuterol), clenbuterol (clenbuterol), clorprenaline (clorprenaline), denopamine (denopamine), Dioxethedrine (dioxethedrine), dobutamine (dobutamine) (Dobutamine (dobutrex)), dopamine (dopamine) (intropin), dopexamine (dopexamine), ephedrine (ephedrine), etafedrine (etafedrine), ethylnorephinephrine (ethylnorepinephrine), fenoterol (fenoterol), formoterol (formoterol), hexoprenaline (hexoprenaline), ibopamine (ibopamine), neoisuprel (isoetharine), isoproterenol (isoproterenol), Mabuterol (mabuterol), orciprenaline (metaproterenol), methoxiphenadrin (methoxyphenamine), oxyfedrine (oxyfedrine), pirbuterol (pirbuterol), procaterol (procaterol), protokylol (protokylol), reproterol (reproterol), rimiterol (rimiterol), ritodrine (ritodrine), soterenol (soterenol), terbutaline (terbutaline), tretoquinol (tretoquinol), tulobuterol (tulobuterol) and xamoterol (xamoterol).The non-limitative example of phosphodiesterase inhibitor comprises amrinone (amrinone) (inocor).

Anti-anginal drug can comprise organic nitrate (organonitrate), calcium channel blocker, beta-Blocking agent and combination thereof.

The non-limitative example of organic nitrate (also referred to as nitric acid vasodilator) comprises nitroglycerin (nitro-bid, nitrostat), isosorbide dinitrate (isordil, sorbitrate) and amyl nitrite (amylnitrate) (aspirol, vaporole).

Endothelin (ET) is a kind of 21 amino acid whose peptides, and it has strong physiology and pathophysiology effect, and they seem to relate to the formation of heart failure.The effect of ET mediates via the interaction with two class cell surface receptors.A receptor (ET-A) is relevant with vasoconstriction and Growth of Cells, and Type B receptor (ET-B) is relevant with the release of the vasodilation that endotheliocyte mediates and other neuro hormone (such as aldosterone).The pharmacological agent that can suppress the ability of the generation of ET or its stimulation cells involved is known in the art.Suppress the generation of ET to relate to the medicament using and block and be called the enzyme of endothelin-converting enzyme, endothelin-converting enzyme relates to processes activated peptide from precursor.The ability of ET irritation cell is suppressed to relate to the medicament using and block ET and its acceptor interaction.The non-limitative example of endothelin receptor antagonists (ERA) comprises bosentan (Bosentan), enrasentan (Enrasentan), Ambrisentan, darusentan (Darusentan), tezosentan (Tezosentan), atrasentan (Atrasentan), Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC3711, BQ123 and BQ788.

In certain embodiments, the second therapeutic agent can comprise the operation of some types, this comprise such as preventative, diagnostic or by stages, curative (curative) and palliative operation.Operation (particularly Curative surgery) can be combined with other therapies (such as the present invention and one or more other medicaments).

This type of operative treatment agent for blood vessel and cardiovascular disease and disease well known to a person skilled in the art, and can include but not limited to implement operation to organism, provide cardiovascular mechanical prosthetic, angioplasty, coronary artery reperfusion, catheter ablation, provide embedded multiple rate defibrillator, Mechanical circulatory support or its combination to experimenter.In the present invention, the non-limitative example of spendable Mechanical circulatory support comprises intra aortic balloon counterpulsation, left ventricular assist device or its combination.

For the pharmaceutical formulation used experimenter and path

Present invention also offers the pharmaceutical composition comprising miR-29a-c agonist or antagonist.Agonist can be the expression vector of the nucleic acid segment comprising coding miR-29a-c or comprise the polynucleotide of ripe miR-29a-c sequence or its live part.Agonist can be included in lipid delivery vehicle.Antagonist can be the polynucleotide of hybridizing with miR-29a-c or its target thing.

When clinical practice, pharmaceutical composition can be prepared with the form suitable for predetermined application.Generally speaking, this can need to prepare and is substantially free of pyrogen and other is to the compositions of the impurity that the mankind or animal can be harmful to.

Colloidal dispersion system (such as macromolecular complex, Nano capsule, microsphere, pearl and the system based on lipid comprise oil in water emulsion, micelle (micelle), mixed micelle and liposome) can be used as the oligonucleotide inhibitor (such as antagonist) of Microrna function or the delivery vehicle of construct expressing specific Microrna.For by delivery of nucleic acids of the present invention to cardiac muscle and skeletal muscle tissue suitably commercialization lipomul comprise iII, Nutrilipid and other similar liplid emulsions.A kind of preferred gluey system used as delivery vehicle in body is liposome (i.e. artificial membrane vesicle).The preparation of this type systematic and use are well known in the art.Exemplary preparaton is also disclosed in US5, and 981,505; US6,217,900; US6,383,512; US5,783,565; US7,202,227; US6,379,965; US6,127,170; US5,837,533; US6,747,014; And WO03/093449, by addressing complete income herein.

Generally can wish to adopt suitable salt and buffer agent to be absorbed to make delivery vehicle stable and to allow by target cell.When being imported in experimenter by reconstitution cell, also buffer can be adopted.Waterborne compositions of the present invention includes the delivery vehicle of effective amount, and it comprises and is dissolved or dispersed in inhibitor polynucleotide in pharmaceutical acceptable carrier or aqueous medium or miRNA polynucleotide sequence (such as liposome or other complex or expression vector) or cell.Phrase " pharmacy is acceptable " or " pharmacology is acceptable " refer to not produce when using animals or humans molecular entity and the compositions of disadvantageous, allergic or other undesired reaction.As used herein, " pharmaceutical acceptable carrier " comprises solvent, buffer agent, solution, disperse medium, coating, antibacterial agent and antifungal, isotonic agent and absorption delay agent etc. can accept for compounding pharmaceutical (be such as applicable to use people medicine).The use that this type of medium and reagent are used for pharmaceutically active substances is well known in the art.Unless any conventional media or reagent incompatible with active component of the present invention, otherwise just contain its use in therapeutic composition.Complementarity active component can also be mixed in compositions, as long as the carrier of compositions described in their not deactivations or cell.

Active compound of the present invention can comprise classical pharmaceutical preparation.Can via any general routes according to using of these compositionss of the present invention, if target tissue via this path can and.This comprises oral, nose or buccal.Or, use and can be through Intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by being injected directly into heart tissue.The pharmaceutical composition comprising miRNA antagonist or the expression construct comprising miRNA sequence also can be used by conduit system or for system therapeutic agent delivery being separated coronary circulation to heart.This area know for by therapeutic agent delivery to the multiple conduit system of heart and coronary vasculature.U.S. Patent No. 6,416,510; U.S. Patent No. 6,716,196; U.S. Patent No. 6,953,466; WO2005/082440; WO2006/089340; U.S. Patent Publication text No.2007/0203445; U.S. Patent Publication text No.2006/0148742; Some non-limitative examples being applicable to the delivering method based on conduit of the present invention or coronary artery separation method are disclosed with in U.S. Patent Publication text No.2007/0060907 (by addressing complete income herein).Such composition can accept compositions to use as pharmacy as above usually.

Reactive compound also can parenteral or intraperitoneal be used.For example, the solution of the reactive compound of free alkali or pharmacology's pharmaceutically acceptable salt can be prepared in the water suitably mixed with surfactant (such as hydroxypropyl cellulose).Also can glycerol, liquid macrogol, and composition thereof in and in oil, prepare dispersion.Under normal storage and service condition, these prepared products generally contain antiseptic to prevent growth of microorganism.

Such as aseptic aqueous solution or dispersion and the sterile powder for preparing aseptic parenteral solution or dispersion are when participating in the cintest comprised for the medicament forms that injection uses or catheter delivery is suitable.Generally speaking, these prepared products are aseptic, and there is the degree flowing being easy to injectivity.Prepared product should be stable under manufacture and storage requirement, and should carry out anticorrosion for the contamination of microorganism (such as antibacterial and fungus).Suitable solvent or disperse medium can containing such as water, ethanol, polyhydric alcohol (such as glycerol, propylene glycol and liquid macrogol, etc.), their suitable mixture and vegetable oil.Can by such as using coating (such as lecithin), by maintaining desired particle size (when dispersion) and maintaining suitable mobility by use surfactant.The prevention that can realize microbial action by various antibacterial agent and antifungal, such as paraben, methaform, phenol, sorbic acid, thimerosal, etc.In many cases, isotonic agent can be preferably included, such as sugar or sodium chloride.Can by the prolongation using the medicament postponing to absorb to realize the absorption of Injectable composition in the composition, such as aluminum monostearate and gelatin.

Aseptic parenteral solution can be prepared as follows, namely reactive compound be mixed in the solvent as required containing other composition any (such as listed) above with suitable amount, then filtration sterilization.Generally speaking, prepare dispersion as follows, mix containing basic disperse medium with in the sterile carrier of other composition wanted (such as listed above) by the various active component through sterilizing.When the sterile powder for the preparation of aseptic parenteral solution, preferred preparation method comprises vacuum drying and Freeze Drying Technique, and they produce from the solution of previous aseptic filtration the powder that its active component adds any composition that other is wanted.

Compositions of the present invention generally can be mixed with neutrality or salt form.Pharmaceutically acceptable salt comprise such as from mineral acid (such as hydrochloric acid or phosphoric acid) or from organic acid (such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.) derivative acid-addition salts (being formed with the free amine group of protein).The salt that also can be formed from inorganic base (such as sodium hydroxide, potassium, ammonium, calcium or ferrum) or free carboxy that is derivative from organic base (such as 2-aminopropane., trimethylamine, histidine, procaine etc.) and protein.

