CN111249466A

CN111249466A - Application of tanshinone IIA and miR-29b inhibitor in preparation of medicine for treating tendon adhesion

Info

Publication number: CN111249466A
Application number: CN202010178441.6A
Authority: CN
Inventors: 卢荟; 周海英; 蒋帅; 杨虎; 沈辉
Original assignee: First Affiliated Hospital of Zhejiang University School of Medicine
Current assignee: First Affiliated Hospital of Zhejiang University School of Medicine
Priority date: 2020-03-14
Filing date: 2020-03-14
Publication date: 2020-06-09
Anticipated expiration: 2040-03-14
Also published as: CN111249466B

Abstract

The invention relates to application of tanshinone IIA and miR-29b inhibitor in preparation of a medicament for treating tendon adhesion, and belongs to the technical field of medicines.

Description

Application of tanshinone IIA and miR-29b inhibitor in preparation of medicine for treating tendon adhesion

Technical Field

The invention relates to application of combination of tanshinone IIA and miR-29b inhibitor in preparation of a medicine for treating tendon adhesion, and belongs to the technical field of medicines.

Background

Tendon adhesion refers to tendon motor dysfunction caused by proliferation and invasion of surrounding tissues during tendon injury repair. Tendon adhesion after trauma surgery is one of the common problems after tendon injury, and as the prevalence of adhesion and the contradictory factors that tendon healing needs sufficient strength to perform early functional exercise, no effective solution has been available so far. Tendon adhesions may occur due to mechanical and chemical injury. After injury, mesenchymal cells and mast cells are induced to release a variety of active substances, including thrombin, histamine, heparin and other vasoactive substances, resulting in an inflammatory response in the tissue, increased capillary permeability, and massive serous exudation. If these exudates are not broken down and absorbed, fibrin may accumulate, followed by infiltration of fibroblasts and ingrowth of new capillaries, eventually leading to adhesion. From the standpoint of tendon healing, tendon healing is currently believed to be accomplished by both internal and external repair mechanisms. Endogenous repair mechanism repairs injured tendon through tendon cell proliferation, and exogenous repair mechanism repairs injured tendon through peritendinal tissue proliferation, fibroblast proliferation and inflammatory cell proliferation, so the strength of tendon is mainly determined by endogenous repair mechanism, and exogenous repair mainly forms adhesion. Therefore, the ideal tendon repair mode is to start an endogenous mechanism in advance at the tendon broken end, so that the tendon can be healed with enough strength, and then the adhesion can be prevented and treated by inhibiting the exogenous mechanism in the peritendinous tissue.

The major cytokines found to be involved in the tendon injury repair process include transforming growth factor β (transforming growth factor- β - β), bone morphogenetic protein 12(bone morphogenetic protein-12, BMP-12), insulin-like growth factor 1(insulin-like growth factor-i, IGF-1), basic fibroblast growth factor (basic fibroblast growth factor, bFGF), Vascular Endothelial Growth Factor (VEGF), Platelet Derived Growth Factor (PDGF), etc. TGF- β/Smad3 is a common important signaling pathway in the wound repair process, is one of the factors of histopathological fibrosis, TGF- β, etc. is found to be responsible for the dose effect and time of human embryonic cells and TGF- β, and TGF-23, which is found to be involved in the tendon injury repair process, and is found to be an important signaling pathway in the tendon repair process through the stimulation of fibroblast growth factor-5, which is found to be involved in the healing process by the proliferation of fibroblast growth factor-5, which is found to be a low-stimulating factor of the growth factor, TGF- β, TGF-5, which is found to be a factor which is considered to be a major factor which is responsible for the growth factor which is found to promote the proliferation of the healing of human embryonic germ healing process, and which is found to be responsible for the growth of tendon injury, and which is found to be caused by the growth factor which is found to be an excessive growth factor which is found to promote the growth factor which is found to be an inflammatory response of the growth factor which is found to the growth of tendon repair process of the growth of the tendon repair process of the healing of the growth of the healing of tendon repair process of myofibroblast growth of the growth of myofibroblast growth of the tendon repair process of tendon repair process.

