CN110283851A - Target spot MYO9B relevant to malignant pleural effusion and its application - Google Patents

Target spot MYO9B relevant to malignant pleural effusion and its application Download PDF

Info

Publication number
CN110283851A
CN110283851A CN201910634660.8A CN201910634660A CN110283851A CN 110283851 A CN110283851 A CN 110283851A CN 201910634660 A CN201910634660 A CN 201910634660A CN 110283851 A CN110283851 A CN 110283851A
Authority
CN
China
Prior art keywords
myo9b
sequence
application
substance
product
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910634660.8A
Other languages
Chinese (zh)
Other versions
CN110283851B (en
Inventor
施焕中
伊凤双
翟侃
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Chaoyang Hospital
Original Assignee
Beijing Chaoyang Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Chaoyang Hospital filed Critical Beijing Chaoyang Hospital
Publication of CN110283851A publication Critical patent/CN110283851A/en
Application granted granted Critical
Publication of CN110283851B publication Critical patent/CN110283851B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/10—Antioedematous agents; Diuretics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Environmental Sciences (AREA)
  • Hematology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Diabetes (AREA)
  • Animal Husbandry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses target spot MYO9B relevant to malignant pleural effusion and its applications.The invention also discloses following 1) -5) in any application: 1) inhibit application of the substance of MYO9B protein active in the product of preparation treatment or adjuvant treatment malignant pleural effusion；2) substance of MYO9B protein active is inhibited to reduce or reduce the application in the product of Patients with Malignant Pleural Metastases pleural effusion amount in preparation；3) inhibit or the substance of silencing MYO9B gene expression is preparing the application in treatment or the product for assisting in the treatment of malignant pleural effusion；4) inhibit or the substance of silencing MYO9B gene expression is preparing the application in reduction or the product for reducing Patients with Malignant Pleural Metastases pleural effusion amount；5) application of MYO9B albumen and its associated signal paths as target spot in the product for developing or designing treatment or adjuvant treatment malignant pleural effusion.