After preparation, preferably use solution in the mode compatible with dosage form with to treat upper effective amount.Described preparaton can easily be used with multiple dosage form, such as injection, drug release capsules etc.Such as, in order to parenteral is used as an aqueous solution, generally solution is suitably cushioned, and first such as make liquid diluent isotonic with enough salt or glucose.This type of aqueous solution can be used for such as intravenous, intramuscular, subcutaneous and intraperitoneal and uses.Preferably, aseptic aqueous medium is adopted, as will be known to persons skilled in the art, particularly according to present disclosure.For example, single dosage can be dissolved in the isotonic NaCl solution of 1ml, and or be added into 1000ml hypodermoclysis or the infusion site injection (participating in such as " Remington'sPharmaceuticalSciences " the 15th edition, 1035-1038 page and 1570-1580 page) in suggestion.Depending on the situation of treated experimenter, will inevitably there are some changes in dosage.In any situation, the people being responsible for using can be the dosage that each experimenter determines to be suitable for.In addition, for human administration, prepared product should reach sterility, pyrogen degree, Generally Recognized as safe and the purity rubric that FDA biological preparation standard chamber requires.

Cosmetic formulations for improving the collagen deposition in tissue can comprise at least one miR-29a-c antagonist.Described antagonist can be the antagonist of miR-29a, miR-29b, miR-29c or its combination.In some embodiments, described miR-29a-c antagonist is tiny RNA antagonist.Described antagonist can connect or coupling has the described antagonist of promotion to enter the medicament of cell or tissue.This type of medicament can comprise cell internalizing transhipment thing, such as wears film peptide (antennapedia), TAT, BuforinII, Transportan, model peptide amphiphile, K-FGF, Ku70, Prion, pVEC, Pep-1, SynB1, SynB3, SynB5, Pep-7, HN-I, two-guanidinesalt-SPDC, two-guanidinesalt-Tren-cholesterol and poly arginine.Described medicament can be connected to amino or the c-terminus of miR-29a-c antagonist.In one embodiment, described medicament is connected to antagonist by the sequence of being cut after entering cell.This type of sequence comprises the consensus sequence of protease known in the art usually.

Cosmetic composition can be formulated in all types of vehicle.Suitable vectorial non-limitative example comprises emulsion (such as Water-In-Oil, W/O/W, oil-in-water, Water-In-Oil bag oil, silicone bag O/w emulsion), emulsifiable paste, lotion, solution (water with aqueous alcoholic the two), anhydrous substrate (such as lip pomade (lipstick) and powder), gel and ointment or other method can known by those of ordinary skill in the art or above-mentioned any combination (Remington's, 1990).Various and other suitable vehicle can be apparent to those of skill in the art, and is suitable for using in the present invention.In certain embodiments, the concentration of each component and combination are compatible and do not formed and select from the mode of complex of finished product precipitation with described combinatorial chemistry.

Also contain and can encapsulate fragrant skin activity component and run through other component of this description qualification to be delivered to target region, such as skin.The non-limitative example of encapsulation technology comprises can as delivery vehicle for being delivered to the liposome of skin, vehicle and/or the nano-particle (colloidal particle of such as biodegradable and nonbiodegradable by this type of component, it comprises the polymeric material wherein wrapping up, encapsulate and/or be absorbed with described component, example comprises nanosphere body and Nano capsule) use (participate in such as United States Patent (USP) 6,387,398; United States Patent (USP) 6,203,802; United States Patent (USP) 5,411,744; And Kreuter1998, by addressing complete income herein).

Also contain the acceptable or acceptable compositions of pharmacology of pharmacy.Phrase " pharmacy is acceptable " or " pharmacology is acceptable " are included in the compositions to not producing allergic or similar adverse effect during human administration.Usually, such composition is prepared into topical composition, liquid solution or suspension, also can prepare the solid form being applicable to dissolving in a liquid before use or suspending.Administration route can change with the position of the illness that will treat and character, and comprise in such as local, suction, Intradermal, percutaneous (transdermal), parenteral, intravenous, intramuscular, intranasal, subcutaneous, percutaneous (percutaneous), tracheal strips, intraperitoneal, tumor, perfusion, lavation, direct injection and Orally administered and prepare.

Compositions of the present invention can be mixed in product.The non-limitative example of product comprises cosmetic product, product, drug products etc. based on food.Only for example, nonrestrictive cosmetic product comprises opacifier product (sunscreenproducts), skin tanning product without sunshine (sunlessskintanningproducts), Hair Stying Products (hairproducts), nail-care products (fingernailproducts), moisturizing cream (moisturizingcreams), skin nursing frost and skin care solution (skinbenefitcreamsandlotions), softening agent (softeners), day cream (daylotions), gel, ointment, foundation cream (foundations), late frost (nightcreams), lip pomade (lipsticks), mascara (mascaras), eye shadow (eyeshadows), informer (eyeliners), cheek coloured silk (cheekcolors), cleaning agent (cleansers), toner (toners), facial film (masks), or other known cosmetic product or application.In addition, cosmetic product can be mixed with the product of (leave-on) that maintain or (rinse-off) rinsed out.

Compositions of the present invention can comprise other component.The non-limitative example of other component comprises components of cosmetics (have active and non-activity the two) and drug component (activated with both non-activities).CTFA international cosmetic component dictionary and handbook (2004) describe the extremely multiple nonlimiting cosmetic component that can use in the background of the invention.The example of these component classifications comprises: spice (artificial with natural), dyestuff and color component (such as blue 1, acid blue 1, red 40, titanium dioxide, D & C4 indigo plant, No. C5, D & is green, D & C4 orange, No. C17, D & is red, No. C33, D & is red, D & C2 violet, D & C10 Huang, with D & C11 Huang), adsorbent, emulsifying agent, stabilizing agent, lubricant, solvent, humidizer (comprises such as emollient, wetting agent, film former, occludent, with the medicament affecting skin natural moisturization mechanism), waterproofing agent, UV absorbent (physics with the absorbent of chemistry, such as para-amino benzoic acid (PABA) and corresponding PABA derivant, titanium dioxide, zinc oxide, Deng), quintessence oil (essentialoil), vitamin (such as A, B, C, D, E, and K), trace metal (such as zinc, calcium and selenium), counter-stimulus (such as steroid and nonsteroid anti-inflammatory drugs), plant extract (such as aloe vera, Flos Chrysanthemi, Fructus Cucumidis sativi extract, Semen Ginkgo, Radix Ginseng, and Herba Rosmarini Officinalis), antimicrobial, antioxidant (such as BHT and tocopherol), chelating agen (such as EDETATE SODIUM and EDTA tetra-sodium), antiseptic (such as methyl parahydroxybenzoate and propyl p-hydroxybenzoate), pH adjusting agent (such as sodium hydroxide and citric acid), absorbent (such as aluminum Starch octenyl succinate, Kaolin, corn starch, oat starch, cyclodextrin, Talcum, and zeolite), skin bleaching and highlight agent (lighteningagent) (such as hydroquinone and nicotiamide lactate), wetting agent (such as glycerol, propylene glycol, butanediol, pentanediol, sorbitol, carbamide, and mannitol), exfoliator (exfoliant) (such as 'alpha '-hydroxy acids and beta-hydroxy acid such as lactic acid, glycolic, and salicylic acid, and salt) waterproofing agent (such as magnesium hydroxide/aluminum stearate), skin conditioning agent (such as Aloe extract, allantoin, bisabolol, ceramide, dimethicone, hyaluronic acid and glycyrrhizic acid dipotassium), thickening agent (such as can improve the material of the viscosity of compositions, such as carboxylic acid polyalcohol, cross-linked polyacrylate polymer, polyacrylamide polymers, polysaccharide and colloid) and the compound (such as silicone oil and polysiloxane) containing silicone.

Also contain the pharmaceutical composition useful to emulsion composition of the present invention.The non-limitative example of pharmaceutical composition comprises anti-acne drug, be used for the treatment of the medicament of acne rosacea, analgesic, anesthetics, anal orifice and rectal intestine medicine, antihistaminic, anti-inflammatory agent (comprising nonsteroid anti-inflammatory drugs), antibiotic, antifungal agent, antiviral agents, antimicrobial drug, antitumor activity agent, Scabicide, pediculicide, antineoplastic agent, Antiperspirant, antipruritic, antipsoriatic, antiseborrhoic, biologically active proteins matter and peptide, burn process medicine, cauterant, depigmenting agent, depilatory, diaper rash process medicine, enzyme, hair growth stimulant, hair growth delayer (comprising DFMO and salt thereof and analog), hemorrhage, keratolytic agent (kerotolytics), aphtha process medicine, cold sore process medicine, tooth and periodontal process medicine, photosensitizing activity agent, protective agent/barrier agent, steroid (comprising hormone and corticosteroid), sunburn process medicine, opacifier, transdermal agent, nose activating agent, vagina activating agent, wart process medicine, treatment of wounds medicine, wound healing medicine etc.

Any composition described herein can be included in test kit.In a nonrestrictive example, each miRNA is included in test kit.Described test kit can comprise water and hybridization buffer further so that the hybridization of two chains of described miRNA.In some embodiments, described test kit can comprise one or more for suppressing the oligonucleotide of target miRNA function.Described test kit also can comprise one or more transfection reagents so that miRNA or miRNA antagonist is delivered to cell.

The composition of test kit can be packed in aqueous medium or with lyophilized form.The container means of test kit generally comprise at least one phial, test tube, flask, bottle, syringe or other container means, and (preferably distributing suitably) composition is wherein housed.Have in test kit (labelling reagent and label can be packaging together) in the situation exceeding a kind of composition, test kit generally also can comprise second, third or other other container, wherein can separately accommodate other composition.But, the combination of various composition can be accommodated in phial.Test kit of the present invention generally also can comprise settles nucleic acid securely in order to sell, and the means of other reagent container any.This type of container can comprise the plastic containers for the injection or blow molding of laying required phial.

When the composition of described test kit provides in one and/or plurality of liquid solution, described liquid solution is aqueous solution, particularly preferably aseptic aqueous solution.

But the composition of test kit can provide in dry powder form.When reagent and/or composition provide in dry powder form, by adding suitable solvent, described powder can be rebuild.Described solvent also can provide in another container means.

Container means generally can comprise at least one phial, test tube, flask, bottle, syringe and/or other container means, and (preferably distributing suitably) nucleic acid formulation is wherein housed.Described test kit also can comprise second container means, can accept buffer agent and/or other diluent for accommodating aseptic pharmacy.

Test kit of the present invention also can comprise the means of settling phial in order to sell securely usually, such as such as the plastic containers of the injection and/or blow molding of laying required phial.