Tanshinone IIA is an effective component of salvia miltiorrhiza (Salviaminetirrhiza bunge) of salvia in Labiatae and has the effects of resisting bacteria, diminishing inflammation, expanding blood vessels, resisting platelet aggregation and the like, the in vitro primary culture rat HSC stimulated by TGF- β is activated, meanwhile, the danshenic acid is acted, and as a result, the danshenic acid is found to inhibit the secretion of cell collagen, α -smooth muscle actin (α -smooth muscle actin, α -SMA) and the protein expression of a plasminogen activator inhibitor, and inhibit the protein expression of

Smad

2 and 3 in cytoplasm and nucleus, so that the mechanism of inhibiting the hepatic fibrosis and inhibiting the HSC activation by the danshenic acid is that the mechanism of inhibiting TGF β in the signal transduction of HSC, and the mechanism of inhibiting the hepatic fibrosis of mice is also found that the tanshinone IIA promotes the mRNA expression of cell I collagen by inhibiting the TGF- β/Smad3 signal pathway, reduces the expression of liver tissue IGFBP7, thereby exerting the hepatic fibrosis resistance effect, and the like, and proves that the tanshinone IIA can be reduced by regulating the TGF- β/493 pathway and the kidney fiber export of rat kidney 23-493 and the kidney 23-Na-mouse.

The traditional Chinese medicine is an important component of splendid culture of China and is one of the most influential subject fields in China in the world at present. The concept of 'treating the disease before the disease' in the traditional Chinese medicine is well-known for a long time, and the first 'four-qi regulating-nerve theory' in the Huangdi 'Nei Jing & Su Wen & lt & gt problem' discusses that the goddess do not treat the disease before the disease is treated, the goddess do not treat the disease after the disease is treated disorderly and … … is treated randomly, the goddess do not treat the disease after the disease is treated randomly, the goddess do not feel thirsty but do fighting against the disease, and the special knowledge and the insights of the field in the traditional Chinese medicine are created. The theory of stasis in the beginning of arthralgia guides the treatment of early tendon adhesion, namely the theory of prevention of diseases and prevention of diseases. And accords with the strategy of converting to prevention treatment. The use of drugs to prevent pre-disease or high risk groups is naturally a focus of international evidence-based medicine. This is a development trend in the global health care industry. Intervention of early tendon adhesions is therefore a need for the patient and also for the development of hygiene.

Tendon adhesion is a common complication after tendon injury, and the prevention and treatment of tendon adhesion is always a common concern in the scientific community. How to cause the tendon to generate less or no adhesion after being damaged or repaired, recover the sliding function as soon as possible, and simultaneously not influence the healing of the tendon is the existing technical problem, and no effective medicine and method can thoroughly solve the problem of tendon adhesion at present. The local injection traditional Chinese medicine has the advantages of integral dynamic adjustment and individualized treatment, and the accurate and quick treatment effect of western medicines is also the guarantee of good compliance of patients. Therefore, the early prevention of tendon adhesion by combining traditional Chinese medicine and gene therapy is urgently needed in clinic at present. The method conforms to the requirements of the country, the society and the individual, brings practical benefits to patients, and can bring great economic and social benefits to the country, the society, the family and the individual.

Disclosure of Invention

The invention aims to provide application of combination of tanshinone IIA and miR-29b inhibitor in preparation of a medicament for treating tendon adhesion, so as to solve the problems in the prior art.

The technical scheme adopted by the invention for solving the technical problems is as follows:

application of tanshinone IIA and miR-29b inhibitor in preparation of medicine for treating tendon adhesion is provided.

Preferably, the application is to use tanshinone IIA after the miR-29b inhibitor.

Preferably, the application is to use tanshinone IIA 0-72h after the miR-29b inhibitor. The optimal scheme is that tanshinone IIA is used 4-8h after the miR-29b inhibitor.

A medicine for treating tendon adhesion comprises tanshinone IIA and miR-29b inhibitor. Most preferably, the mode of administration of the medicament is injection.

Research on liver fibrosis patients finds that serum levels of miRNA-16, miRNA-146a, miRNA-221 and miRNA-222 are all significantly up-regulated in early and late stages of liver fibrosis, Liu and the like show that miR-21 is significantly up-regulated in lungs of bleomycin-induced fibrotic mice and in lungs of IPF patients, increased miR-21 levels promote fibroblastic activity of TGF- β in fibroblasts, thereby causing pulmonary fibrosis, and reduction of miRNA-29 levels is also found in relation to fibrosis of various organs including heart, liver, kidney and skin and SSc, which indicates that miRNA-29 levels may be core 'fibragrna', miR-29 is knocked out in human lung fibroblast IMR-90 cells, and a plurality of miR- β up-regulated related fibrosis related genes are found to inhibit inflammation of mouse collagen receptor beta-actin gene expression in vivo, and inhibit diabetic retinopathy, and inhibit collagen production of rat, collagen receptor beta-5, mouse collagen production, mouse proliferation, rat endothelial cell proliferation, mouse endothelial cell proliferation, kidney and IPF patients, and diabetic nephropathy, and rat endothelial growth factor-1 is significantly inhibited by TGF-11B kinase-11, and mouse endothelial cell proliferation.