Description

Target spot MYO9B relevant to malignant pleural effusion and its application
Technical field
The invention belongs to animal gene engineering technology fields, and in particular to target spot MYO9B relevant to malignant pleural effusion And its application.
Background technique
Tumour cell to pleura infringement can result in malignant pleural effusion (Malignant Pleural Effusion, MPE).In China, lung cancer morbidity rate occupies the first place of all cancers, and death rate highest, and lung cancer is with the middle position of MPE patient Life cycle is obviously shortened compared with no MPE patient, and quality of life is worse.Therefore, the pathogenesis of MPE is inquired into, it is relatively early to find and diagnose MPE gives corresponding control measure, significant for the quality of life for improving patient, however the pathogenesis in relation to MPE is current It is not also fully aware of.Interaction between tumour and host is the key that MPE formation, and the tumour at pleura is that MPE is formed Driving force, and the panimmunity cell of host plays an important role during the occurrence and development of MPE.
MYO9B is a kind of Multidomain, single head motor signal molecule, the Various Tissues such as lymph node, chest in immune system Gland, spleen and panimmunity cell such as Dendritic Cells, macrophage and CD4+Great expression in T cell.2010, Hanley etc. edits mouse embryo stem cell MYO9B gene using cre-loxP system, and it is small to obtain MYO9B gene knockout Mouse.Although Cre/loxP system is theoretically very mature but there are still insufficient and limitations in practical applications: (1) utilizing The conditionity that Cre/loxP technology carries out gene, which knocks out, first has to building targeting vector, the homology arm that amplification length is about 4-5kb, BAC clone and gene recombination technology are also needed simultaneously.LoxP segment is targeted and imports cellular genome, this step occurs homologous heavy The probability of group is extremely low, and needs to identify targeting by the complicated screening operation such as Long fragment PCR and Northern hybridization Successful cell.Therefore, which needs a large amount of time and efforts, is to carry out gene conditionity using Cre/loxP system to strike The rate-limiting step removed.(2) there is certain potential poison after Cre enzyme is expressed in mammals as a kind of exogenous recombinase Property, the problems such as cell Proliferation abnormal, DNA mismatch and chromosome deficiency can be caused.(3) Cre/loxP system cutting efficiency is 70% Or so, still there is a small amount of gene that knocks out not to be knocked in purpose organ or tissue, these target gene not knocked out can be in specific device Official organizes interior trace expression.
Summary of the invention
The first purpose of the invention is to provide following 1) -5) in any application:
1) inhibit the substance of MYO9B protein active answering in the product of preparation treatment or adjuvant treatment malignant pleural effusion With；
2) substance of MYO9B protein active is inhibited to reduce or reduce Patients with Malignant Pleural Metastases pleural effusion amount in preparation Application in product；
3) inhibit or the substance of silencing MYO9B gene expression is in preparation treatment or the product of adjuvant treatment malignant pleural effusion In application；
4) inhibit or the substance of silencing MYO9B gene expression is reduced in preparation or reduction Patients with Malignant Pleural Metastases thoracic cavity is long-pending Application in the product of liquid measure；
5) MYO9B albumen and its associated signal paths are being developed or are being designed treatment as target spot or assisting in the treatment of malignant pleural Application in the product of hydrops.
In above-mentioned application, the substance for inhibiting MYO9B protein active can be the synthesis of inhibition MYO9B albumen or promotion MYO9B protein degradation or protein, polypeptide or the small molecule compound for inhibiting MYO9B protein function；
The substance of the inhibition or silencing MYO9B gene expression can be the substance or knockout of interference MYO9B gene expression The substance of MYO9B gene or the substance for being mutated MYO9B gene.
Further, the substance for knocking out MYO9B gene can be CRISPR/Cas9 system.
Further, in the CRISPR/Cas9 system include two sgRNA, be respectively designated as sgRNA1 and sgRNA2；
The target sequence of the sgRNA1 identification is DNA molecular shown in the sequence 1 in sequence table；
The target sequence of the sgRNA2 identification is DNA molecular shown in the sequence 2 in sequence table.
In a specific embodiment of the present invention, the sgRNA1 is RNA molecule shown in sequence 3 in sequence table；
The sgRNA2 is RNA molecule shown in sequence 4 in sequence table.
It is a further object to provide a kind of products.
The active constituent of product provided by the invention is the substance of above-mentioned inhibition MYO9B protein active or inhibition or silencing The substance of MYO9B gene expression；
The function of the product is to treat or assist in the treatment of malignant pleural effusion or reduction or reduce malignant pleural effusion to suffer from Person's pleural effusion amount.
It is a still further object of the present invention to provide a kind of preparation methods of transgenic mice.
The preparation method of transgenic mice provided by the invention includes the following steps: based on CRISPR/Cas9 system to small MYO9B gene in musculus cdna group is edited, so lose MYO9B gene function in the mouse genome to get To the transgenic mice.
In the above method, in the CRISPR/Cas9 system include two sgRNA, be respectively designated as sgRNA1 and sgRNA2；
The target sequence of the sgRNA1 identification is DNA molecular shown in the sequence 1 in sequence table；