This type of test kit also can comprise to be preserved or maintains miRNA or miRNA inhibition oligonucleotide or protect them to avoid the composition of degrading.Specific examples of such components containing RNA enzyme or can not provide protection for RNA enzyme.This type of test kit can be generally that often kind of reagent or solution comprise unique container with suitable means.

Test kit also can comprise about adopting Kit components and using the description of other reagent any do not comprised in test kit.Description can comprise the version that can perform.Test kit also can comprise utensil or the device of being used miRNA agonist or antagonist by various administration route (such as parenteral or conduit are used).

This type of reagent is the embodiment of test kit of the present invention.But this type of test kit is not limited to the concrete item identified above, and any reagent operating for miRNA or characterize can be comprised.

For the identification of the method for modulator

The present invention comprises the method for the agonist for the identification of miR-29a-c further, the agonist of miR-29a-c cardiac fibrosis, cardiac hypertrophy or heart failure prevention or treatment or be useful in reversing.These algoscopys can comprise the large-scale library of random screening candidate compound; Or described algoscopy can be used for the compound focusing on particular category, they are to make compound more likely promote the visual angle selection of the structure attribute of miR-29a-c expression and/or function for thinking.

In order to identify the modulator of miR-29a-c, the function of miR-29a-c generally can be measured when existing and there is not candidate compound.Such as, described method generally comprises:

A () provides candidate compound;

B described candidate compound mixes with miR-29 by ();

C () measures miR-29a-c active; And

D the activity in () comparison step (c) is active with miR-29a-c when there is not described candidate compound, the difference wherein measured between the miR-29a-c activity that obtains indicates described candidate compound to be the modulator of miR-29a-c really.

Also algoscopy can be carried out in the cell be separated, organ or the organism of living.

Certainly be appreciated that all screening techniques self of the present invention are exactly useful, although in fact may not find effective material standed for.The invention provides the method for screening this type of material standed for, is not only the method finding them.

As used herein, " candidate compound " refer to any can the potential regulation and control fibrosis of miR-29a-c or the molecule of collagen adjustment aspect.Usual meeting obtains the molecular library thought and reach useful medicament base this standard from various commercial source, thus attempts the qualification of " promotion " useful compound.Such as, be to the one of a large amount of relevant (with irrelevant) screening compound activity fast and effective mode to the screening in this type of library (comprising the library produced by combination, tiny RNA antagonist library).By having activity but the prototype of the inappropriate compound of other side creating the second filial generation, the third generation and forth generation compound, they also self are being used for the tachytelic evolution of potential drug by combined method.

Vitro assay be a kind of fast, cheap and be easy to algoscopy.This type of algoscopy generally uses the molecule of separation, fast and run in a large number, can improve obtainable quantity of information in a bit of time thus.Multiple container can be used to run this type of algoscopy, comprise test tube, plate, dish and other surface, such as gauge rod (dipstick) or pearl.

A kind of technology for high flux screening compound is described in WO84/03564 (by addressing complete income herein).Can at solid substrate (such as plastics pin or some other surfaces) tiny RNA antagonist (antogomir) compound that above synthesis is little in a large number.They the ability of miR-29a-c can be suppressed to this quasi-molecule rapid screening.

The present invention is also contained, the active ability with expressing to miR-29a-c in their regulating cells of screening compound.The various cell line of this type of Screening test Guttae Phacosylini, comprises from derivative those of Skeletal Muscle Cell, comprises the special cell of transformation for this purpose.Also primary cardiac cell can be used, as H9C2 cell line.

In vivoassay method relates to the use of the various animal models of heart disease or musculoskeletal disease, fibrosis or collagen loss, comprise transgenic animal, they have carried out the mark transforming to have specified defect or carry the ability that can be used for the arrival of measurement candidate substances and affect different cell in organism.Due to they build, be easy to operate and about the information of their physiologys and Gene effect, mice is a kind of preferred embodiment, especially for genetically modified.But other animal is also suitable, comprise rat, rabbit, hamster, Cavia porcellus, gerbil jird, marmot, cat, dog, sheep, goat, pig, cattle, horse and monkey (comprising chimpanzee, Gibbon and baboon).The algoscopy that the animal model derived from these species any carries out inhibitor can be used.

Compound animal being used to suitable form can be related to test compounds treatment animal.Using can be any path that can be used for clinical object.The effectiveness measuring compound in vivo can relate to multiple various criterion, includes but not limited to the change of loose signal transduction path and loose physical symptom.And, can to implement the measurement to toxicity and dose response in animal than the more significant mode of algoscopy in body or in cell.

Transgenic animal

A specific embodiments of the present invention provides one or two the transgenic animal lacked in two functional miR-29a, miR-29b and/or miR-29c allele.And, induction type, tissue selectivity or the promoter of composing type control under express the transgenic animal of miR-29a-c, from the recombinant cell lines of this type of animal derived, and transgenic embryo determine to play in the generation of miR-29a-c in Fibrotic control with at pathological heart hypertrophy and heart failure definite may be useful on.In addition, these transgenic animal can see clearly heart development.The use of derivable or restrainable miR-29a-c code nucleic acid be excessively regulate or not modulated expression provide model.And, to contain in two allele " having knocked out " miR-29a-c one or two transgenic animal.And, contain the transgenic animal of the miR-29a-c " knocked out " in one or two allele of one or two bunch.

In a general embodiment, by allow that the mode of transgene expression makes given integrated transgene enter in genome to generate transgenic animal.Method generality for generating transgenic animal is recorded in Wagner and Hoppe (United States Patent (USP) 4,873,191; By addressing income herein); And Brinster etc. (1985; By addressing income herein).

Typically, the gene transfer being genome sequence by flank by microinjection enters germ cell.By the implantation of ovum host jenny after microinjection, and offspring's screening transgenic is expressed.Transgenic animal can be generated from the beginning from the germ cell of many animals (including but not limited to reptiles, amphibian, birds, mammals and Fish).

Can by the next DNA clone for the preparation of microinjection of any means known in the art.Such as, the DNA clone for microinjection can be cut with the enzyme action being suitable for bacteria removal plasmid sequence, and use standard technique in tbe buffer liquid on 1% agarose gel to DNA fragmentation electrophoresis.Manifest DNA band by ethidium bromide staining, and cut out the band containing expressed sequence.Then the band cut out is placed in and 0.3M sodium acetate is housed, in the bag filter of pH7.0.DNA electroelution is entered in bag filter, uses 1:1 phenol: chloroformic solution extracting, and with the alcohol settling of two volumes.DNA is again dissolved in 1ml low salt buffer (0.2MNaCl, 20mMTris, pH7.4, and 1mMEDTA), and at Elutip-D ^tMpurification on post.First 3ml high-salt buffer (1MNaCl, 20mMTris, pH7.4, and 1mMEDTA) is used to prepare post in advance, then with the cleaning of 5ml low salt buffer.Make DNA solution pass post and be bonded to base for post matter to make DNA three times.After the cleaning once of 3ml low salt buffer, with 0.4ml high-salt buffer eluted dna, and with the alcohol settling of two volumes.Absorbed by 260nm in UV spectrophotometer and measure DNA concentration.In order to microinjection, DNA concentration is adjusted in 5mMTris, pH7.4 and 0.1mMEDTA 3 μ g/ml.Other method being used for the DNA of microinjection for purification is recorded in (1982) such as Palmiter; And Sambrook etc. (2001).

In a kind of exemplary microinjection code, inject (0.1cc, ip) pregnant mare serum promoting sexual gland hormone (PMSG by 5IU; Sigma), then after 48 hours, 5IU injects (0.1cc, ip) human chorionic gonadotropin (hCG; Sigma), the super ovulation of female mice in six week age is induced.Immediately by female and malely to put together after hCG injection.Latter 21 hours of hCG injection, passes through CO ₂to suffocate or cervical dislocation puts to death post-coitum female, and take out embryo from the fallopian tube cut, be placed on containing 0.5% bovine serum albumin (BSA; Sigma) in DulbeccoShi phosphate buffered saline (PBS).Mound cell is around removed with hyaluronidase (1mg/ml).Then clean pronucleus embryo and be placed in the EarleShi balanced salt solution (EBSS) containing 0.5%BSA and there is 5%CO ₂, 95% air humidification air 37.5 DEG C of incubators in, until inject time.The implantation of embryo can be carried out at two cell stages.

By the adult female mice of random rotation with excised deferential male pairing.C57BL/6 or Swiss mice or other suitable strain can be used for this purpose.Make recipient female in the time copulation identical with Donor females.When shifting embryo, carry out anesthetized recipients by peritoneal injection 0.015ml2.5% avertin every gram of body weight female.Fallopian tube is exposed by a center line midline incision.Then an otch is done through the body wall just above fallopian tube.Then ovarian bursa is torn with tabulation tweezer.The embryo that will shift to be placed in DPBS (DulbeccoShi phosphate buffered saline (PBS)) and in the tip of transfer pipette (an about 10-12 embryo).Pipette tip to be inserted in funnel and to shift embryo.After transfer, close otch by delayed suture.

Definition

As used herein, term " heart failure " is widely used in any illness representing and reduce cardiac pumping ability.As a result, there is congested and edema in the tissue.Modal, heart failure is reduced by the myocardial contractility being derived from coronary flow reduction to cause; But many other factorses can cause heart failure, comprise valvular infringement, vitamin deficiency and primary cardiac muscle disease.Although understand the precise physiological mechanism of heart failure not yet completely, it is generally acknowledged that heart failure relates to the disease in several heart autonomous nature (comprising orthosympathetic, parasympathetic and pressure receptor response).Phrase " performance of heart failure " is widely used in contains all sequela relevant with heart failure, such as short of breath, pitting edema, hepatomegaly and touch a tender spot, Jugular vessel is congested, pulmonary rale etc., comprise the laboratory relevant with heart failure and find.