Considering that the regulation and control effects of tanshinone IIA and miR-29b on tissue fibrosis can be realized through a TGF- β 1/Smad3 way, the invention innovatively adopts the combination of tanshinone IIA and miR-29b inhibitor, namely combines the traditional Chinese medicine and gene therapy means, so as to realize the clinical treatment of tendon adhesion and prepare the medicament for treating the tendon adhesion.

The inhibition effect of tanshinone IIA (TSA) and miR-29b inhibitor on tendon adhesion formation after tendon injury is verified through molecular cells and biological multi-layer. All data are expressed as mean ± standard deviation. Three and more groups were compared using ANOVA analysis, two groups were compared using Student's t-test, and all analyses were performed using SPSS 17.0 software. P <0.05 was considered statistically significant.

The results show that there is a statistical difference between the results of the treatment groups and between the control groups and the treatment groups (P < 0.05). from the expression of inflammatory factors, TSA treatment reduces the expression of TGF- β 1 and Samd3 levels, and the miR-29 inhibitor significantly upregulates the expression of TGF- β 1 and Smad3, and when used in combination, the expression levels of TGF- β 1 and sad 3 are significantly higher than those of cells treated with TSA alone, but significantly attenuated compared to cells treated with miR-29b inhibitor, indicating that TSA and miR-29b inhibitors both target the same pathway, which means that the binding of both can trigger the endogenous pathway, and that manipulation of TSA and miR-29b inhibitor significantly reduces the proliferation potential of cells treated with TSA-29 b, while the targeting of TSA-29 b inhibitor to cells treated with miR-29b increases the proliferation potential of cells treated with FACS, and when cell proliferation inhibitors are treated with miR-29b, the cell inhibitors significantly reduce the proliferation potential of proliferation and cell proliferation when cell inhibitors are treated with miR-29b, the cell proliferation pathway is significantly reduced when cell proliferation is analyzed in late-sorting.

Further, the in vivo experimental study conducted by the present invention was conducted by randomly dividing all rats into 6 groups, 1 group was a sham-operated group without tendon injury treatment, and the remaining 5 groups were labeled and positioned at the tendon injury site after the rat model of the achilles tendon injury was made, and were randomly divided into 4 miR-29 b-inhibited group (treated group) and 1 negative control-injected group (control group), and miR-29b interfering adenovirus or empty virus was injected in vivo every 3 days, the 4 groups of the treated group were injected with 0.5ml of tanshinone IIA injection immediately after surgery, 6 hours after surgery, 24 hours after surgery, and 72 hours after surgery at the tendon marker site, and each injection lasted for 1 week, general behavioral observation of rats was conducted after 3 weeks, tissue analysis, and biomechanical determination were conducted after taking the tendon injury area tissue for general observation, tissue pathology analysis, and biomechanical determination, cell level results showed that the combined treatment with TSA and miR-29b inhibitors could significantly reduce the number of apoptotic cells, and the miR-29b inhibitors were injected in the tendon injury area tissue area for general behavioral observation, tissue analysis, tissue level was close to the most closely to that the treated group, and the collagen load of the collagen in the treated group was not significantly increased, but significantly, and the collagen fiber load of the collagen fiber treated group was significantly increased in the collagen group, and the collagen fiber treated group for the collagen group was not increased significantly, but significantly.

The test results show that miR-29b inhibitor applied to tendon stumps can activate TGF- β 1/Smad3 pathway to start endogenous repair mechanism, and TSA can block TGF- β 1/Smad3 pathway to inhibit exogenous repair mechanism.

Drawings

In order to more clearly illustrate the embodiments or technical solutions of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained based on these drawings without creative efforts.