The target sequence of the sgRNA2 identification is DNA molecular shown in the sequence 2 in sequence table；
Further, the sgRNA1 is RNA molecule shown in sequence 3 in sequence table；
The sgRNA2 is RNA molecule shown in sequence 4 in sequence table.
The above method includes the steps that using the sgRNA1, sgRNA2 the and Cas9 mRNA；
Further, the mass ratio of the sgRNA1, the sgRNA2 and the Cas9 mRNA are (1-2): (1-2): 2；
Further, the mass ratio of the sgRNA1, the sgRNA2 and the Cas9 mRNA are 1:1:2.
In a specific embodiment of the present invention, described method includes following steps:
(1) electricity containing the sgRNA1, sgRNA2 the and Cas9 mRNA is turned liquid electricity to go in mouse fertilized egg, Obtain the fertilized eggs after electricity turns；
(2) fertilized eggs after the electricity turns are cultivated, and select development into the embryo implantation replace-conceive mouse of 2 cell stages, hair After the completion of educating, F0 is obtained for mouse；
(3) F0 of MYO9B gene mutation is obtained for mouse (heterozygosis) from the F0 for identification in mouse；
(4) F0 is hybridized for mouse (heterozygosis) with wild-type mice (C57BL/6 mouse), it is (miscellaneous obtains F1 generation mouse It closes)；
(5) by the female and male hybridization in the F1 generation mouse (heterozygosis), F2 is obtained for mouse (homozygosis)；
(6) F2 is bred for mouse (homozygosis) continuous hybrid to F4 generation, obtains F4 for mouse (homozygosis).
It is compared with wild type C57BL/6 mouse, the F4 that the present invention obtains is on two homologues of mouse (homozygosis) Size shown in 17697-17712 of MYO9B gene is size shown in the DNA fragmentation and 17866-17872 of 16bp It is lacked for the DNA fragmentation of 7bp.
It is a still further object of the present invention to provide the products for preparing above-mentioned transgenic mice.
The product provided by the invention for preparing above-mentioned transgenic mice includes above-mentioned sgRNA1, above-mentioned sgRNA2 and Cas9 mRNA。
Following M1) or M2) or M3) described in application also belong to protection scope of the present invention:
M1) transgenic mice that the above method is prepared is as studying malignant pleural effusion occurrence and development mechanism And/or the application in the mouse model of prognosis；
M2 the transgenic mice or the said goods that) above method is prepared are in preparation for studying malignant pleural effusion hair Application in raw development mechanism and/or the mouse model of prognosis；
M3 the transgenic mice or the said goods that) above method is prepared are preparing and/or are screening treatment or assisting controlling Treat the application in the drug of malignant pleural effusion.
The present invention uses CRISPR/Cas9 system to edit the MYO9B gene in mouse genome for the first time, obtains MYO9B knock out mice, and further MYO9B function is studied.Malignant pleural effusion model experiment results show: The immune response that MYO9B gene participates in malignant pleural effusion is compared with wild-type mice, the pernicious chest after MYO9B gene knockout The pleural effusion amount of chamber hydrops mouse significantly reduces.
Detailed description of the invention
Fig. 1 is 01#Mouse catastrophe.01#Mouse is containing heterozygous mutation, mutation are as follows: -16-7 (missing 16bp+ missing 7bp)。
Fig. 2 is 02#Mouse catastrophe.02#Mouse is containing heterozygous mutation, mutation are as follows: -16-1 (missing 16bp+ missing 1bp)。
Fig. 3 is MYO9B knock out mice compared with the pleural effusion amount of wild-type mice.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even Mean value.
The name of product of Opti-MEM in following embodiments is GibcoTMOpti-MEMTM, it is the product of Thermo.
The name of product of Cas9mRNA in following embodiments is GeneArtTMCRISPR Nuclease mRNA is Invitrogen product, lot number 00556295.
C57BL/6 mouse and CD-1 mouse in following embodiments are Beijing dimension limited public affairs of tonneau China experimental animal technology The product of department.
The construction method of embodiment 1, MYO9B gene editing mouse model
One, sgRNA and Cas9 mRNA prepares
1, the design of target sequence
According to MYO9B gene order, (No. Genbank of the mRNA sequence of MYO9B gene is NM_001142322.1, such as sequence In list shown in sequence 5.Wherein, DNA sequence dna shown in sequence 5 171-6557 is the CDS sequence of encoding murine MYO9B albumen Column), the target sequence of design is as follows:
1#:TGGCTCGAAGCACTACGTGC (sequence 1)；
2#:AGGCTGGCAGCTCGGGCCGT (sequence 2).
2, the preparation of sgRNA
(1) with eSpCas9 (1.1) plasmid (addgene) for template, using invitro-sgMyo9b-1#.S and hU6.R Primer carries out PCR amplification, obtains PCR product, as in-vitro transcription template 1；
With eSpCas9 (1.1) plasmid (addgene) for template, using invitro-sgMyo9b-2#.S and hU6.R primer PCR amplification is carried out, PCR product is obtained, as in-vitro transcription template 2.
Primer sequence is as follows:
Invitro-sgMyo9b-1#.S:TAATACGACTCACTATAGGGTGGCTCGAAGCACTA CGTGCGTTTTAG AGCTAGAAATAG；
Invitro-sgMyo9b-2#.S:TAATACGACTCACTATAGGGAGGCTGGCAGCTCGG GCCGTGTTTTAG AGCTAGAAATAG；
HU6.R:AAAAGCACCGACTCGGTGCC.
(2) PCR product is through agarose gel electrophoresis, and then Ago-Gel DNA QIAquick Gel Extraction Kit recycles, then respectively to return The in-vitro transcription template 1 and in-vitro transcription template 2 of receipts are template, (are purchased from Ambion company, goods using T7 in-vitro transcription kit Number be AM1334) be transcribed in vitro, respectively obtain sgRNA1 and sgRNA2.
SgRNA1 sequence is as follows: UGGCUCGAAGCACUACGUGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (sequence 3)
SgRNA2 sequence is as follows: AGGCUGGCAGCUCGGGCCGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (sequence 4).