Term " treatment " or " process " or grammer equivalents contain improvement and/or the reverse (i.e. the ability of cardiac pumping) of heart failure symptoms.Any tolerance described herein (such as measuring ejection fraction, Fractional shortening, left ventricular internal diameter, heart rate etc.) can be used and evaluate cardiac " improvement of physiological function " is come to any effect of animals survived.When using animal model, the response (in addition, can comprise through connecing subject and not connecing subject non-transgenic animal in contrast) using any algoscopy described herein to compare to connect subject transgenic animal and do not connect subject transgenic animal.Compound that use in screening technique of the present invention, that cause any parameter relevant with heart failure to improve can be accredited as therapeutic compound thus.

The symmetry expansion left ventricle that term " DCM (dilated cardiomyopathy) " refers to exist systole contractile function difference is for feature and usually relate to a kind of heart failure type of right ventricle in addition.

Term " compound " refers to any chemical entities, medicament, medicine etc. of disease (disease), disease (illness), discomfort (sickness) or the disease (disorder) that can be used for treating or prevent body function.Compound comprises known to potential therapeutic compound.Can the screening carried out of the screening technique of the application of the invention to carry out deterministic compound be curative." known therapeutic compound " refers to demonstrate (such as via animal experiment or to human administration in first experience) effective therapeutic compound in this type for the treatment of.In other words, known therapeutic compound is not limited to compounds effective in the treatment of heart failure.

As used herein, term " cardiac hypertrophy " refers to that wherein Adult cardiac myocyte carrys out the process of response pressure via hypertrophic growth.The feature of this type of growth is that cell size increases cell and do not having cell division, assembles other muscle segment and maximize to make strength generate in cell, and the activation of fetal rhythm gene program.Cardiac hypertrophy is usually relevant with mortality risk with the morbidity raised, and the research association being therefore devoted to the molecular mechanism understanding cardiac hypertrophy has significant impact to human health.

As used herein, term " regulation and control " refers to change or the change of biological activity.Regulation and control can be the rising of protein active or reduction, the change of kinase activity, change in conjunction with any other of the change of feature or the biology relevant with the activity of protein or other structures of interest, function or immunological characteristic.Term " modulator " refers to any molecule or the compound that can change or change biologic activity as mentioned above.

Term " B-adrenergic receptor antagonist " refers to chemical compound or the entity that can block (partially or even wholly) beta (β) type adrenoceptor (namely responding the adrenergic system receptor of catecholamine (especially norepinephrine)).Some B-adrenergic receptor antagonist show to a certain degree (be generally β to a kind of receptor subtype ₁) specificity; This type of antagonist is called " β ₁specific adrenergic energy receptor antagonist " and " β ₂specific adrenergic energy receptor antagonist ".Term " B-adrenergic receptor antagonist " refers to as the chemical compound into selectivity and Nonselective antagonists.The example of B-adrenergic receptor antagonist includes but not limited to acebutolol (acebutolol), atenolol (atenolol), butaxamine (butoxamine), carteolol (carteolol), esmolol (esmolol), labetalol (labetolol), metoprolol (metoprolol), nadolol (nadolol), penbutolol (penbutolol), Propranolol (propanolol), with timolol (timolol).Method of the present invention contains the use of the derivant of known B-adrenergic receptor antagonist.In fact, method of the present invention is encompassed in any compound functionally showed as B-adrenergic receptor antagonist.

Term " angiotensin-convertion enzyme inhibitor " or " ACE inhibitor " refer to chemical compound or the entity of the enzyme involved by the activated Angiotensin II of angiotensin I converting one-tenth that can suppress relative inactive in (partially or even wholly) renin-angiotensin system.In addition, ACE inhibitor suppresses the degraded of Kallidin I concomitantly, and this likely significantly strengthens the resisting hypertension effect of ACE inhibitor.The example of ACE inhibitor includes but not limited to benazepril (benazepril), captopril (captopril), enalapril (enalopril), fosinopril (fosinopril), lisinopril (lisinopril), quinapril (quiapril) and ramipril (ramipril).Method of the present invention contains the use of the derivant of known ACE inhibitor.In fact, method of the present invention is encompassed in any compound functionally showed as ACE inhibitor.

As used herein, term " genotype " refers to the actual genetic constitution of organism, and " phenotype " refers to individual health character of showing.In addition, " phenotype " is the result (namely it is the expression of cell history and the response to extracellular environment thereof) of genome selective expression.In fact, human genome contains estimation 30,000-35,000 gene.In often kind of cell type, these genes only have sub-fraction (i.e. 10-15%) to express.

When " comprising " conbined usage with term in claims and/or description, the use of word "/kind " can represent " one/kind ", but also consistent with the implication of "/kind or multiple/kind ", " at least one/kind " and "/kind or more than/kind ".

Any embodiment discussed herein can perform by any method of the present invention or compositions, and vice versa.In addition, the method that can be used in the present invention of compositions of the present invention and test kit.

Run through the application, term " about " is for representing that certain numerical value comprises the standard deviation of the error for the device or method measuring this numerical value.

In claims, the use of term "or" is for representing "and/or", and refer to only to select one or each alternate item mutually to repel unless expressly stated, definition and the "and/or" of one are only selected in the text support that namely exposes.

As used in the specification and claims, word " comprises " (and any distortion), " having " (and any distortion), " comprising " (and any distortion) or " containing " (and any distortion) are inclusive/comprising property or open, does not get rid of other composition do not addressed or method step.

Although inserted chapter title in this application so that read, this type of title should not be construed as the segmentation to embodiment.

Comprise the following example and illustrate various aspects of the present invention further.Those skilled in the art can understand, and technology disclosed in Examples below represents inventor and finds to run well when implementing of the present invention and technology and/or the compositions that therefore can be considered as forming enforcement preference pattern of the present invention.But according to present disclosure, those skilled in the art should understand and can carry out many changes and still obtain similar or similar result and do not deviate from the spirit and scope of the present invention in disclosed specific embodiments.

Embodiment

MiR-208 encodes (Figure 1A) in the intron of α-mhc gene.As α-MHC, miR-208 is specific expressed in heart, has trace to express (Figure 1B) in lung.MiR-208 processes from α-MHCpre-mRNA, instead of transcribes as the transcript that separates and obtain.But, what is interesting is, miR-208 shows and looks noticeable, half-life of at least 14 days, and even can express at α-MHCmRNA thus and descend timing performance function.Although the miR-208 genetic defect in mice fails to bring out obvious phenotype, to from 2 monthly age wild type and miR-208 ^-/-the elimination that the microarray analysis that the heart of animal carries out discloses miR-208 causes the remarkable expression of numerous quick skeletal muscle contractile protein plasmagene, and they do not express in normal condition in heart.So, under normal operation, miR-208 and unique heartspecific mhc gene coexpression, maintain myocardial cell identity by the expression of containment Skeletal Muscle Gene in heart to the prompting of these results.

The exception response of miR-208 invalid (null) mice to cardiac pressure discloses the most remarkable function (vanRooij etc., 2007) of miR-208.To in the pressure shrinking overload by thoracic aorta or response to the intracellular signaling of calcinerin (a kind of calcium/calmodulin-dependent phosphatase driving heart disease rationality to reinvent), in fact miR-208 null mice does not show cardiac myocyte hypertrophy or fibrosis, and does not have ability to raise β-MHC expression (Fig. 6-8).On the contrary, other pressure-responsive gene (such as those coding ANF and BNP) in miR-208 mutant animals by induced strong, demonstrate miR-208 and specialize in the control expressed β-MHC, the other side that it can be replied with cardiac pressure breaks off relations.

β-MHC expresses and contains by thyroxin intracellular signaling, and raises (Leung etc., 2006) in hypothyroidism state.MiR-208 ^-/-animal also has resistance to the β-MHC up-regulated after T3 inhibitor propylthiouracil (PTU) (it brings out hypothyroidism) process.But, what is interesting is, in miR-208 mutant mice, antenatal β-MHC expresses is normal, and instruction miR-208 specializes in and regulates after the birth of β-MHC expression, this consistent with the acquisition of the thyroxin response of β-mhc gene (Fig. 5).

A clue of miR-208 mechanism of action is from miR-208 ^-/-heart and hyperthyroidism heart similar, the two all show β-MHC is expressed blocking-up, pressure-responsive gene upper mediation for pathologic hypertrophy and Fibrotic protection (Fig. 6-10).MiR-208 ^-/-in heart, the induction (Wei etc., 2005) of fast skeletal muscle fiber in hyperthyroidism state is also imitated in the rise of quick skeletal muscle gene.

These find that prompting miR-208 (at least partly) is worked with the expression of a common component of thyroxin signal transduction path by pressure response in containment heart.The strongest prediction target thing of miR-208 is the auxiliary instrumentality THRAP1 of Thyroid Hormone Receptors (TR), and it can play actively and negative effect (Pantos etc., 2006 transcribing; Yao and Eghbali, 1992; Figure 12).TR works through passive thyroxin response element (TRE) and contains that β-MHC in Adult cardiac expresses (Zhao etc., 2005).So, the rising prediction that THRAP1 expresses when miR-208 lacks can strengthen the containment activity that TR expresses β-MHC, with miR-208 ^-/-consistent to the blocking-up of β-MHC expression in heart.But although THRAP1 shows as true (bonefide) target thing of miR-208, these data do not get rid of the adjustment that other target thing may participate in expressing β-MHC.

Owing to reducing mechanical performance and effect of Adult cardiac to the even slight change of β-MHC, therefore explore miR-208 and regulate for stoping β-MHC expression rising to have therapeutic value during heart disease.MiR-208 is to the heartspecific of cardiac pressure response (and abnormal cardiac growth) and the tempting therapeutic target (Figure 13) making miR-208 (and downstream effect thing (effector)) become operation β-MHC level that focuses on task at hand.

materials and methods

Northern engram analysis.The heart tissue sample being diagnosed as the left ventricle of the anonymous personage with non-exhaustion or failure heart is obtained from GileadColorado (Westminster, CO).Obtain the heart tissue sample being diagnosed as the marginal zone region of the anonymous personage suffering from myocardial infarction.Use Trizol reagent (Gibco/BRL), be separated total serum IgE from cell, mice, rat and human heart tissue sample or the myocyte that is separated.By confirming equal loading with Ethidum Eremide dyeing Northern gel.(vanrooij etc., 2006) as discussed previously are implemented Northern trace and are detected Microrna.U6 probe serves as loading contrast.Expressing to detect α-MHC, detecting containing the Northern trace of 10 μ g from the RNA of both adult wild-type and miR-208 mutant animals heart tissue by the α-MHCcDNA fragment covering First Exon and a 5'UTR district part.