FIG. 1 is a graph showing the dynamic changes of miR-29B, TGF- β 1 and Smad under the action of miR-29B interfering adenovirus and TSA, wherein A: MTT method is used for determining the cytotoxicity of TSA, B: qPCR is used for detecting the expression of miR-29, C: TGF- β 1mRNA and protein expression level are determined under different conditions, D: qPCR (n-3) is used for detecting the expression of Smad mRNA under different conditions, and western blotting is used for detecting the protein expression level (n-1);

FIG. 2 is a graph of the effect of miR-29b interfering with adenovirus and TSA treatment on cell proliferation, apoptosis, and cell cycle, A: cell proliferation was measured with CCK8 kit, B: FACS detection of apoptosis, C: cell cycle analysis of primary isolated cells under different conditions;

FIG. 3 is a graph showing the effect of drug action on miR-29b expression and apoptosis after a rat Achilles tendon injury model is established, wherein A: qPCR quantification of miR-29B expression, B: the TUNEL method detects the frequency of apoptotic cells;

FIG. 4 is a graph of the effect of miR-29B inhibitor and TSA treatment on TGF- β 1, p21 and Smad3 expression, A: qPCR for TGF- β 1mRNA expression, n-3, B: qPCR for p21 mRNA expression, n-3, C: qPCR for Samd3 mRNA expression;

fig. 5 is a graph showing analysis of tendon collagen expression and histological changes, in which a: production of collagen of each group i, B: production of collagen type iii in tendon tissue of rats in each group, C: hematoxylin eosin staining (HE staining) and Masson staining (x200), D: expression of cyclin D;

fig. 6 is a tendon strength analysis chart in which a: biomechanical analysis of maximum load, B: evaluation of periintimal adhesion;

in fig. 2 to 6, n is 3, p is 0.05, 0.01, 0.005, 0.001.

Detailed Description

The technical solution of the present invention will be further specifically described below by way of specific examples. It is to be understood that the practice of the invention is not limited to the following examples, and that any variations and/or modifications may be made thereto without departing from the scope of the invention.

In the present invention, all parts and percentages are by weight, unless otherwise specified, and the equipment and materials used are commercially available or commonly used in the art. The methods in the following examples are conventional in the art unless otherwise specified.

The reagents used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

In the following examples: miR-29b, AAV-293 cells, miR-29b interfering adenovirus and miR-29b inhibitor are all provided by Ruibo Biotechnology, Inc., Guangzhou.

The core of the invention is to provide an application of tanshinone IIA and miR-29b inhibitor in preparation of a medicament for treating tendon adhesion, which is called as a first specific embodiment, and the method comprises the following steps:

example 1

First, miR-29b interference adenovirus customization

Constructing miR-29b interference recombinant plasmid by using miRNA sponge adsorption structure, and co-transfecting AAV-293 cells with package plasmid pHelper and pAAV-RC; after 3 days of transfection, cells were lysed to collect AAV viral particles; centrifuging, ultrafiltering, concentrating and purifying virus supernatant; the virus titer is determined by a fluorescent quantitative PCR method, and the total amount of miR-29b interfering adenovirus (miR-29bshRNA adenovirus) and unloaded adenovirus (miR-29b NC adenovirus) is respectively 1^10^11pfu by subpackaging and storing.

Second, rat Achilles tendon injury model making

Experimental animals: SD rats, male, about 350g, SPF grade, provided by the experimental animals center of the medical college of university of zhejiang.

Rat Achilles tendon injury model preparation: abdominal injection of halothane (50 mg/kg). Stopping bleeding on the right hind limb, making a heel longitudinal incision, opening the Achilles tendon sheath, picking out Achilles tendon, cutting, and using 5-0Ti-Cron non-absorbable suture (COVIDIEN, Langhorn, PA, USA); modified Kessler sutures were applied to Achilles tendon, tendon sheath and skin closure by direct suturing with 5-0Surgipro slide wire (COVIDIEN, Langhorn, Pa., USA). After the model is built, the injury part of the achilles tendon is provided with a line or a mark, so that the administration and the positioning are convenient, and the hind limb of the rat is fixed by a splint.

Third, isolation and culture of primary rat fibroblast

Taking the tendon at the injured part of the achilles tendon of the SD rat after the model building, rinsing for three times by ampicillin-streptomycin sulfate-PBS, removing peritendinous tissues, and sufficiently shearing the tendon according to the proportion of 1: 1 volume ratio of 0.25% pancreatin-200U/ml collagenase IV DMEM medium, 37 degrees C digestion effect for 2 hours. Centrifuging at 1200rpm for 10 min, washing the precipitate with serum-free DMEM, centrifuging for 2 times, re-suspending with 10% fetal calf serum-containing DMEM medium, adding into culture dish, and centrifuging at 37 deg.C and 5% CO₂Removing the original culture medium after 2 hours of adherence in the environment of (1), separating out fibroblasts, and performing conventional culture and passage. The separated cells are detected by conventional HE (human epididymis) chromatoscopy and immunocytochemistry staining to detect the expression of Col1 and Col3 so as to determine whether the cells are fibroblasts.