(3) transcription product is through agarose gel electrophoresis, and then RNA purification kit recycles, then is dissolved with DEPC water, obtains SgRNA1 solution and sgRNA2 solution, last -80 DEG C save backup.
3, electricity turns the preparation of mixed liquor
Opti-MEM, sgRNA1 solution, sgRNA2 solution and Cas9mRNA solution are mixed, electricity is obtained and turns mixed liquor (always 50 μ L of volume), it is respectively 200ng/ μ L, 200ng/ μ that sgRNA1, sgRNA2 and Cas9mRNA, which turn the final concentration in mixed liquor in electricity, L and 400ng/ μ L.
Two, surpass ovulation
8 week old male C57BL/6 mouse 1,8 week old female C57BL/6 mouse 3.Female mice was in first day abdominal cavity 14:00 Pregnant mare serum gonadotrop(h)in (PMSG) PMSG (5U/ is only) is injected, human chorionic gonadotrophin hCG is injected intraperitoneally in third day 14:00 (5U/ is only) immediately after mates 3 female mices and 1 male mouse, and 8:00-9:00 checks female mice vaginal plug within the 4th day, chooses and checks To the female mice of negative bolt.
Three, fertilization ovum collecting and culture
The female mice of negative bolt is checked in euthanasia above-mentioned steps two, its fallopian tubal of aseptic collection is put into a 35mm Pi Shi In culture dish (the drop culture medium made of M2 culture solution and hyaluronidase solution, 37 DEG C of pre-temperatures), under stereomicroscope Ampulla of uterine tube is torn with tweezers, the zygote group that cumulus cell surrounds is released, is moved into hyaluronidase drop A few minutes are placed, fertilized eggs is collected, is transferred in M2 drop culture medium, selects morphologically normal fertilized eggs, in 37 DEG C, 5%CO2 Under the conditions of cultivate it is spare.
Four, electricity turn and fallopian tubal in embryo transfer
It takes the electricity prepared in 45 μ L above-mentioned steps one to turn mixed liquor to be added in CUY505P5 pole cup, adds and pick out Fertilized eggs measure resistance, make its 0.48-0.52k Ω, and electricity turns, and design parameter is as follows: Poring Pulse:225V, Length 1ms, interval 50ms, No.4, D.Rate 10%, Polarity+；Transfer Pulse:20V, Length 50ms, Interval 50ms, No.5, D.Rate 10%, Polarity+/-.Fertilized eggs after electricity turns are gone in KSOM culture medium, 37 DEG C, 5%CO2Under the conditions of be incubated overnight, select development to 2 cell stages embryo implantation replace-conceive mouse.
Specific step is as follows for embryo transfer: the CD-1 female mice of false pregnancy 0.5d (morning on the same day checks negative bolt), fiber crops Do about 1cm notch in back after liquor-saturated, exposure ovary and fallopian tubal, under stereomicroscope, will after microinjection culture to 2 cell stages Embryo implantation ampulla of uterine tube, sutured after ovary and fallopian tubal are put back to abdominal cavity, left and right sides fallopian tubal is transplanted, every Mouse is implanted into 20 2 cell stage embryos.
Five, strain is established
1, identification of the positive F0 for mouse
1) CD-1 mouse farrowing in about 20 days, obtains F0 for mouse after transplanting.After F0 is born for mouse, cut in 3-4 week old Tail, and the tissue of acquisition is used for the extraction of genomic DNA, while using wild type C57BL/6 mouse as control.
2) using the genomic DNA of extraction as template, PCR amplification is carried out using upstream primer and downstream primer, obtains PCR production Object, and PCR product is sequenced.Primer sequence is as follows:
My09b.dec.S:TCTGGTATGAACTGCCTTG；
My09b.dec.A:TAGTAGCCATCCTCCTGAG.
Sequencing result shows: comparing with wild type C57BL/6 mouse, positive F0 is for mouse 01#In two homologues One article of homologue on MYO9B gene 17697-17712 the positions 189-204 of mRNA sequence (corresponding) shown in Size shown in DNA fragmentation that size is 16bp and 17866-17872 (position 358-364 of corresponding mRNA sequence) is 7bp DNA fragmentation lacked, there is no mutation (Fig. 1) for another item chromosome.
It is compared with wild type C57BL/6 mouse, positive F0 is for mouse 02#A homologous dyeing in two homologues Size shown in 17695-17710 (positions 187-202 of corresponding mRNA sequence) of the MYO9B gene on body is 16bp's Bases G shown in DNA fragmentation and the 17868th (360 of corresponding mRNA sequence) is lacked, and another item chromosome does not have It mutates (Fig. 2).
2, the foundation of strain
Take positive F0 for mouse 01#It builds and is.Specific step is as follows: by positive F0 for mouse 01#It is small with wild type C57BL/6 Mouse hybridization obtains F1 generation mouse, when 3-4 week old, cuts coda gene type evaluation and screening and positive F0 for mouse 01#Genotype is consistent Mouse obtains F1 generation chimeric mice 01#；F1 generation chimeric mice 01#Between carry out hybridization and obtain F2 for mouse, when 3-4 week old, cut Coda gene type evaluation and screening goes out F2 for Mice homozygous 01#, F2 is for Mice homozygous 01#Female and male can be used as the mating of kind of mouse, Continuous hybrid was bred to F4 generation, obtained F4 for Mice homozygous 01#And genotype identification is carried out to it.Genotype identification primer My09b.dec.S and My09b.dec.A.
It is compared with wild type C57BL/6 mouse, F4 is for Mice homozygous 01#MYO9B gene on two homologues The DNA piece that size shown in the DNA fragmentation and 17866-17872 that size shown in 17697-17712 is 16bp is 7bp Duan Jun is lacked.
Six, the functional verification of MYO9B knock out mice
To wild type C57BL/6 mouse and MYO9B knock out mice, (F4 is for Mice homozygous 01#) carry out malignant pleural product Liquid model experiment.
1, the building of malignant pleural effusion mouse model