PTU process.By be supplemented with 0.15%PTU (purchased from HarlanTekladCo., TD97061, Madison, WI) without iodine diet animal specify the persistent period bring out athyroxinosis.

Microarray and real-time PCR analysis.Trizol (Invitrogen) is used to be separated total serum IgE from heart tissue.Mouse genome 4302.0 array (Affymetrix) is used to implement microarray analysis.In order to detect miRNA level, Taqman Microrna Reverse Transcriptase kit (AppliedBiosystems, ABI) is used to implement RT-PCR according to the recommendation of manufacturer.Use 5ngRNA to generate cDNA with miRNA Auele Specific Primer, detect the expression of miRNA interested afterwards with miRNA specificity T aqman probe.After carrying out RT-PCR with random hexamer primer (Invitrogen) to RNA sample, use Taqman probe purchased from ABI by the expression of PCR or a quantitative real-time PCR analysis gene subset.

The generation of miR-208 mutant mice.In order to generate miR-208 targeting vector, the 0.4kb fragment extended to miR-208 upstream of coding region (5' arm) being digested with SacII and NotI and connect into pGKneoF2L2dta targeting plasmid, is the upstream of the neomycin box of Frt in loxP site and flank.3.3kb fragment (3' arm) is digested with SalI and HindIII and connects into carrier, at neomycin resistance and and Dta is negative selects between box.Identify that carrying destroyed allelic target determines ES cell with 5' and 3' probe by Southern engram analysis.Identify three miR-208 targets determine ES clone and for Blastocyst injection.By gained gomphosis mouse and C57BL/6 copulation to obtain the germline transmission of mutation allele.

The generation of transgenic mice.The mouse genome fragment sub-clone of miRNA flank interested is entered the heartspecific expression plasmid (Kiriazis and Kranias, 2000) containing α-MHC and people GHpoly (A)+signal.From mice tail biopsies isolation of genomic DNA, and use is analyzed by PCR the primer of people GHpoly (A)+signal specificity.

Western blot.As described in document, (Morkin, 2000) extract myosin from heart tissue.By SDSPAGE by MHC isoform separately, and with mouse monoclonal α-MHC (BA-G5) (ATCC, Rockville, MD) and mouse monoclonal anti-myosin (at a slow speed, skeleton M8421) (Sigma, MO) (it is to β-MHC high degree of specificity) enforcement western blot.In order to detect the myosin of all one-tenth stricture of vaginas, use general specific antibody (panspecificantibody) (mouse monoclonal 3-48; AccurateChemical & ScientificCorporation, NY).By detecting THRAP1 from the immunoprecipitation of the molten born of the same parents' thing of 400 μ g cardiac protein.By sample in 4 DEG C of presettlings after 1 hour, supernatant and the anti-THRAP1 of 1 μ l Rabbit polyclonal (being presented by the R.Roeder of RockefellerUniversity) and 15 μ l a-protein pearls one are arised from 4 DEG C and is incubated overnight.Pearl is cleaned three times with lysis buffer and boils in SDS sample buffer.The THRAP1 protein of immunoprecipitation is resolved by SDS-PAGE, and the coupling that anti-THRAP1 and 1:5000 of the Rabbit polyclonal using 1:3000 to dilute dilutes has anti-rabbit igg analysis of horseradish peroxidase, wherein detected by luminol reagent (SantaCruz).

Histologic analysis and RNA in situ hybridization.To be used for histologically being organized in incubation in Krebs-Henselheit solution, fixing in 4% paraformaldehyde, section, and be hematoxylin and eosin (H & E) processing, and MassonShi trichrome stain or the in situ hybridization (Krenz and Robbins, 2004) that undertaken by standard technique.Maxiscript test kit (Amersham) is used to generate ³⁵the rna probe of S labelling.Use AdobePhotoshop that signal vacation is coloured to redness.

Transthoracic echocardiography developing.Use VingmedSystem (GEVingmedUltrasound, Horten, Norway) and 11.5MHz linear array transducer, come evaluate cardiac function and heart yardstick by the two-dimensional echocardiography in conscious mice.The front and back wall thickness using M-mode to trace to measure the heart to relax latter stage and heart contracting latter stage.As the maximum anteroposterior diameter of diastole (LVIDd) or systole (LVIDs), measure left ventricle (LV) internal diameter (LVID).By one, data are analyzed to the unwitting observer of murine genes type.LV Fractional shortening (FS) is calculated: FS (%)=[(LVIDd-LVIDs)/LVIDd] x100 according to following formula.

Plasmid and transfection algoscopy.Contain the 305bp genomic fragment of miR-208 coding region by pcr amplification and connect into pCMV6.Pcr amplification is contained the 1kb fragment of whole Mus THRAP1-UTR and is connected into the pCMV6 expression construct and Fluc (f-luc) reporter construct (pMIR-REPORT of being with HA label ^tM, Ambion).Mutation via PCR-based constructs a kind of mutant form of UCGUCUUAmiR-208 seed binding sequence.

Cell culture, transfection and luciferase assay method.Contain the 1793bp genomic fragment of miR-29b-1 and miR-29a coding region by pcr amplification and connect into pCMV6.Pcr amplification is contained the genomic fragment of the Mus 3'UTR of miR-29a-c binding site and is connected into Fluc (f-luc) reporter construct (pMIR-REPORT ^tM, Ambion).With the instruction rotaring redyeing COS cell of Fugene6 (Stratagene) according to manufacturer.By adding the expression vector not containing cDNA insert of respective amount, keep the DNA constant total quantity in each hole.After transfection 48 hours, luciferase assay method test kit (Promega) is used to measure the luciferase expression of cell extract.Relative Promoter activity is stated as and is expressed standardized luminous relative unit relative to beta galactosidase in cell extract.

(Simpson and Savion, 1982) as discussed previously isolating cardiac fibroblast (CF).In brief, cut out heart from newborn 1-2 age in days Sprague-Dawley rat (HarlanSpragueDawley, Indianapolis, IN) of anesthesia, chopping, and digest with 0.1% pancreatinum.Cell paving is coated in primaria plate upper 2 hour, and removes the culture medium containing the myocardial cell fraction through digestion tissue.Cardiac fibroblast adheres to and breeds more fasterly than cardiac myocyte; In fact this generate pure fibroblast cell cultures after first time goes down to posterity, and this is confirmed by differentiation bed board (differentialplating) repeatedly and microscopic evaluation.Make cell detachment in order to go down to posterity with 0.05% trypsin, and implement culture research in 2-4 generation.Cultured cell in EagleShi culture medium (DMEM) is improved at the DulbeccoShi of the high glucose (4.5gm/lt) containing 10% hot deactivation FBS and antibiotic (penicillin and streptomycin).Within l48 hour, myofibroblast differentiation is induced by culture being become low serum (2%FBS) and L-AA (10 μ g/ μ l) and using 10ng/mlTGF β.

In the body undertaken by anti-miR process, miR-29b is reticent.Use through chemical modification, comprise and suppress miR-29b to express with the antisense oligonucleotide of the sequence of miR-29b complementation (anti-miR-29b).All bases are all that 2'-OMe modifies, and two and last four bases contain key between thiophosphate nucleoside, and the 3' of this oligonucleotide holds coupling to have cholesterol.Eight week age, C57BL/6 male mice accepted anti-miR-29b (AsAsCACUGAUUUCAAAUGGUsGsCsUsAs-cholesterol) or mispairing miR-29b (AsAsAACUGAUGUCACAUGGUsGsAsUsAs-cholesterol) or the suitable saline of volume through tail vein injections with the dosage of 80mg/kg body weight.Process latter 3 days or 3 weeks collection organizations.

Embodiment 1: pressure-responsive miRNA is to the adjustment of cardiac hypertrophy and heart failure

According to they participations in regulating cell phenotype, inventor supposes that miRNA plays a role in adjustment heart is to the response of cardiac pressure, and known this causes transcribing of gene expression and translate change.In order to investigate miRNA participation possible in cardiac hypertrophy, they use the microarray (Babak etc., 2004) representing 186 kinds of different miRNA to implement parallel (side-by-side) miRNA microarray analysis in 2 kinds of loose models of the mouse heart set up.Compare carrying out the stretch tight mice (TAB) (Hill etc., 2000) of bundle (this brings out hypertrophy by improving afterload of heart) of thoracic aorta with the animal carrying out sham-operation.In second model, the transgenic mice (Molkentin etc., 1998) of the calcinerin (CnA) (this causes hypertrophy that is serious, forms of characterization) of expressing activation in heart is compared (Figure 14 A) with wild type littermates.27 kinds of miRNA that the RNA be separated from the heart of the mice carrying out TAB demonstrates rising compared with carrying out the contrast of sham-operation express, and 33 kinds of miRNA that CnATg mice demonstrates rising compared with non-transgenic littermate controls express, wherein 21 kinds are all raised in these two kinds of models.Similarly, the hypertrophy that TAB and CnA brings out is expressed with 15 kinds that reduce and 14 kinds of miRNA respectively, and wherein 7 kinds of miRNA lower (Figure 14 B) jointly.(undocumented data) and previous microarray analysis (Barad etc., 2004 are analyzed to the Northern of these miRNA; Sempere etc., 2004; Shingara etc., 2005; Liu etc., 2004) indicate that they express in organizing widely.Based on their relative expression levels, the conservative of the mankind, rat and mouse sequence, and the expression during hypertrophy, inventor focuses on the miRNA (Figure 14 C) that 11 kinds of miRNA and 5 kinds of raising are lowered.

To the Northern engram analysis of the heart RNA from WT and CnATg animal confirm rising miR-21 ,-23 ,-24 ,-125b ,-195 ,-199a and-214 express and reduce miR-29 ,-93 ,-150 and-181b express (Figure 14 C and Figure 15).In a word, the miRNA of these data instruction uniqueness raises during cardiac hypertrophy, points out them to play the probability of the function of this process adjustment thing.