Example 2 Effect of TSA and miR-29b inhibitors on rat fibroblasts

1. MTT (monocyte direct cytotoxicity assay) screening for the most suitable tanshinone concentration

Rat fibroblasts in the logarithmic growth phase and in a good growth state in example 1 were digested and prepared into a single cell suspension, which was inoculated into a 96-well plate at a density of 2000 cells/well, and the culture medium was added to a final volume of 100. mu.l, to set up 1 blank control group, 6 TSA-treated groups (0.001uM, 0.01uM, 0.1uM, 1uM, 10uM, 20uM) of different concentrations, and 5 duplicate wells were set for each group at 37 ℃ and 5% CO₂The culture was continued for 24 hours after the cells were attached to the wall, and for 4 hours after 20. mu.l of 5mg/ml MTT was added. The medium containing MTT was discarded, 150. mu.l DMSO was added and incubated for 30min, and the absorbance at 490nm was measured using a multifunctional microplate reader. The light absorption value reflects the vitality of the cells. The results of the experiment are shown in FIG. 1A, and the results show that 1. mu.M TSA significantly reduced the survival rate of cells, and therefore, the present inventors used 0.1. mu.M TSA in the present study.

In the following experiment, rat fibroblasts in logarithmic growth phase and in good growth state in example 1 are digested and prepared into single cell suspension, the single cell suspension is inoculated into a 96-well plate at the density of 2000 cells/well, a culture solution is added until the final volume is 100 mu l, and 2 negative control groups are set up, namely 1 blank control group and 1 miR-29b NC adenovirus transfection group respectively; and 4 treatment groups, namely miR-29b interference adenopathyA virus transfection group, a 0.1 mu M TSA treatment group, a miR-29b NC adenovirus +0.1 mu M TSA treatment group, and a miR-29b interfering adenovirus +0.1 mu M TSA treatment group, wherein each group is provided with 5 multiple holes, and the temperature is 37 ℃ and the CO content is 5 percent₂The cells are cultured under the environment of (1), and the cells are continuously cultured for 24 hours after being attached to the wall.

2. CCK8 detects cell proliferation: pancreatin digestion, collection of cells in logarithmic growth phase, re-suspension of cells at 1 × 105cell/ml density, plating in 96-well plate, adding 10 μ l CCK8 into each well, culturing at 37 deg.C for 4h, and measuring absorbance OD 450 of each well with enzyme labeling instrument to detect cell proliferation level. The results of the experiment are shown in figure 2A,

as can be seen from FIG. 2A, in comparison with the negative control group, the cells treated with miR-29b to interfere with adenovirus significantly increased cell proliferation, while the TSA-treated cells significantly decreased cell proliferation, whereas when TSA and miR-29b inhibitor simultaneously act on the cells, the present inventors found that the cell proliferation ability was significantly decreased compared to the miR-29b inhibitor and was higher than that of the TSA-treated cells.

3. Detecting the cell cycle by a flow cytometer: cells were incubated with different concentrations of TSA for 24 hours, then stained with propidium iodide and the DNA content was detected by flow cytometry.

Groups of cells were taken from each log phase growth and then fixed and permeabilized in pre-chilled 100% methanol. Propidium iodide (50. mu.g/ml) and RNase A (125. mu.g/ml) were added at room temperature, and after 45 minutes of incubation for staining, cells were filtered through a 200-mesh nylon mesh membrane, and then analyzed for cell cycle using a flow cytometer FACSCalibur (Becton Dickinson Co.) (see FIG. 2C for experimental results).

The isolated cultured fibroblasts were collected, trypsinized, washed with pre-cooled PBS, and resuspended in 100. mu.l binding buffer. Then 2. mu.l Annexin V-FITC and 5. mu.l PI were added to the cells and incubated for 15 minutes at room temperature protected from light. After adding 400. mu.l binding buffer, the reaction was carried out on the machine. The software analyzed the rate of apoptosis (see figure 2B for experimental results).