Based on wild type C57BL/6 mouse and MYO9B knock out mice, (F4 is for Mice homozygous 01#) according to document "Stathopoulos GT et al.,J Natl Cancer Inst,2008；Stathopoulos GT et al.,Am J Respir Crit Care Med,2010；Wu XZ et al., Am J Respir Cell Mol Biol, the side in 2017 " Method constructs malignant pleural effusion mouse model, respectively obtains wild type MPE mouse model and MYO9B gene knockout MPE mouse mould Type.Specific step is as follows: after mouse enters deep numb state, with sterilizing immobilization with adhesive tape mouse four limbs, being at dorsal position, cuts The hair of the mouse forward right side wall of the chest is removed, is then successively disappeared with the skin of Iodophor and the 75% chronic ethanol treated mice forward right side wall of the chest Poison.Skin is cut off to the osculum of about 5mm long at one at 45 ° of about 1cm of mouse xiphoid-process upper right, then passivity successively separates subcutaneous muscle Film and muscle are until exposure rib cage.Tumour cell is inoculated with into mouse pleural cavity: with the micro-injection of 100 μ l ranges under direct-view Device extracts 50 μ l Lewis lung cancer cells suspension (1.5*105/ only, PBS buffer solution), and pass through intercostal space to mouse pleura Intracavitary injection tumor cell suspension.Successively suture muscle layer and epidermis with nylon wire, then with 75% alcohol disinfecting wound. Mouse revival is finally waited, and is put back in cage.
2, the pleural effusion of malignant pleural effusion mouse model measures fixed
After Establishment of mouse model 14 days, mouse is anaesthetized and put to death, mouse is fixed on dorsal position with adhesive tape, then with 75% wine Essence disinfection thorax abdomen, does a T-shape notch in ventrimeson, opens the visible pleural cavity of liver, inside there is sanguineous pleural effusion (Fig. 3). Using the syringe of 1mL range, minimum division value 0.01mL.Hand syringes, syringe needle punctures diaphragm, careful to draw thoracic cavity product Liquid empties bubble in syringe, reads by shown in syringe, records pleural effusion volume.
As a result as shown in Figure 3.As the result is shown: the pleural effusion amount of wild type MPE mouse model (n=10) be 0.61 ± The pleural effusion amount of 0.01mL (mean ± SEM), MYO9B gene knockout MPE mouse model (n=10) is 0.26 ± 0.05mL (mean±SEM).Compared with wild type MPE mouse, the pleural effusion amount of MYO9B gene knockout MPE mouse model is obviously less, Difference has statistical significance (P < 0.0001).Illustrate that malignant pleural effusion mouse can be significantly reduced in MYO9B gene delection Pleural effusion amount.
Sequence table
<110>Beijing Chaoyang Hospital Attached to Capital Medical Univ.
<120>target spot MYO9B relevant to malignant pleural effusion and its application
<160>5
<170>PatentIn version 3.5
<210>1
<211>20
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>1
tggctcgaag cactacgtgc 20
<210>2
<211>20
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>2
aggctggcag ctcgggccgt 20
<210>3
<211>20
<212>RNA
<213>artificial sequence (Artificial Sequence)
<400>3
uggcucgaag cacuacgugc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210>4
<211>100
<212>RNA
<213>artificial sequence (Artificial Sequence)
<400>4
aggcuggcag cucgggccgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60
cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100
<210>5
<211>100
<212>DNA
<213>artificial sequence (Artificial Sequence)
<400>5
ggaagtgaaa tcgcacggtg cagcggcggg cgaggctggt cgcttcgggg cggggcggcc 60
gggagcagcg ggcaggctgg ccggggaccg gtggcgcgca gcggccgagg tccagttaca 120
ggaggtgtgc acccgccggt gaggtatgct gaggccagga ggccggcagt atgagtgcgc 180
acgaggctgg cagctcgggc cgtcggcagc aggccaccta ccacctgcac atctacccgc 240
agctgtccag cgctgggagc cagacctcat gccgtgtgac cgccaccaag gacagcacaa 300
caagcgatgt catccaggat gtggtggcca gcctacacct ggatggctcg aagcactacg 360
tgctggtgga ggtgaaggag tcaggcgggg aggagtgggt gttggatgcc agcgactcac 420
ctgtacaccg agtgctactg tggcctcggc gagctcagga cgagcaccct caggaggatg 480
gctactactt cttgctgcag gaacgcaatg ctgatggcag tattcagtac ctgcccatac 540
agctgctggc tcagcctaca gctgcatgtc gcctggtaga gcgagggctg ttgccgaggc 600
ctcaagcaga ctttgatgac ctgtgcaacc tgccagagct gactgaagcc aacctgctgc 660
agaacctgaa gctgcgcttc atgcagcaaa agatctacac atacgcgggc agcatcctgg 720
tggccatcaa cccctttaag ttcctgccca tttacaaccc caagtatgtg aagatgtatg 780
agaaccaaca gctgggcaaa ctggagccac atgtgttcgc tctggccgat gtagcctact 840
acgccatgct gcgcaagcac gtgaaccagt gtatcgtcat ctctggtgag agtggctctg 900
gcaagacaca gagcaccaac ttcctcatcc actgcctcac agcgctcagc cagaagggct 960
atgccagtgg cgtcgaaagg accatcctgg gagcagggcc tgtgctggag gcttttggga 1020
atgccaagac agcccacaac aacaactcca gccgcttcgg gaagttcatc caagtcaact 1080
acctagaaaa tggcattgtg aggggagctg ttgtggaaaa ataccttctt gaaaagtctc 1140
gcctggtttc ccaggagaag gatgagcgga actaccatgt gttttattat ctgctgctgg 1200
gtgtcagtga ggaggagcgc ctggaatttc agctgaagca gcctcaagac tatttctacc 1260
tcaaccagca taacttgaat attgaagatg gagaagacct caaacatgac tttgaaaggc 1320
ttcagcaggc catggagatg gtgggcttcc tgcctgccac caagaagcag atcttctctg 1380
tcctctcagc catcctgtac cttggcaatg tcacctacaa gaagagagcc acaggccgag 1440
atgaaggcct ggaggtcggt cctccagagg tgttggacac cctctcccag ctcttaaagg 1500
taaagcggga gaccctggtg gaggtcttaa ccaagagaaa aacagttaca gtcaatgaca 1560
aactcatcct gccttacagc ctcagtgagg ccataactgc acgagactcc atggccaagt 1620
ccctatacag tgccctattt gactggattg tgctaaggat caaccacgcc ctcctcaaca 1680
agaaggacat ggaagaggct gtttcctgct tgtccattgg cgtcctggac atctttggat 1740
ttgaggactt cgaaaggaat agctttgagc agttttgcat caactatgcc aatgagcagt 1800
tgcagtacta cttcacccag cacatcttca agctggagca ggaggagtac cagggtgagg 1860
gcatctcgtg gcacaacatt gactacaccg acaacgtggg ctgtatccac ctcatcagca 1920
agaagcccac tggcctcttc tacctgctgg acgaggagag caacttccca catgccacaa 1980
gccacacttt gctggccaag ttcaagcagc agcatgagga caataagtac ttcctgggca 2040
caccagtcct ggagcccgcc ttcatcatcc agcacttcgc gggcagagtg aaataccaga 2100
tcaaggactt ccgggagaag aacatggact acatgcggcc tgacatcgtg gcactgctaa 2160
ggggcagtga cagctcctat gtgcgccagc tcattggcat ggacccggta gctgtgttcc 2220
gctgggctgt actacgagca gccatcaggg ccatggctgt gctgcgggag gctgggcgcc 2280