The discovery of the downstream target thing that embodiment 2:miR-29 family regulates as miR-208

May mediate in the effort of downstream miRNA of the effect of miR-208 in qualification, the present inventor implements miRNA microarray (Figure 16) to the heart from wild type and miR-208 null mice.They find that multiple members of miR-29 family raise (Figure 17) in miR-208 null mice.Target thing prediction instruction miR-29 family member targeting is encoded the mRNA (Figure 18) of multiple collagen and other composition of extracellular matrix.So, in miR-208 null mice the rise of miR-29 family member likely illustrate see in these animals to Fibrotic blocking-up (Figure 19).

MiR-29a-c lowers in diseased heart and the discovery prompting of the mRNA of targeting coding collagen and extracellular matrix proteins strengthens miR-29a-c expresses or the strategy of combination of itself and target thing mRNA can be reinvented pathological heart and heart in fibrosis background has beneficial effect.In addition, miR-29a-c express or the rising of function can stop tissue (such as skeletal muscle, liver, lung, kidney and other) in the fibrosis relevant with numerous disease.In addition, miR-208 contains that the discovery instruction miR-29a-c that the loss rise miR-29a-c of miR-29a-c expression and miR-208 expresses is the downstream mediator of miR-208 to action of the heart.

Embodiment 3:miR-29a-c regulates the expression of fibrosis gene

In order to start to limit the function that in heart, miR-29a-c is possible after MI, inventor utilizes computational prediction to identify possible miR-29a-c target thing.Targetscan predicts that website indicates that coding collagen that number is unexpectedly high, metallopeptidase mRNA relevant with the fibrosis of integrin are as possible miR-29a-c target thing (worldwide website is positioned at targetscan.org).May regulate cardiac fibrosis to determine that miR-29a-c lowers, inventor focuses on and relates to the prediction target thing that in heart, ECM generates.Elastin laminin (ELN), fibrillin 1 (FBN1), type i collagen α 1 and α 2 (COL1A1, COL1A2) and type III collagen α 1 (COL3A1) contain one or more conservative potential Seed Sequences (Figure 20 A) of miR-29a-c.

Because miRNA lowers steady-state level and the translation of its said target mrna, inventor analyzes the expression of prediction miR-29a-cmRNA target.To the specific downregulation of miR-29a-c in the Real time RT-PCR analysis instruction infarcted region of 3 days cardiac samples cardiac these crucial modulability genes Fibrotic after MI and COL1A1, COL1A2, COL3A1 and FBN1 express raise relevant.On the contrary, ELN shows in marginal zone unchanged, and even demonstrates rising (Figure 20 B) in distal myocardium.

Use the expression plasmid that CMV drives, inventor predicts luciferase expression plasmids process LAN miR-29b-1 and miR-29a (Figure 20 C) in COS cell of miR-29a-c target thing 3'-UTR with containing.The amount improving the miR-29b-1/miR-29a that CMV drives causes the dose dependent of luciferase activity to reduce, but the miR-206 of a great deal of (in contrast) does not have effect (Figure 20 C-D), demonstrating these mRNA is the target things of containing by miR-29a-c.

Embodiment 4: to the adjustment of miR-29a-c in cardiac fibroblast

Cardiac fibrosis is an importance of the remodeling process usually seen in failure heart.The deposition increase of fibroblastic propagation and ECM composition causes myocardial stiffness and diastolic dysfunction.Transforming growth factor β (TGF β) has demonstrated in the generation of collagen in heart and deposition and has played dominant trait's effect, and induced fibroblast is transformed into myofibroblast (Border and Noble, 1994).The real-time PCR analysis carried out the cardiac fibroblast being exposed to TGF β discloses the reduction that miR-29a-c expresses, and the miR-29a-c after prompting MI reduces and may regulate (Figure 21 A) by TGF β.What is interesting is, natriuretic peptide (as B-typeNatriuretic Peptide (BNP)) has demonstrated and has suppressed gene expression (Kapoun etc., 2004) that is relevant with fibrosis and transformation of myofibroblasts, that regulate by TGF β.In this, the mice that inventor's previous report lacks heartspecific miRNAmiR-208 is to cardiac fibrosis and reinvented resistance, and the BNP showing rising when baseline expresses (vanRooij etc., 2007).Due to the effect of known BNP antagonistic TGF beta, therefore the present inventor infers that the BNP level raised in these mices may strengthen the expression of miR-29a-c.In fact, the dose dependent that after Northern analyzes and shows removing miR-208, miR-29a-c expresses raises, and this conforms to (Figure 21 B) with more and more higher BNP expression.These data instruction TGF β induces collagen related gene expression in fibroblast, and realize via reduction miR-29a-c level at least partly, they can be suppressed by the BNP secreted by myocardial cell.

Low inducing fibrosis and collagen gene expression is struck in embodiment 5:miR-29a-c body

In order to explore the latent effect of miR-29a-c as the down regulator of collagen expression further, inventor uses and strikes low miR-29b in vivo with the cholesterol modified oligonucleotide (anti-miR-29b) of the ripe miRNA sequence complementation of miR-29b, using saline or comprise four base mispairings oligonucleotide (mmmiR-29b) as negative control (Figure 22 A).Latter three days of the anti-miR-29b of single tail vein injections (80mg/kg), inventor observe checked in a organized way in the remarkable reduction (Figure 22 B) expressed of miR-29b.On the contrary, compared with saline control, the expression of mmmiR-29b antisense oligonucleotide on miR-29b of suitable dosage does not affect.By anti-miR-29b realize to strike low showing be specific to ripe miRNA, because the level of pre-miRNA is still suitable between the animal of anti-miR and mm process.Although in liver and kidney to strike low showing be completely, in the heart and lung, low-level miR-29b (Figure 22 B) still can be detected.

Because other miR-29 member and miR-29b share high sequence homology, therefore also checked the miR-29a and-c expression that respond anti-miR-29b.Although detect in liver and kidney and strike significantly low (especially miR-29c), heart is expressed and is not shown change (Figure 23).Real-time PCR analysis instruction miR-29b strikes and to be lowly enough in liver specificity induction collagen gene expression, but does not have this effect (Figure 22 C) in Mismatch controls.

In order to the heart strengthening miR-29b strikes low, inventor's continuous two days intravenous injection 80mg/kg oligonucleotide, and collection material after 3 weeks.Compared with the expression seen after injecting with mmmiR-29b, Northern analyzes the miR-29b responding anti-miR-29b in instruction kidney regulating liver-QI and strikes low completely.The heart level of miR-29b also significantly reduces, but the miR-29b in lung shows and do not affect (Figure 22 D) by anti-miR-29b.Collagen expression response miR-29b in the heart suppresses and raises (Figure 22 E).In a word, these data instruction miR-29b plays the function of the down regulator of collagen gene expression in vivo, and the collagen deposition affected thus in heart regulating liver-QI and fibrosis.

Embodiment 6: lower collagen expression with miR-29a-c analogies

In order to determine whether miR-29a-c process LAN can reduce collagen expression, and fibroblast is exposed to miR-29b analogies by the present invention.Be exposed to miR-29b analogies after 3 days, the miR-29b expression in fibroblast cell cultures increases nearly 400 times (Figure 22 F).MiR-29a expresses unaffected, and miR-29c expression is only slightly raised (Figure 22 F) by miR-29b analogies.The expression of real-time PCR analysis instruction glue protogene responds miR-29b analogies and reduces (Figure 22 G).But be medium compared with the rising that reduction degree and the miR-29b of collagen expression express, instruction miR-29a-c level is not unique determiner of collagen level.

By addressing by complete to discussed herein and all publications that are that quote, patent and patent application income herein.According to the disclosure, just can make and perform disclosed herein with claimed all compositionss and method without the need to undo experimentation.Although describe the compositions and methods of the invention in preferred embodiment, but can it is evident that those skilled in the art, can to compositions described herein and method, and each step of described method or the order of each step carry out changing and not deviating from concept of the present invention, spirit and scope.In particular, can it is evident that, medicament described herein can be substituted at chemistry some reagent relevant with physiology's these two aspects, and same or analogous result can be realized.Think it will be apparent to those skilled in the art all this type of similar substitute and be modified in spirit of the present invention, scope and concept, they are defined by the following claims.

List of references

By addressing clearly by following list of references income herein, its degree provide exemplary code or other details to supplement listed by this paper for them those.

U.S.Patent4,873,191

U.S.Patent5,604,251

U.S.Patent5,844,107

U.S.Patent5,877,302

U.S.Patent5,972,900

U.S.Patent5,972,901

U.S.Patent6,008,336

U.S.Patent6,077,835

U.S.Patent6,200,801

U.S.Publn.20020150626

U.S.Publn.20030032615

U.S.Publn.20030203865

U.S.Publn.20040048787

Abrahametal.,Mol.Med.,8:750-760,2002.

Ambros,Cell,113(6):673-676,2003.

Angeletal,Cell,49:729,1987b.

Angeletal,Mol.Cell.Biol,7:2256,1987a.

AtchisonandPerry,Cell,46:253,1986.

AtchisonandPerry,Cell,48:121,1987.

Babaketal.,RNA10:1813-1819,2004.

BaichwalandSugden,In:GeneTransfer,Kucherlapati(Ed.),PlenumPress,NY,117-148,1986.

Banerjietal,Cell,27(2Ptl):299-308,1981.

Banerjietal,Cell,33(3):729-740,1983.

Baradetal,GenomeRes.14:2486-2494,1997.

Barnesetal,J.Biol.Chem.,272(17):11510-11517,1997.

Bavtd,Cell,116:281-297,2004.

BenvenistyandNeshif,Proc.NatlAcad.Sd.USA,83(24):9551-9555,1986.

Berketal.,J.Clin.Invest.117:568-575,2007.

Berkhoutetal.,Cell,59:273-282,1989.

Bhavsaretah,Genomics,35(l):ll-23,1996.

Blanavetal.,EMBOJ.,8:1139,1989.BodineandLey,EMBOJ,6:2997,1987.