The above experimental results show that the TSA-treated cells have a higher proportion of cells in the G1 phase, and the TSA-induced apoptosis rate is higher than that of the control cells. In addition, compared with the miR-29b interference adenovirus treatment group, the TSA treatment group has the cell proportion reduced in the G2 stage and the S stage. Meanwhile, when TSA and miR-29b interfere adenovirus to act on cells at the same time, the inventor also observes that the apoptosis is obviously reduced, the proportion of cells in the G1 phase is slightly higher than that of the single TSA, and the miR-29b inhibitor is opposite.

Taken together, the results indicate that miR-29b can promote cell proliferation, and TSA can reduce the effects.

4. QPCR detects the content change of TGF- β 1, Smad3 and miR-29b, which comprises the steps of taking each group of cells in logarithmic growth phase, digesting the cells by 0.25% pancreatin, centrifuging the cells for 10 minutes at 1200rpm of solution, washing the cells by PBS, centrifuging the cells for 2 times, extracting total RNA by a Trizol method, measuring the concentration of the total RNA by an ultraviolet spectrophotometry, detecting TGF- β 1, Smad3 and miR-29b by adopting a primer sequence (the same below) and a real-time fluorescent PCR kit (TaKaRa), calculating the relative ratio of gene expression by adopting a 2- △△ CT method, and taking U6 as an internal reference gene, wherein the test result is shown in a graph of 1B, C (left) and D (left).

TABLE 1 primers used for QPCR detection

mircoRNA antisense strand universal primer: r primer: CCAGTGCAGGGTCCGAGGTATT (SEQ ID No. 11).

As can be seen from the data in FIG. 1B, the inventors observed that the application of miR-29B interfering adenovirus significantly reduced the expression of miR-29B in fibroblasts, TSA treatment significantly enhanced the expression of miR-29B, and simultaneous treatment of cells with TSA and miR-29B interfering adenovirus counteracted the effects of treatment, indicating that there was no significant change in miR-29B in the double treated samples, whereas the dynamic changes in the expression of TGF- β 1 and Smad at the mRNA and protein levels were the same as can be seen from the data in FIG. 1C, D.

5. Western Blot (WB) assay TGF- β 1, p-Smad3, Smad3 Total proteins were routinely extracted from cells of each treatment group, centrifuged at 12000rpm for 15min at 4 ℃, the supernatant was concentrated using BCA kit, 30 μ g of total protein was electrophoretically separated on 10% SDS-PAGE gels from each sample, wet-processed proteins were transferred to 0.22 micron pore PVDF membrane, the membrane was incubated overnight at 4 ℃ with the corresponding primary antibody, incubated with HRP-labeled secondary antibody (1:2000) for 90min at room temperature, visualized using Ez-ECL chemiluminescence assay kit to detect the levels of cells p21, TGF- β 1, Smad3, p-Smad3 in tissue, quantification One software for band grayscale analysis, β -actin as internal reference protein, and the results are shown in FIGS. 1C (right) and D (right).

As can be seen from the data in FIG. 1C (right), D (right), the inventors found that TSA treatment reduced expression at the level of TGF- β 1 and Samd3 in contrast, miR-29 interference adenovirus group significantly upregulated expression of TGF- β 1 and Smad3 when cells were treated with both TSA and miR-29 interference adenovirus, the expression levels of TGF- β 1 and Samd3 were significantly higher than those of cells treated with TSA alone, but significantly attenuated compared to cells treated with miR-29b interference adenovirus.

The results show that TSA and miR-29b inhibitors both target the same pathway, meaning that the binding of the two can trigger the intrinsic pathway and manipulate the targeted late stage of the extrinsic pathway.

Example 3 prevention and treatment of Achilles tendon adhesion in rats by TSA and miR-29b inhibitors

45 SD rats after model creation in example 1 are taken and randomly divided into 6 groups, each group comprises 5 rats, 1 group is a sham operation group and is not subjected to tendon injury treatment, the other 5 groups of rats are randomly divided into two groups, namely 4 groups, namely a miR-29b inhibition group (treatment group) and 1 group, namely a negative control injection group (control group), and miR-29b interference adenovirus or empty virus in vivo transfection injection (10^9 pfu/mouse) is performed at a mark every 3 days. Treatment groups 4 rats were injected with 0.5ml TSA injection immediately after surgery, 6 hours after surgery, 24 hours after surgery, and 72 hours after surgery at the achilles tendon marker, each injection lasting 1 week. Sacrificed after 3 weeks.

1. General observations were: the mental state, the activity, the fur, the weight, the achilles tendon wound healing condition and the like of the rat are dynamically observed. All rats survived, the wound healed for the first time, and no infection and hind limb waste occurred.

2. General observation: SD rats are sacrificed and then the skin and subcutaneous tissues of the operative area are incised, tissues of tendon suture, tendon sheath and tendon are respectively exposed, and inflammatory reaction, granulation hyperplasia, tendon healing and adhesion conditions of tendon broken ends are observed. The scoring criteria were: class I, no adhesion around the tendon; level II, the tendon suture has a few limitations, the thin film is adhered, and the tendon sliding is slightly limited; III level, small blocks are loose and adhered in a belt shape, and are easy to separate from the surface of the tendon, and the sliding part of the tendon is limited; class IV, medium and compact adhesion in a large area, certain mobility and obvious limitation on tendon sliding; v grade, dense adhesion in large area, extensive adhesion between tendon and sheath, subcutaneous tissue, and extremely poor sliding property. The tendon healing condition is superior in grade I and II, good in grade III, and poor in grade IV and V. The test results are shown in FIG. 6B, and the results prove that the tendon healing of each treatment group is better than that of the control group.

3. And (3) biomechanical determination: after the rat is sacrificed, the achilles tendon and the calcaneus bone connected with the achilles tendon are dissected and separated, and the adhesion tissues around the tendon are removed cleanly to prevent the influence on the experimental result. The preload was applied at 1N and the Achilles tendon tension was adjusted and then returned to zero. The maximum distance was set at 6.50mm, and the Achilles tendon was stretched to break at 0.05mm/s (biomechanical slow pull test) and 1mm/s (biomechanical fast pull test), respectively. The ultimate load and the actual stretching length of the achilles tendon are read by Winstest mechanical testing software, the toughness is calculated to be load/strain (N/mm), the fracture part is observed, and the tendon original length, the strain proportion, the maximum load and the maximum strain are recorded. The test results are shown in FIG. 6A.

As can be seen from the data in fig. 6A, the results show that the maximum load under all the treatment conditions is higher than that of the control group, and although the maximum load is still lower than that of the untreated group, the tendon can not be completely healed, but the early induction of endogenous repair mechanism can improve the tendon strength and reduce tendon adhesion.

4. And (3) histological observation: taking treated tendon tissues of rats of each group, soaking and fixing the treated tendon tissues by 4% paraformaldehyde, dehydrating after decalcification treatment, embedding paraffin and slicing for later use. Histological observations were performed by hematoxylin eosin staining (HE staining) and Masson trichrome staining (x200), analyzed under light microscopy: fibroblasts, collagen fibers, inflammatory cells. The results of the experiment are shown in fig. 5C, and it can be seen from the data of fig. 5C that in all groups, the present inventors observed that fibroblasts and collagen tissues at the repair site were proliferated and well arranged compared to the untreated control group.

FIG. 3 shows the rat model established and treated under different conditions of 1-6 groups shown in FIG. 3. Rats were sacrificed 3 weeks after treatment. The apoptosis rate was measured by TUNNEL staining and the results under fluorescence microscopy (fig. 3B) showed that the combination treatment with TSA and miR-29B inhibitors significantly reduced the number of apoptotic cells.

Notably, the inventors observed that the levels of apoptotic cells were slightly lower in the other treatment groups compared to rats treated with the miR-29b inhibitor first and TSA 6 hours later, while being similar compared to the untreated group, indicating that different treatment time points may produce different therapeutic effects.

5. And (3) molecular biological observation: QPCR examined the effect of the miR-29b inhibitor in the rat model, and the results showed (FIG. 3A) that all inhibitor treatments significantly inhibited miR-29b RNA expression compared to the untreated group.

QPCR and WB detected the expression levels of TGF- β 1, p21 and Smad3, and the results showed (FIG. 4) that TGF- β 1, p21 and Smad3 were consistently expressed at the mRNA and protein levels, and that the treated group significantly reduced their expression, but still higher than the healthy control group, indicating that the treatment may not be able to fully heal the tendon, requiring further detailed study.