tgcgtgcaga gagagcggag aaggcagcag gtataagtag ccctgccact cgaagtcaca 2340
tggaagagct accaagagga gccagtaccc cttcagaaaa actgtaccgc gatttgcata 2400
accaaatcat caagagcctc aaaggactgc catggcaggg cgaggacccg aggaggcttc 2460
tccagtccct cagtctgttc cagaagcccc gcacctcctt cctgaagagt aaaggtatca 2520
aacaaaagca gatcattccc aagaacctgc tggactcgaa gtccctgagg ctcatcatca 2580
gcatgacact gcatgaccga actaccaagt cactgctgca cctgcacaaa aagaagaagc 2640
cacctagcat cagtgcacag ttccagacat ctcttaacaa gctgttggag gcactgggca 2700
aggccgagcc cttcttcatc cgctgcatcc gctccaatgc cgagaagaag gaactttgct 2760
ttgatgatga actggtgctg cagcaactgc gctacacagg catgctagag actgtgcgca 2820
tccgacgctc tggctacagc gccaagtaca ccttccagga cttcacggag cagttccagg 2880
tgttgctgcc caaggatgtc cagccctgta gggaggccat tgctgccctg ctggagaagc 2940
tgcaggtgga caggcagaac taccagattg gaaagacgaa ggtcttcctg aaggagacag 3000
agcgtcagac cctgcaggag aagctgcatg gtgaggtcct gcgtagaatc ctgcagctgc 3060
agagttggtt ccgtatggtg ctggaacgca agcactttgt acagatgaag catgctgcct 3120
tgaccatcca ggcctgctgg cggtcttacc gtgtgcgccg tgcactggaa aggacgcagg 3180
cagctgtgta cctgcaggct gcctggaggg gctacctgca gagacaggcc taccaccacc 3240
agaggcatag catcatccgc ctgcagagcc tctgccgtgg ccacctgcag cgcaggagct 3300
tcagccagat ggtgtcagag aagcagaagg cagagcaagc cagggaggca gcaggaggaa 3360
agctgtcaga gggtgagcct ggccccgtgg ccgctgggga gcagctatct gagcaccctg 3420
tggaagaccc tgagagcctg ggtgtggagg ctgaaacctg gatgaacaag tccccagacg 3480
gcatgtcacc taagaaggag acacccagcc cagagatgga gaccgcagcc caaaagacag 3540
tgccagctga aagtcatgag aaagtctcca gtagccgaga gaagcgagag tcacggcggc 3600
aacgagggtt ggagcatgtt gaacgacaga ataaacacat ccaatcctgc agggaggaga 3660
gcagcaccca ccgagaacct tccagaaggg caagcctgga aataggggaa agcttccctg 3720
agggcacaaa gggacccaga gaagatggac ttgaggcatg gactgagacc acagccccct 3780
ctagttcaaa gcaggcacag gttgtgggag acccacctgg gagtcccagt cccgtgcaga 3840
ggcccaccac cctggcccta gacagtaggg ttagcccaat gctccccagc agctccctgg 3900
aggttagccc agtgctcccc agcagctccc tggaatcccc caaagataag gacaaggatg 3960
agagcagcac caaggctcag gacaagcccg agagtcccag tggctccacc cagatccaac 4020
gataccaaca cccagacaca gagcggctgg ccactgctgt agagatatgg cgaggcaaga 4080
agcttgccag tgccgtgctg agccaatccc tggacctgag tgagaagcac cgggctacag 4140
gggcagccct gactcccaca gaggagaggc gcatctcttt ctccaccagt gacgtctcca 4200
agctgtcccc agtcaaggta cagacttcag ctgaaatcga tggggacttt agcagcaaga 4260
agccatccat ccataagaag aagtcaggag atccatccgc tggtcctgat gcaggcctgt 4320
ctccaggctc ccagggtgac tctaaatctg catttaagcg gctcttcctg cacaaagcca 4380
aggataagaa gcccagcctg gagggtgtag aggagacaga gagcaatgga gggcaggctg 4440
cacaggagac cccggccagg aagactctag acgtaccttc tagccagcag caccgccata 4500
ccacaggtga gaagccccta aaagggaaga agaaccgaaa tcgcaaagtt ggccagatca 4560
cagtgtccga gaagtggcga gagtcagtgt tccgtaagat cactaatgcc aatgagctca 4620
agtttctgga cgagttcctg ctcaacaagg tgaatgacct tcgctcacag aagacaccca 4680
tcgaaagctt gttcattgag gccactgagc gcttcaggag caacatcaag accatgtatt 4740
cggtgcctaa tgggaagatc catgtaggct acaaggacct gatggagaac taccagatcg 4800
ttgtcagtaa cctggctgcc gagcgtgggg agaaggacac caatctggtc ctcaatgtct 4860
tccagtcact gctggatgag ttcacccgca gctacaacaa gactgacttt gagcgggcca 4920
agcagagcaa agcccagaag aagaagcgga agcaggagcg tgctgtccag gaacacaatg 4980
gacatgtgtt tgccagctac caggtgaaca ttccacagtc atgtgagcag tgtctgtcct 5040
acatctggct catggacaag gctctactgt gcagtgtgtg caagatgacc tgccacaaga 5100
aatgcgtgca caagattcag agctattgct cctacactgg aaggaggaag agtgagctgg 5160
gtgccgaacc aggccacttc ggtgtgtgtg tagacagcct gaccagtgac aaggcctccg 5220
tgcccattgt gctggagaag cttctggaac acgtagagat gcatggcctg tacactgagg 5280
gcctttaccg caagtcagga gctgccaacc ggacacggga attacgccag gcactgcaga 5340
cagaccctgc tgcagttaag ctggaagact tccctatcca cgctatcacc ggggtcctga 5400
agcaatggct tcgtgagctg cctgagccac tcatgacttt tgcccagtat ggagatttcc 5460
tcagggctgt tgagcttcca gagaagcagg agcagctgtc tgccatctat gcagtcctgg 5520
accacctgcc agaagccaac cacacctccc tggagcgact catcttccac cttgtcaaag 5580
tggccctgct tgaagatgtg aaccgcatgt ctccgggagc tctagctatc atctttgcac 5640
cctgcctgct tcgctgccct gacaactccg accccctgac cagcatgaag gatgtactga 5700
agatcaccac gtgtgtggag atgctcatca aagaacagat gaggaagtac aagatgaaga 5760
tggaggaaat caaccacctg gaggctgctg agagcattgc attccgcagg ctctccctgt 5820
tgaggcagaa tgctccgtgg cctctcaaac tggggttttc atcaccctat gagggggtcc 5880
ggatcaaaag ccccaggacc ccagtggtcc aagacctgga gctgggggct ctccccgagg 5940
aggctgcagg tggcgacgag gaccgagaaa aggagattct catggagagg atccagtcca 6000
tcaaggaaga gaaggaggac atcacatatc gactgccgga gctggaccca cggggttctg 6060
atgaggagaa ccttgactca gagacatcgg ccagcactga gagcctgctg gaggagaggg 6120
gcgtgcgggg ggccgtggaa gggccccccg cacctgctct cccctgcccc atttcgccca 6180
ccctgagtcc cctccccgag gccgccgccc ctccacgagg aaggccgaca tccttcgtca 6240
cggtcagagt gaagacacct cggaggaccc ccatcatgcc catggccaat atcaagctcc 6300
ctccgggcct gcccttgcac ctgacaagct gggcacctgc tctccaggag gctgttgttc 6360
cagtgaagcg ccgagagcca cctgcccgca gacaggacca ggtacattcc gtatacatcg 6420
cccctggggc tgacctgcca tcacagagta cactgatagc cctggaccat gataccatac 6480
ttcctgggac caagcgcagg tattcggacc cccctaccta ctgcctgccc cccagctccg 6540
gccaggccaa tggctgagga ccatgactgg cagtctgcat ctcctaacat ccccgaactg 6600
gcatcccagc tgtggagctg gccttcactt tctgagaagg atctagaatg aaaagctccc 6660
aaagggatgc agtggccagc tctgtgtgtt gtggagactg ggagctgctg gccaggagcc 6720
atcagagccc caacctgcac agcagtggct cctttgtcct ttcagtaact gtttctcttt 6780
ttgtggttta cataactttt aagttcataa cagccttaat ggaggaccaa acttttgtat 6840
ttgtatgtct gaacttttat attaactctg cacccttgta acctggacat gggcagggca 6900
agcctgcaaa gtggacatgt gggctacaga tgactgctgc actcactgca tagtggtaga 6960
gagtgaactc acaggacgtc tgtccatctt gaatgcctcc cagcagtagt catctgccca 7020
gagaaccttc cagagattgc tggagctttc cacagctgaa ggcaggacag gagtgggaag 7080
tccctgagtg ccagggaagc ctgaatgtag cttacagctc tgcccactgt gcctgtgaaa 7140
tgcacggagc cagggacttg gaacctttag gaacaatcag tgcatccggt gacagcctgg 7200
gttctttaga ggctggctct cttctcaggc tctacccagt cctggagaca aggaagcccc 7260
acaggaggtg tgaaataaaa gtacttgaga agggtt 7296