BorderandNoble,N.Engl.J.Med.,331:1286-1292,1994.

Boshartetal.,Cell,41:521,1985.

Boszeetal.,M50J.,5(7):1615-1623,1986.

Braddocketal.,Cell,58:269,1989.

Brenneckeetal,Cell,113:25-36,2003.

Brinsteretal,Proc.Natl.Acad.Sci.USA,82(13):4438-4442,1985.

Bristow,Cardiology,92:3-6,1999.

BullaandSiddiqui,J.Virol,62:1437,1986.

Calinetal,Proc.Natl.Acd.Sci.USA,99:15524-15529,2002.

CampbellandVillarreal,MolCell.Biol,8:1993,1988.

CampereandTilghman,GenesandDev.,3:537,1989.

Campoetal,Nature,303:77,1983.

Careetal,Nat.Med.13:613-618,2007.

CarringtonetalScience,301(5631):336-338,2003.

CelanderandHaseltine,J.Virology,61:269,1987.

Celanderetal.,J.Virology,62:1314,1988.

Chandleretal,Cell,33:489,1983.

ChangandKarin,Nature,410(6824):37-40,2001.

Changetal,Biochim.Biophys.Acta,1092(2):153-160,1991.

Changetal,MolCell.Biol,9:2153,1989.

Changetal,Nature,430(7001):785-789,2004.

Chatterjeeetal,Proc.Natl.Acad.Sci.USA,86:9114,1989.

ChenandOkayama,MolCellBiol,7(8):2745-2752,1987.

Chenetal,Science,303(5654):83-86,2004.

Choietal,Cell,53:519,1988.

Coffin,In:Virology,Fieldsetal(Eds.),RavenPress,NY,1437-1500,1990.

Cohenetal,J.Cell.Physiol,5:75,1987.

Costaetal,MolCell.Biol,8:81,1988.

Couchetal,Am.Rev.Resp.Dis.,88:394-403,1963.

Couparetal.,Gene,68:1-10,1988.

Cripeetal,EMBOJ.,6:3745,1987.

CulottaandHamer,MolCell.Biol,9:1376,1989.

Oandoloetal.,J.Virology,47:55-64,1983.

DeVilliersetal,Nature,312(5991):242-246,1984.

Deschampsetal,Science,230:1174-1177,1985.

Dubenskyetal,Proc.Natl.Acad.Sci.USA,81:7529-7533,1984.

Durandetal,Ann.Med.,27:311-317,1995.

Edbrookeetal,MolCell.Biol,9:1908,1989.

EdgertonandRoy,J.ApplPhysiol,89:1224-1231,2000.

Edlundetal,Science,230:912-916,1985.

EichhornandBristow,Circulation,94:2285-2296,1996.

EPO0273085

Fatkinetal,J.Clin.Invest.,106(11):1351-1359,2000.

Fechheimer,etal,ProcNatl.Acad.Sci.USA,84:8463-8467,1987.

FengandHolland,Nature,334:6178,1988.

Ferkoletal,FASEBJ.,7:1081-1091,1993.

FirakandSubramanian,MolCell.Biol,6:3667,1986.

FoeckingandHofstetter,Gene,45(1):101-105,1986.

Fraleyetal,Proc.Natl.Acad.Sci.USA,76:3348-3352,1979.

Franzetal,Cardioscience,5(4):235-43,1994.

Freyetal,Circulation109:1580-1589,2004.

Friedmanetal,GenesDevel,3:1314,1989.

Fujitaetal,Cell,49:357,1987.

GhoshandBachhawat,In:LiverDiseases,TargetedDiagnosisandTherapyUsingSpecificReceptorsandLigands,Wuetal(Eds.),MarcelDekker,NY,87-104,1991.

Ghosh-Choudhuryetal,EMBOJ.,6:1733-1739,1987.

Gillesetal,Cell,33:717,1983.

Glossetal,EMBOJ.,6:3735,1987.

Godboutetal,MolCell.Biol,8:1169,1988.

Gomez-Foixetal,J.Biol.Chem.,267:25129-25134,1992.

GoodbournandManiatis,Proc.Natl.Acad.Sci.USA,85:1447,1988.

Goodbournetal,Cell,45:601,1986.

GopaLMol.CellBiol,5:1188-1190,1985.

Gopal-Srivastavaetal.,J.MolCellBiol.15(12):7081-7090,1995.

GrahamandPrevec,In:MethodsinMolecularBiology:GeneTransferandExpressionProtocol,Murray(Ed.),HumanaPress,Clifton,NJ,7:109-128,1991.

GrahamandVanDerEb,Virology,52:456-467,1973.

Grahametah,J.Gen.Virl,36(l):59-74,1977.

Greeneetal,ImmunologyToday,10:272,1989

Grishoketal,Cell,106:23-34,2001.

GrosschedlandBaltimore,Cell,41:885,1985.

GrunhausandHorwitz,SeminarinVirology,3:237-252,1992.

HarlandandWeintraub,J.CellBiol.,101(3):1094-1099,1985.

HaslingerandKarin,Proc.Natl.Acad.Sci.USA,82:8572,1985.

HauberandCullen,J.Virology,62:673,1988.

HeinekeandMolkentin,Nat.Rev.Mol.CellBiol.7:589-600,2006.

Henetal,Nature,321:249,1986.

Henseletal,LymphokineRes.,8:347,1989.

HermonatandMuzycska,Proc.Natl.Acad.Sci.USA,81:6466-6470,1984.

HerrandClarke,Cell,45:461,1986.

Hersdorfferetal,DNACellBiol,9:713-723,1990.

HerzandGerard,Proc.Natl.Acad.Sci.USA,90:2812-2816,1993.

Hilletal,Circulation,101:2863-2869,2000.

Hirochikaetal.,J.Virol,61:2599,1987.

Hirschetal,MolCell.Biol,10:1959,1990.

Holbrooketal.,Virology,157:211,1987.

HorlickandBenfield,MolCell.Biol,9:2396,1989.

HorwichetalJ.Virol,64:642-650,1990.

Huangetal,Cell,27:245,1981.

Hugetal,MolCell.Biol,8:3065,1988.

Hutvagneretal,PLoSBiol,2(4):E98,2004.

Hwangetal,MolCell.Biol,10:585,1990.

Imagawaetal,Cell,51:251,1987.

ImbraandKarin,Nature,323:555,1986.

Imleretal,MolCell.Biol,7:2558,1987.

ImperialeandNevins,MolCell.Biol,4:875,1984.

ItoandRoeder,TrendsEndocrinol.Metab.,12:127-134,2001.

Jakobovitsetal.,Mol.Cell.Biol,8:2555,1988.

JameelandSiddiqui,Mol.Cell.Biol,6:710,1986.

Jaynesetal,MolCell.Biol,8:62,1988.

Johnsonetal,MolCell.Biol,9:3393,1989.

JonesandShenk,Cell,13:181-188,1978.

KadeschandBerg,MolCell.Biol,6:2593,1986.

Kanedaetal,Science,243:375-378,1989.

Kapounetal,Circ.Res.,94:453-461,2004.

Karinetal,MolCell.Biol,7:606,1987.

Karinetal,MolCell.Biol,7:606,1987.

Karlssonetal,EMBOJ.,5:2377-2385,1986.

Katinkaetal,Cell,20:393,1980.

Katinkaetal,Nature,290:720,1981.

Katoetal,J.Biol.Chem.,266:3361-3364,1991.

Kawamotoetal,MolCell.Biol,8:267,1988.

Kellyetal,J.CellBiol,129(2):383-396,1995.

Kiledjianetal.,Mol.Cell.Biol,8:145,1988.

Kimuraetal,Dev.GrowthDiffer.39(3):257-265,1997.

Kinugawaetal,Circ.Res.,89:591-598,2001.

Kinugawaetal,J.Clin.Endocrinol.Metab.,86:5089-5090,2001.

KiriazisandKranias,Annu.Rev.Physiol,62:321-351,2000.

Klaassen'sThePharmacologicalBasisofTherapeutics

Klamutetal,MolCell.Biol,10:193,1990.

Kleinetal,Nature,327:70-73,1987.

Kochetal,MolCell.Biol,9:303,1989.

Kreketal,NatureGenetics,37:495-500,2005.

KrenzandRobbins,J.Am.Coll.Cardiol,44:2390-2397,2004.

KrieglerandBotchan,In:EukaryoticViralVectors,Gluzman(Ed.),ColdSpringHarbor:

ColdSpringHarborLaboratory,NY,1982.

KrieglerandBotchan,MolCell.Biol,3:325,1983a.

Kriegleretal,Cell,38:483,1984.

Kriegleretal,Cell,53:45,1988.

Kriegleretal,In:GeneExpression,AlanLiss(Ed.),HamerandRosenberg,NewYork,1983b.

Krützfeldtetal,Nature,438:685-689,2005.

Kuhletal,Cell,50:1057,1987.

Kunzetal,Nucl.AcidsRes.,17:1121,1989.

Lagos-Quintanaetal.,Science,294(5543):853-858,2001.

LaPointeetal,Hypertension27(3Pt2):715-22,1996.

LaPointeetal,J.Biol.Chem.,263(19):9075-8,1988.

Larsenetal,ProcNatl.Acad.Sci.USA.,83:8283,1986.

Laspiaetal,Cell,59:283,1989.

Latimeretal,MolCell.Biol,10:760,1990.

Lauetal,Science,294(5543):858-862,2001.

LeGalLaSalleetal,Science,259:988-990,1993.

LeeandAmbros,Science,294(5543):862-864,2001.

Leeetal,Nature,294:228,1981.

Leungetal,Proc.Natl.Acad.Sci.USA,48:18125-18130,2006.

Levinsonetal,Nature,295:79,1982.

Levreroetal,Gene,101:195-202,1991.

Linetal,MolCell.Biol,10:850,1990.

Liuetal,ProcNatlAcadSciUSA101:9740-9744,2004.

Lowesetal,J.Clin.Invest.,100(9):2315-2324,1997.

Luriaetal,EMBOJ.,6:3307,1987.

LuskyandBotchan,Proc.Natl.Acad.Sci.USA,83:3609,1986.

Luskyetal,MolCell.Biol,3:1108,1983.

MacejakandSarnow,Nature,353:90-94,1991.

MajorsandVarmus,Proc.Natl.Acad.Sci.USA,80:5866,1983.

Mannetal,Cell,33:153-159,1983.

Mwkowitzetal,J.Virol,62:1120-1124,1988.

McKinseyandOlson,J.Clin.Invest.,115(3):538-546,2005.

McNealletal,Gene,76:81,1989.

MeisterandTuschl,Nature,431:343-9,2004.

Miksiceketal,Cell,46:203,1986.

Miyataetal,Circ.Res.,86(4):386-390,2000.

Molkentinetal.,Cell93:215-228,1998.

MordacqandLinzer,GenesandDev.,3:760,1989.

Moreauetal,Nucl.AcidsRes.,9:6047,1981.

Morkin,Microsc.Res.Tech.,50:522-531,2000.

Mossetal,Biol.Chem.,271(49):31688-31694,1996.

Muesingetal,Cell,48:691,1987.

Nakaoetal,Clin.Invest.,100(9):2362-2370,1997.

Ngetal,Nuc.AcidsRes.,17:601,1989.

NicolasandRubinstein,In:Vectors:Asurveyofmolecularcloningvectorsandtheiruses,RodriguezandDenhardt(Eds),Stoneham:Butterworth,494-513,1988.

NicolauandSene,Biochim.Biophys.Acta,721:185-190,1982.

Nicolauetal,MethodsEnzymol,149:157-176,1987.

Ondeketal,EMBOJ.,6:1017,1987.

Ornitzetal,MolCell.Biol,7:3466,1987.

Palmiteretal,Nature,300:611,1982.

Pantosetal,Horm.Metab.Res.,38:308-313,2006.

Paskindetal,Virology,67:242-248,1975.

PasquinelliandRuvkun,Ann.Rev.CellDev.Biol,18:495-513,2002.

PCTAppln.WO0071096

PCTAppln.WO84/03564

PCTAppln.WO98/33791

Pechetal,MolCell.Biol,9:396,1989.

PelletierandSonenberg,Nature,334(6180):320-325,1988.

Peralesetal,Proc.Natl.Acad.Sci.USA,91:4086-4090,1994.

Perez-StableandConstantini,MolCell.Biol,10:1116,1990.

PhysiciansDeskReference

PicardandSchaffner,Nature,307:83,1984.

Pinkertetal,GenesandDev.,1:268,1987.

Pontaetal,Proc.Natl.Acad.Sci.USA,82:1020,1985.

Povtonetal,MolCell.Biol,10:1076,1990.

Potteretal,Proc.Natl.Acad.Sci.USA,81:7161-7165,1984.

QueenandBaltimore,Cell,35:741,1983.

Quinnetal,MolCell.Biol,9:4713,1989.

Racheretal,BiotechnologyTechniques,9:169-174,1995.

Ragotetal,Nature,361:647-650,1993.

Redondoetal,Science,247:1225,1990.

ReismanandRotter,MolCell.Biol,9:3571,1989.

Remington'sPharmaceuticalSciences,15thed.,pages1035-1038and1570-1580,MackPublishingCompany,Easton,PA,1980.

Renan,Radiother.Oncol,19:197-218,1990.

ResendezJr.etal.,Mol.Cell.Biol,8:4579,1988.

Richetal,Hum.GeneTher.,4:461-476,1993.

Ridgeway,In:Vectors:ASurveyofMolecularCloningVectorsandTheirUses,Rodriguezetal(Eds.),Stoneham:Butterworth,467-492,1988.

Ripeetal,MolCell.Biol,9:2224,1989.

Rippe,etal,MolCellBiol,10:689-695,1990.

Rittlingetal,Nuc.AcidsRes.,17:1619,1989.

Rosenetal,Cell,41:813,1988.

Rosenfeldetal,Science,252:431-434,1991.

Rosenfeld,etal,Cell,68:143-155,1992.

Rouxetal,Proc.Natl.Acad.Sci.USA,86:9079-9083,1989.

Sakaietal,GenesandDev.,2:1144,1988.

SambrookandRussell,MolecularCloning:ALaboratoryManual3<rd>Ed.,ColdSpringHarborLaboratoryPress,2001.

Satakeetal,JVirology,62:970,1988.

Schaffneretal,J.MolBiol,201:81,1988.

Searleetal,MolCell.Biol,5:1480,1985.

Sempereetal,GenomeBiol5:R13,2004.

SharpandMarciniak,Cell,59:229,1989.

ShaulandBen-Levy,EMBOJ.,6:1913,1987.

Shermanetal,MolCell.Biol,9:50,1989.

Shingavaetal,RNA11:1461-1470,2005.

SimpsonandSavion,Circ.Res.,50:101-116,1982.

SleighandLockett,J.EMBO,4:3831,1985.

Spalholzetal,Cell,42:183,1985.

SpandauandLee,J.Virology,62:427,1988.

SpandidosandWilkie,EMBOJ.,2:1193,1983.

StephensandHentschel,Biochem.J.,248:1,1987.

Stratford-PerricaudetandPerricaudet,In:HumanGeneTransfer,Eds,Cohen-HaguenauerandBoiron,JohnLibbeyEurotext,France,51-61,1991.

Stratford-Perricaudetetal,Hum.Gene.Ther.,1:241-256,1990.

Stuartetal,Nature,317:828,1985.

SullivanandPeterlin,MolCell.Biol,7:3315,1987.

SwartzendruberandLehman,J.Cell.Physiology,85:179,1975.

Takebeetal.,Mol.Cell.Biol,8:466,1988.

Tavernieretal,Nature,301:634,1983.

TaylorandKingston,MolCell.Biol,10:165,1990a.

TaylorandKingston,MolCell.Biol,10:176,1990b.

Tayloretal,J.Biol.Chem.,264:15160,1989.

Temin,In:GeneTransfer,Kucherlapati(Ed.),NY,PlenumPress,149-188,1986.

TheMerckIndex,EleventhEdition

Thiesenetal.,J.Virology,62:614,1988.

Topetal,J.Infect.Dis.,124:155-160,1971.

Treisman,Cell,46(4):567-174,1986

Trancheetal,MolBiol.Med.,7:173,1990.

Trancheetal,MolCellBiol,9(11):4759-4766,1989.

TrudelandConstantini,GenesandDev.,6:954,1987.

Tuv-Kaspaetal,MolCellBiol,6:716-718,1986.

Tyndelletal,Nuc.Acids.Res.,9:6231,1981.

vanRooijetal,Proc.Natl.Acad.Sci.USA,103(48):18255-18260,2006.

vanRooijetal,Science316(5824):575-579.2007

VanniceandLevinson,J.Virology,62:1305,1988.

Varmusetal,Cell,25:23-36,1981.

Vasseuretal,ProcNatl.Acad.Sci.USA,77:1068,1980.

Wagneretal,Proc.Natl.Acad.Sci.USA87(9):3410-3414,1990.

WangandCalame,Cell,47:241,1986.

Weberetal,Cell,36:983,1984.

Weietal,J.Endocrinol.Invest.,28:8-11,2005.

WeinbergeretalMolCell.Biol,8:988,1984.

WinotoandBaltimore,Cell,59:649,1989.

Wongetal,Gene,10:87-94,1980.

WuandWu,Adv.DrugDeliveryRev.,12:159-167,1993.

WuandWu,Biochemistry,27:887-892,1988.

WuandWu,J.Biol.Chem.,262:4429-4432,1987.

Xuetal,Curr.Biol,13:790-795,2003.

Yamauchi-Takiharaet.al,Proc.Natl.Acad.Sci.USA,86(10):3504-3508,1989.YangandRussell,Proc.Natl.Acad.Sci.USA,87:4144-4148,1990.

Yangetal.,Nat.Med.13:486-491,2007.

YaoandEghbali,Circ.Res.71:831-839,1992.

Youngetal,In:HandbookofAppliedTherapeutics,7.1-7.12and9.1-9.10,1989.

Yuetal,Biochem.Biophys.Res.Commun.349(l):59-68.EpubAug11,2006.

YutzeyetalMolCell.Biol,9:1397,1989.

Zeleninetal,FEBSLett.,287(1-2):118-120,1991.

Zengetal,MolCell,9(6):1327-33,2002.

Zhaoetal,Proc.Natl.Acad.Sci.USA,102(13):4890-4895,2005.

ZioberandKramer,J.Bio.Chem.,271(37):22915-22,1996

Claims (10)

1. the purposes of agonist in the medicine for the preparation for the treatment of in the experimenter having this to need or prevention tissue fibering of miR-29a-c, the agonist of wherein said miR-29a-c comprises pri-miRNA, pre-miRNA of miR-29a, miR-29b and/or miR-29c or the polynucleotide of mature sequence.

2. the purposes of claim 1, wherein said polynucleotide comprise the sequence of SEQIDNO:18, SEQIDNO:19 or SEQIDNO:20.

3. the purposes of claim 1 or 2, wherein said polynucleotide are expressed from expression vector.

4. the purposes any one of claim 1-3, the preparation of wherein said agonist is used for parenteral, oral, percutaneous, Intradermal, intramuscular, intravenous, subcutaneous, intraperitoneal, sustained release, controlled release, delayed release, suppository, suction, conduit or sublingual administration or is injected directly in heart tissue.

5. the purposes of claim 1, wherein said tissue fibering is cardiac fibrosis, scleroderma, skeletal muscle fiber, hepatic fibrosis, renal fibrosis, pulmonary fibrosis or diabetic fibrosis.

6. the purposes any one of claim 1-3, wherein said polynucleotide are double-strands.

7. the purposes of claim 2, wherein said polynucleotide length is 18 to 25 nucleotide.

8. the purposes of claim 2, wherein said polynucleotide length is 70 to 200 nucleotide.

9. the purposes of claim 1 or 2, wherein said polynucleotide comprise one or more chemical modification.

10. the purposes of claim 9, wherein said chemical modification is selected from lower group: locked nucleic acid, sugar-modified and backbone modifications.