Immunohistochemistry was used to detect tendon tissue collagen expression, FIG. 5A, B, D is a graph of tendon tissue collagen expression and histological change analysis, immunohistochemistry was used to detect the expression level of collagen I at 3 weeks of each group, A: collagen type I production in each group, B: collagen type III production in rat tendon tissue in each group, and D: cyclin D expression, histological evaluation of tendon tissue at 3 weeks of each group, it was shown from the results of FIG. 5A, B, D that the expression of collagen types I and III (Col I/III) in tendon tissue showed opposite trends, the protein level of Col I increased when TSA treatment was delayed, while cyclin D increased significantly compared to untreated group, but there was no difference between treated groups.

In vitro experiments show that TSA treatment can remarkably enhance the expression of miR-29b, TSA can reduce the expression of TGF- β and Smad3, inhibit cell proliferation and promote apoptosis, and miR-29b inhibitor is opposite, when TSA and miR-29 inhibitor are used at the same time, apoptosis is remarkably reduced, the expression level of TGF- β and Samd3 is remarkably higher than that of cells treated by TSA only, but is remarkably weakened compared with cells treated by miR-29b inhibitor, and the combined application of miR-29b inhibitor and TSA can effectively prevent tendon adhesion and improve tendon strength.

In conclusion, the invention proves that an endogenous repair mechanism can be started by using the miR-29b inhibitor at the tendon stump, and an exogenous repair mechanism can be inhibited by using the TSA, so that the purpose of reducing tendon adhesion is achieved. Particularly, TSA is added after miR-29b inhibitor treatment for 6 hours, so that cytotoxicity generated in the rat model is lower, tendon adhesion is inhibited, and the effect of enhancing tendon adhesion strength after healing is better.

The embodiments are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same or similar parts among the embodiments are referred to each other. The device disclosed by the embodiment corresponds to the method disclosed by the embodiment, so that the description is simple, and the relevant points can be referred to the method part for description.

The application of the combination of tanshinone IIA and miR-29b inhibitor provided by the invention in preparing a medicament for treating tendon adhesion is described in detail above. The principles and embodiments of the present invention are explained herein using specific examples, which are presented only to assist in understanding the method and its core concepts. It should be noted that, for those skilled in the art, it is possible to make various improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications also fall within the scope of the claims of the present invention.

Sequence listing

<110> Zhejiang university medical college affiliated to the first hospital

Application of combination of tanshinone IIA and miR-29b inhibitor in preparation of medicine for treating tendon adhesion

<130>WHLY20-019

<160>11

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial sequence (1-F)

<400>1

cactcccgtg gcttctagtg 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence (1-R)

<400>2

ggactggcga gccttagttt 20

<210>3

<211>20

<212>DNA

<213> Artificial sequence (2-F)

<400>3

acagcaggtc aagaggagta 20

<210>4

<211>20

<212>DNA

<213> Artificial sequence (2-R)

<400>4

ctgagcctgt ttcgtgtcta 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence (3-F)

<400>5

cctccaattc agagcgcttc 20

<210>6

<211>20

<212>DNA

<213> Artificial sequence (3-R)

<400>6

atagcactgt cactgaggca 20

<210>7

<211>20

<212>DNA

<213> Artificial sequence (4-F)

<400>7

cgcttcggca gcacatatac 20

<210>8

<211>20

<212>DNA

<213> Artificial sequence (4-R)

<400>8

aaatatggaa cgcttcacga 20

<210>9

<211>23

<212>DNA

<213> Artificial sequence (5-F)

<400>9

tgcgctagca ccatttgaaa tca 23

<210>10

<211>52

<212>DNA

<213> Artificial sequence (5-S)

<400>10

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaacact ga 52

<210>11

<211>22

<212>DNA

<213> Artificial sequence (R primer)

<400>11

ccagtgcagg gtccgaggta tt 22

Claims

1. Application of tanshinone IIA and miR-29b inhibitor in preparation of medicine for treating tendon adhesion is provided.

2. Use according to claim 1, characterized in that: the application is to use tanshinone IIA after miR-29b inhibitor.

3. Use according to claim 1, characterized in that: the application is to use tanshinone IIA 0-72h after the miR-29b inhibitor.

4. Use according to claim 1, characterized in that: the application is to use tanshinone IIA 4-8h after the miR-29b inhibitor.

5. A medicament for treating tendon adhesion is characterized in that: the medicine comprises tanshinone IIA and a miR-29b inhibitor.

6. A medicament for the treatment of tendon adhesions as claimed in claim 5, which is characterized by: the administration mode of the medicine is injection.