Claims (10)

1. following 1) -5) any application in:
1) inhibit application of the substance of MYO9B protein active in the product of preparation treatment or adjuvant treatment malignant pleural effusion；
2) substance of MYO9B protein active is inhibited to reduce or reduce the product of Patients with Malignant Pleural Metastases pleural effusion amount in preparation In application；
3) inhibit or the substance of silencing MYO9B gene expression is in the product of preparation treatment or adjuvant treatment malignant pleural effusion Using；
4) inhibit or the substance of silencing MYO9B gene expression is in preparation reduction or reduction Patients with Malignant Pleural Metastases pleural effusion amount Product in application；
5) MYO9B albumen and its associated signal paths are being developed or are being designed treatment as target spot or assisting in the treatment of malignant pleural effusion Product in application.
2. application according to claim 1, it is characterised in that: the substance for inhibiting MYO9B protein active is to inhibit The synthesis of MYO9B albumen promotes MYO9B protein degradation or inhibits protein, polypeptide or the small molecule chemical combination of MYO9B protein function Object；
Or, the substance of the inhibition or silencing MYO9B gene expression is the substance or knockout MYO9B for interfering MYO9B gene expression The substance of gene or the substance for being mutated MYO9B gene.
3. application according to claim 2, it is characterised in that: the substance for knocking out MYO9B gene is CRISPR/Cas9 System；
Or, including two sgRNA in the CRISPR/Cas9 system, it is respectively designated as sgRNA1 and sgRNA2；
Or, the target sequence of the sgRNA1 identification is DNA molecular shown in the sequence 1 in sequence table；
Or, the target sequence of the sgRNA2 identification is DNA molecular shown in the sequence 2 in sequence table.
4. application according to claim 3, it is characterised in that: the sgRNA1 is RNA shown in sequence 3 points in sequence table Son；
Or, the sgRNA2 is RNA molecule shown in sequence 4 in sequence table.
5. a kind of product, active constituent is the substance of any inhibition MYO9B protein active or suppression in claim 1-4 System or the substance of silencing MYO9B gene expression；
The function of the product is to treat or assist in the treatment of malignant pleural effusion or reduction or reduction Patients with Malignant Pleural Metastases chest Chamber hydrops amount.
6. a kind of preparation method of transgenic mice includes the following steps: based on CRISPR/Cas9 system in mouse genome MYO9B gene edited, and then lose MYO9B gene function in the mouse genome to get base is turned described in Because of mouse.
7. according to the method described in claim 6, it is characterized by: in the CRISPR/Cas9 system include two sgRNA, It is respectively designated as sgRNA1 and sgRNA2；
Or, the target sequence of the sgRNA1 identification is DNA molecular shown in the sequence 1 in sequence table；
Or, the target sequence of the sgRNA2 identification is DNA molecular shown in the sequence 2 in sequence table；
Or, the sgRNA1 is RNA molecule shown in sequence 3 in sequence table；
Or, the sgRNA2 is RNA molecule shown in sequence 4 in sequence table.
8. according to the method described in claim 7, it is characterized by: the method includes using the sgRNA1, described The step of sgRNA2 and Cas9 mRNA；
Or, the mass ratio of the sgRNA1, the sgRNA2 and the Cas9 mRNA are (1-2): (1-2): 2；
Or, the mass ratio of the sgRNA1, the sgRNA2 and the Cas9 mRNA are 1:1:2.
9. preparing the product of any transgenic mice in claim 6-8 comprising any described in claim 6-8 SgRNA1, sgRNA2 and Cas9 mRNA.
10. following M1) or M2) or M3) described in application:
M1) transgenic mice that method as claimed in claim 6 to 8 is prepared is as studying malignant pleural product Application in liquid occurrence and development mechanism and/or the mouse model of prognosis；
M2 the transgenic mice or product as claimed in claim 9 that) method as claimed in claim 6 to 8 is prepared are being made The application being ready for use in the mouse model of research malignant pleural effusion occurrence and development mechanism and/or prognosis；
M3 the transgenic mice or product as claimed in claim 9 that) method as claimed in claim 6 to 8 is prepared are being made Application in the drug of standby and/or screening treatment or adjuvant treatment malignant pleural effusion.
CN201910634660.8A 2019-05-30 2019-07-15 Target MYO9B related to malignant pleural effusion and application thereof Active CN110283851B (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201910462541.9A CN110055285A (en) 2019-05-30 2019-05-30 Target spot MYO9B relevant to malignant pleural effusion and its application
CN2019104625419 2019-05-30

Publications (2)

Publication Number Publication Date
CN110283851A true CN110283851A (en) 2019-09-27
CN110283851B CN110283851B (en) 2021-12-28

Family

ID=67325174

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201910462541.9A Withdrawn CN110055285A (en) 2019-05-30 2019-05-30 Target spot MYO9B relevant to malignant pleural effusion and its application
CN201910634660.8A Active CN110283851B (en) 2019-05-30 2019-07-15 Target MYO9B related to malignant pleural effusion and application thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201910462541.9A Withdrawn CN110055285A (en) 2019-05-30 2019-05-30 Target spot MYO9B relevant to malignant pleural effusion and its application

Country Status (1)

Country Link
CN (2) CN110055285A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114931125A (en) * 2022-03-16 2022-08-23 江苏靶标生物医药研究所有限公司 Method for constructing mouse lung cancer pleural effusion model

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130310266A1 (en) * 2010-09-03 2013-11-21 Immport Therapeutics, Inc. Methods and Compositions For The Diagnosis And Treatment Of Cancer and Autoimmune Disorders
CN105331686A (en) * 2015-10-21 2016-02-17 中国科学院生物物理研究所 Myosin9b protein specific antibody preparation and application of Myosin9b gene family change to tumor diagnosis and prognosis
US20170114124A1 (en) * 2015-10-22 2017-04-27 Northwestern University SLIT-ROBO-Myo9-RHOA PATHWAY AND CANCER
CN107586852A (en) * 2017-11-06 2018-01-16 福建医科大学附属协和医院 Gastric cancer peritoneum branch prediction model and its application based on 22 genes
CN108893495A (en) * 2018-06-20 2018-11-27 山东大学深圳研究院 A kind of construction method of Pdzd7 gene mutant animals model

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130310266A1 (en) * 2010-09-03 2013-11-21 Immport Therapeutics, Inc. Methods and Compositions For The Diagnosis And Treatment Of Cancer and Autoimmune Disorders
CN105331686A (en) * 2015-10-21 2016-02-17 中国科学院生物物理研究所 Myosin9b protein specific antibody preparation and application of Myosin9b gene family change to tumor diagnosis and prognosis
US20170114124A1 (en) * 2015-10-22 2017-04-27 Northwestern University SLIT-ROBO-Myo9-RHOA PATHWAY AND CANCER
CN107586852A (en) * 2017-11-06 2018-01-16 福建医科大学附属协和医院 Gastric cancer peritoneum branch prediction model and its application based on 22 genes
CN108893495A (en) * 2018-06-20 2018-11-27 山东大学深圳研究院 A kind of construction method of Pdzd7 gene mutant animals model

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
MARTIN BAHLER ET AL.: "Cellular functions of class IX myosins in epithelia and immune cells", 《BIOCHEMICAL SOCIETY TRANSACTIONS》 *
RUIRUI KONG ET AL.: "Myo9b is a key player in SLIT/ROBO-mediated lung tumor suppression", 《THE JOURNAL OF CLINICAL INVESTIGATION》 *
ZHIJUN LIU ET AL.: "The motorized RhoGAP myosin IXb (Myo9b) in leukocytes regulates experimental autoimmune encephalomyelitis induction and recovery", 《JOURNAL OF NEUROIMMUNOLOGY》 *
莫安薇等: "康莱特注射液联合洛铂治疗非小细胞肺癌恶性胸腔积液的临床研究", 《现代药物与临床》 *
覃雪军等: "调节性T淋巴细胞在恶性胸腔积液发病机制中作用的研究进展", 《中国临床新医学》 *
赖宇等: "温阳消饮法对胸腔积液大鼠脏层胸膜基因表达影响的实验研究", 《时珍国医国药》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114931125A (en) * 2022-03-16 2022-08-23 江苏靶标生物医药研究所有限公司 Method for constructing mouse lung cancer pleural effusion model

Also Published As

Publication number Publication date
CN110283851B (en) 2021-12-28
CN110055285A (en) 2019-07-26

Similar Documents

Publication Publication Date Title
WO2018177351A1 (en) Method for preparing non-chimeric gene knockout animal based on crispr/cas9 technology
Hong et al. Generation of red fluorescent protein transgenic dogs
CN109943593B (en) Construction method and application of Mir3061 gene Rosa26 fixed-point knock-in heterozygote mouse model
KR20180091821A (en) How to manipulate humanized CAR T-cells and platelets by genetic complementarity
US9187764B2 (en) Controllable on-off method for fish reproduction
CN107815465A (en) The preparation method and application of humanization genetic modification animal model
WO1998001027A1 (en) In vivo electroporation method for early animal embryo
CN110283851A (en) Target spot MYO9B relevant to malignant pleural effusion and its application
CN108024522A (en) ETV2 and application thereof
Jin et al. Generation of PDE4 knockout mice by gene targeting
CN115992176A (en) Method for constructing model pig capable of inducing Cas9 protein expression through drugs
KR102270151B1 (en) Pig Knocked Out of the PKD2 Gene and the uses thereof
JP7379528B2 (en) Hemophilia B disease model rat
KR20180037449A (en) Brain tumor animal model and the Use thereof
CN107937439B (en) Application of gene and construction method of animal model
JP2011508600A (en) Method for producing transformed replicated dogs
KR100268713B1 (en) Transgenic mouse deficient in t-cells
WO2015163711A1 (en) Talen targeting myostatin gene and method for making animal with knockout myostatin gene using same
Mysliwiec et al. Generation of a conditional null allele of jumonji
CN113388639B (en) Method for breeding zebra fish vmhcEGFP-KI strain by gene knock-in
CN109090040B (en) A kind of Wnt10aflox/floxThe construction method of mouse model
CN114686438B (en) Construction method and application of ACE2 humanized pig
US20240130338A1 (en) Birds for producing female hatchling and methods of producing same
Hanaoka et al. Viable Chimeras between Embryonal Carcinoma Cells and Mouse Embryos: Comparison of Aggregation and Injection Methods: (teratocarcinoma/mouse embryo/chimera/aggregation/injection)
Li et al. Associated technologies for genome editing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant