CN110283820B - Interference RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression and application thereof - Google Patents
Interference RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression and application thereof Download PDFInfo
- Publication number
- CN110283820B CN110283820B CN201910356795.2A CN201910356795A CN110283820B CN 110283820 B CN110283820 B CN 110283820B CN 201910356795 A CN201910356795 A CN 201910356795A CN 110283820 B CN110283820 B CN 110283820B
- Authority
- CN
- China
- Prior art keywords
- oxidative damage
- granulosa
- inhibiting
- echinococcosis
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/10—Anthelmintics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to the technical field of biomedical engineering, in particular to an interfering RNA for inhibiting the expression of an echinococcus granulosus prototheca DNA oxidative damage repair gene and application thereof, and the target sequence of the interfering RNA for inhibiting the expression of the echinococcus granulosus prototheca DNA oxidative damage repair gene is forward CCGUGUUCGUAAGCAGCUUTT and reverse AAGCUGCUUACGAACACGGTT. The invention discloses a target sequence of interfering RNA for inhibiting the DNA oxidative damage repair gene expression of echinococcosis granulosa protocercaria for the first time, and also discloses application of the target sequence in preparation of echinococcosis granulosa medicine for the first time. The invention inhibits EgRPS9 gene expression by interfering RNA, and influences the repair effect of the DNA oxidative damage of the echinococcus granulosus protocorm to inhibit and kill the growth of the echinococcus granulosus protocorm, thereby effectively treating echinococcosis.
Description
Technical Field
The invention relates to the technical field of biomedical engineering, in particular to an interfering RNA for inhibiting the expression of an echinococcosis granulosa protohead segment DNA oxidative damage repair gene and application thereof.
Background
Echinococcosis granulosa (cystic echinococcosis, CE), also known as echinococcosis, is a serious zoo-zoo parasitic disease caused by the larvae of echinococcus granulosus residing in humans or host animals, one of the overlooked tropical diseases (Neglected Tropical Diseases, NTDs) by WHO is a global public health problem. Domestic dogs are the main infectious source and final host (echinococcosis), and when the domestic dogs discharge mature segments and a large number of eggs, grass lands, water sources, home environments or attached to the coat of the domestic dogs are polluted, and herbivores and humans are infected by feeding the eggs.
Echinococcosis granulosa is common in developed countries and regions of the animal industry, with the main epidemic countries being China, mongolia, turkish, tukuman, iraq, syrian, riba tender, argentina, brazil, chile in south America, australia, new Zealand in oceangoin, and some countries in North, east and south Africa. The method is mainly popular in pasture areas and semi-farming semi-pasture areas in northwest of China, wherein seven provinces (areas) such as Xinjiang, tibet, ningxia, gansu, qinghai, inner Mongolia and Sichuan are used as the most serious areas, the covered territorial area reaches 44%, the number of threatened people is about 6600 ten thousand, and the number of infected livestock is over 5000 ten thousand per year, and the direct economic loss caused by death of the livestock, waste of viscera and the like exceeds 30 hundred million yuan, so the method is one of the parasitic diseases which need to be controlled in important points in China.
The main treatment methods of echinococcosis granulosa include surgical treatment, drug treatment, immunoprophylaxis, radiotherapy and the like. At present, the clinical treatment is the first surgery to remove the inner sac and thoroughly remove the infected part of the viscera to achieve the treatment purpose. However, due to the complexity of the disease, complete excision of the outer capsule cannot be achieved, so that the outer capsule containing active echinococcosis granulosa protonodes still remains in the patient, and the postoperative recurrence rate is high, so that the method is only suitable for patients with small number of capsules and early echinococcosis granulosa, but has serious injury to the patients and high treatment cost, and the medicine treatment status is not substitutable for improving the quality of life of patients with recurrence, multiple and advanced diseases.
At present, only benzimidazole medicines are approved to be marketed for clinically treating echinococcosis granulosa, and clinical researches show that the medicines can prolong the life of patients and relieve clinical symptoms, but can not completely cure the patients. The medicines have the defects of poor intestinal absorption, low blood medicine concentration, low liver medicine concentration and the like, so that the effective medicine concentration acting on focus parts can not reach the due treatment concentration, and the treatment effect is weakened. Therefore, the development and research of novel efficient medicaments for treating echinococcosis granulosa are not very slow.
Echinococci granulosa grows in encapsulated form in the internal organs of humans and other intermediate hosts, and during its early developmental stages, both the metabolism of the encapsulation itself and the host and the immune response to infection cause rapid release of reactive oxygen species (reactive oxygen species, ROS) and excessive accumulation in the body, causing direct damage to proteins, membrane lipids and DNA when oxidative stress exceeds the body's antioxidant capacity, producing serious biological effects. DNA oxidative damage repair refers to a targeted reaction that the body can repair damaged DNA molecules through a self-repair mechanism when the DNA molecules are subjected to ROS attack to generate oxidative damage, and can restore the damaged DNA structure to be the same, and re-execute the original functions, so that the stability of genome and the integrity of genetic information are maintained.
Ribosomal protein S9 (ribosomal protein S, RPS 9) is a component of ribosomal small subunit 40S, encoded by the RPS9 gene, belongs to the ribosomal protein S4p family, and is widely distributed in various organisms such as yeast, bacteria, parasites, mammals and humans. Studies have shown that the RPS9 gene is a highly conserved gene, and may have DNA damage repair, self-translational regulation, developmental regulation, and malignant transformation of normal cells, as well as other functions not yet found. The research shows that RPS9 participates in the P53 pathway to regulate proliferation, differentiation, apoptosis and the like of cells, and silencing RPS9 can induce various cell reactions, so that the growth of cancer cells after being activated can be inhibited, and the RPS9 knockout also can activate the P53 pathway to cause a series of biological processes of aging, differentiation, apoptosis and the like of tumor cells, thereby providing a new thought for the design of antitumor drugs. At the same time, RPS9 was found to be involved in apoptosis, and RPS9 was thought to have a protective effect in oxidative damage of nerve cells. RPS9 interacts with the nucleophosmin B23/NPM binding protein and has a certain effect on normal cell proliferation. RPS9 is also involved in mRNA translation and, after changing its C-terminus, the expression of many genes in the ribosome is significantly altered.
As with any other aerobic organism, the parasite inevitably has the problem of oxygen stress in the parasitic process of the host body, the parasite itself reduces oxygen into water through the breathing process under the aerobic condition, ROS can be generated when the oxygen is incompletely reduced, and researches show that the echinococcosis granulosa protohead can metabolize H under the in vitro culture condition 2 O 2 Meanwhile, eosinophils, neutrophils and macrophages of the host can generate ROS, and the parasite cells and even the whole worm body can be destroyed. Electroporation method is adopted to transfect EgRPS9-siRNA into echinococcosis granulosa protocorm, specifically interfere the expression of EgRPS9 gene, and then H is adopted 2 O 2 And (3) intervening to construct an oxidative damage model, so as to study the repairing effect of EgRPS9 genes on the oxidative damage of echinococcosis granulosa protocorm DNA.
Disclosure of Invention
The invention provides an interfering RNA for inhibiting the expression of an echinococcosis granulosa protonode DNA oxidative damage repair gene and application thereof, and overcomes the defects of the prior art, and the interfering RNA can inhibit and kill the growth of the echinococcosis granulosa protonode by inhibiting EgRPS9 gene expression to influence the repair effect of the echinococcosis granulosa protonode DNA oxidative damage, thereby effectively treating echinococcosis granulosa.
One of the technical schemes of the invention is realized by the following measures: an interfering RNA for inhibiting the expression of the echinococcosis granulosa protocorm DNA oxidative damage repair gene has the target sequences of forward CCGUGUUCGUAAGCAGCUUTT and reverse AAGCUGCUUACGAACACGGTT.
The second technical scheme of the invention is realized by the following measures: application of interfering RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression in preparation of medicine for treating echinococcosis granulosa.
The third technical scheme of the invention is realized by the following measures: application of interfering RNA for inhibiting echinococci granulosa protonode DNA oxidative damage repair gene expression in preparation of drugs for inhibiting echinococci granulosa protonode DNA oxidative damage repair.
The fourth technical scheme of the invention is realized by the following measures: application of interfering RNA for inhibiting echinococcosis granulosa protoknot DNA oxidative damage repair gene expression in preparation of medicines for inhibiting echinococcosis granulosa protoknot RPS9 gene expression is provided.
The invention discloses a target sequence of interfering RNA for inhibiting the DNA oxidative damage repair gene expression of echinococcosis granulosa protocercaria for the first time, and also discloses application of the target sequence in preparation of echinococcosis granulosa medicine for the first time. The invention inhibits EgRPS9 gene expression by interfering RNA, and influences the repair effect of the DNA oxidative damage of the echinococcus granulosus protocorm to inhibit and kill the growth of the echinococcus granulosus protocorm, thereby effectively treating echinococcosis.
Drawings
FIG. 1 is a graph showing the transfection efficiency of EgRPS9-siRNA electroporation in the present invention.
FIG. 2 shows the in vitro tolerance H of echinococcosis prototheca in the invention 2 O 2 A determination map of the maximum concentration of the intervention.
FIG. 3 is a graph showing the activity change of echinococcus granulosus after interfering EgRPS9 gene expression in the present invention.
FIG. 4 is a photograph showing an oxidative damage single-cell gel electrophoresis of echinococcosis granulosa protonode DNA according to the present invention.
Detailed Description
The present invention is not limited by the following examples, and specific embodiments can be determined according to the technical scheme and practical situations of the present invention. The various chemical reagents and chemical supplies mentioned in the invention are all commonly known and used in the prior art unless specified otherwise; the percentages in the invention are mass percentages unless specified otherwise; the solutions in the invention are aqueous solutions in which the solvent is water unless otherwise specified, for example, the hydrochloric acid solution is hydrochloric acid aqueous solution; the room temperature and the room temperature in the present invention generally refer to temperatures ranging from 15 ℃ to 25 ℃, and are generally defined as 25 ℃.
The invention is further described below with reference to examples:
example 1: the target sequence of the interfering RNA for inhibiting the expression of the echinococcosis granulosa protohead DNA oxidative damage repair gene is forward CCGUGUUCGUAAGCAGCUUTT and reverse AAGCUGCUUACGAACACGGTT.
The interfering RNA (siRNA for short) for inhibiting the DNA oxidative damage repair gene expression of the echinococcus granulosus protonode can specifically target the RPS9 gene of the echinococcus granulosus, specifically down regulate the expression of the RPS9 gene of the echinococcus granulosus, and the interfering RNA sequence transfects the echinococcus granulosus protonode so as to influence the repair effect of the DNA oxidative damage of the echinococcus granulosus protonode and reduce the activity of the echinococcus granulosus protonode, thereby realizing the inhibition and killing of the growth of the echinococcus granulosus protonode, and further effectively treating the echinococcosis granulosus.
Example 2: the application of the interfering RNA for inhibiting the expression of the echinococcosis granulosa protohead DNA oxidative damage repair gene in preparing the medicine for treating the echinococcosis granulosa is provided.
Example 3: the application of the interfering RNA for inhibiting the expression of the echinococcus granulosus protonode DNA oxidative damage repair gene in preparing the medicine for inhibiting the echinococcus granulosus protonode DNA oxidative damage repair.
Example 4: the application of the interfering RNA for inhibiting the expression of the echinococcosis granulosa protoknot DNA oxidative damage repair gene in preparing the medicine for inhibiting the expression of the echinococcosis granulosa protoknot RPS9 gene is provided.
The invention can realize that the interfering RNA directly enters focus as the active pharmaceutical ingredient to prevent and treat echinococcosis granulosa. According to the actual use requirement, the virus vector or plasmid vector containing the interfering RNA sequence is taken as an active ingredient, the vector is subjected to enzyme digestion, then the interfering RNA is connected with the digested vector to obtain a connection product, and the connection product is transformed into competent cells to screen out positive clones.
The invention relates to application of interfering RNA for inhibiting the expression of echinococcosis granulosa protoknot DNA oxidative damage repair genes in preparation of drugs for treating echinococcosis, and in particular relates to application in clinic, the interfering RNA is generally injected in an operation process, enters the echinococcosis through a soaking or transfection mode, so that the growth process of the echinococcosis is eliminated. When the echinococci granulosa protonode is transfected with the interfering RNA, removal is carried out by electroporation transfection methods known to those skilled in the art, for example by an electroporator.
In order to demonstrate the effect of the invention in inhibiting the interference RNA expressed by the echinococcus granulosus protoknot DNA oxidative damage repair gene, an experiment for killing the echinococcus granulosus protoknot in vitro is carried out, and the specific experimental process is as follows:
experiment 1: collecting and culturing echinococcosis granulosa protohead
The echinococcosis granulosa protocorm is obtained from sheep liver cysts infected by the echinococcosis in a Hua Ling slaughterhouse of the Uluhazium in Xinjiang, the cyst liquid in the cysts is extracted under the aseptic condition, the protocorm is separated, and after being digested by 1% pepsin for 30min, the protocorm is washed 5 times by using the aseptic normal saline added with 1% penicillin and streptomycin, the protocorm with the detection activity of more than 98% by a 1% eosin staining method can be used for a test, and a culture system is RPMI1640: fetal bovine serum: green streptomycin=89:10:1, 5% co at 37 ℃ 2 Culturing in a constant temperature incubator.
Experiment 2: design and Synthesis of RNA interference sequences
Synthesis and identification of EgRPS9-siRNA effective sequence: according to EgRPS9 gene sequence (GeneBank: AGY 97023), the sequence of EgRPS9-siRNA is designed, and the EgRPS9-siRNA of small molecule is synthesized by Shanghai Ji Ma pharmaceutical technology Co., ltd, and the siRNA (small molecule interference RNA) molecule (green fluorescent modification) used in the invention is obtained by screening, the target sequence is (base pairing of siRNA sense strand and antisense strand with target sequence): forward CCGUGUUCGUAAGCAGCUUTT, reverse AAGCUGCUUACGAACACGGTT, negative control interference sequences were also provided synthetically by the company.
Experiment 3: egRPS9-siRNA transfection method by echinococcus granulosus original head electricity-saving perforation method
Experimental grouping: egRPS9-siRNA interference group, negative control group (non-specific siRNA) and blank control group (no siRNA transfection).
The experimental method comprises the following steps: a transfection system of 100. Mu.L was set, stock echinococci granulosa cultured in vitro in the laboratory for 2d was washed 3 times with phosphate buffer (pH 7.4), and approximately 2000 stock echinococci were added to the above group of electrotransfer buffers in a final siRNA interference sequence concentration of 5. Mu.M in a cuvette. Electroporation parameters were set using a Bio-Rad Micropulser electroporation apparatus: square wave, 125v,20ms,4mm electric shock cup, pulse 1 time, respectively, the echinococcus granulosus protohead segments were transfected. After electroporation, the cuvette was quickly placed in a 37℃incubator for 10min and transferred to a 24-well plate with 1mL of normal medium for 3d.
After 1h of transfection, about 250 echinococci granulosa protosegments were collected per group, the post-smear was washed 3 times with phosphate buffer (pH 7.4), the green fluorescence intensity (fluorescence intensity is proportional to transfection efficiency) in each protosegment group was observed under an inverted fluorescence microscope, and fluorescence images were collected.
Experiment 4: echinococcosis granulosa protohead segment in vitro tolerance H 2 O 2 Determination of the maximum concentration of intervention
The echinococcosis granulosa protonodes were added to 96-well cell culture plates at a density of 250 per well, with 3 duplicate wells per group. Adding H to the culture Medium 2 O 2 The final concentration is 0.2, 0.4, 0.6, 0.8, 1.0 and 2.0mM, the echinococcosis granulosa protocorm is collected after 1H of intervention, 1% eosin dye solution is dyed for 5min, smear is carried out and images are collected (living: refusal dyeing; dead: red) to determine the external tolerance H of the echinococcosis granulosa protocorm 2 O 2 Maximum concentration of intervention.
Experiment 5: effect of EgRPS9-siRNA on echinococcosis granulosa protonode Activity
1) Survival rate detection
3d after transfection, add echinococci granulosa protojoint tolerance H in natural state 2 O 2 Maximum concentration of intervention was treated for 1h, each group of echinococci granulosa protonodes was treated with 1% eosin respectivelyAfter 5min of staining with dye solution, smear, count, observe activity under an inverted fluorescence microscope and calculate survival rate.
2) Alkaline phosphatase Activity assay
After 3d of electrotransfection, echinococcosis granulosa protohead segment tolerance H in natural state is added 2 O 2 The maximum concentration of the intervention was treated for 1h, the culture supernatant of each group of echinococcosis granulosa protonodes was collected, standard wells, control wells and sample wells were set in 96-well plates, the amounts of standard were 4, 8, 16, 24, 32, 40 μl, respectively, and samples were added to a total volume of 50 μl, as indicated in table 1. After incubation at 37℃for 10min, 100. Mu.L of reaction termination solution was added to each well to terminate the reaction, and absorbance was measured with an ELISA reader (A 405 Value), alkaline phosphatase activity was calculated.
Experiment 6: changes in EgRPS9-mRNA expression levels following EgRPS9-siRNA interference
1) Total RNA extraction and cDNA Synthesis
After 3d of electrotransfection, the native prohead is added to tolerate H 2 O 2 After 1h of treatment of the maximum tolerance concentration of (C), the liquid nitrogen is frozen quickly, the total RNA is extracted by a TRIzol method, and the concentration of the total RNA is measured by a nucleic acid quantitative instrument. Reverse transcription Using PrimeScript from Takara Corp TM The RT Reagent Kit is incubated for 15min at 37 ℃ in a prepared reaction system PCR instrument, heated for 5s at 85 ℃ to terminate the reaction, and taken out and stored at-20 ℃ for later use.
2) Real-time fluorescence quantitative PCR (qRT-PCR)
qRT-PCR is carried out by taking the synthesized cDNA of the reverse transcription as a template, the expression of EgRPS9-mRNA is detected, beta-actin is taken as an internal reference, and the upstream and downstream primers of EgRPS9 gene are F: AGAAGAGTGGCGATGGCGATGA, R: CCGTGTGATGGGTAGGCGAAGA. The reaction procedure is: 95 ℃ for 30s; the total circulation is 40 cycles of 5s at 95 ℃ and 30s at 60 ℃;72 ℃ for 10min; cooling to 65 ℃ from 95 ℃ at a speed of 20.0 ℃/s; after incubation at 65℃for 15s, the temperature was raised to 95℃at a rate of 20.0℃per second for dissolution profile analysis.
Experiment 7: single cell gel electrophoresis test for detecting DNA damage condition of echinococcus granulosus protohead segment after EgRPS9 gene expression interference
After 3d of electric rotation, adding the tolerance H of the original head joint in a natural state 2 O 2 The maximum tolerance concentration of (2) is treated for 1h, the culture solution is sucked off, the PBS buffer solution is precooled for 1 time, and the insect bodies are collected. And (3) re-suspending the centrifugally precipitated original head section by using low-melting-point agarose by adopting a double-layer gel spreading method, spreading the original head section on a first layer of gel plate, immersing the gel plate into a newly-prepared cell lysate for 4.5 hours after solidification, taking out the gel plate, flushing the gel plate for 2 times by using PBS, immersing the gel plate into the newly-prepared alkaline electrophoresis buffer solution for alkaline hydrolysis for 20min, and carrying out 25V electrophoresis for 30min. After electrophoresis, the gel plate was placed in Tris-HCl (pH 7.5) and neutralized for 15min, PI dye solution was dyed for 15min in the dark, ultra pure water was decolorized for 5min, and the image was observed and collected under an inverted fluorescent microscope, and OTM value (OTM value was proportional to the degree of DNA damage) was determined with CASP software.
Experiment 8: detection of Reactive Oxygen Species (ROS) content in echinococcosis granulosa protonuda after interference of EgRPS9 gene
After 3d of electric rotation, adding the tolerance H of the original head joint in a natural state 2 O 2 The proto-head was collected into 1.5mL EP tubes and washed 1-pass with serum-free RPMI1640 medium for 1h. The fluorescent dye DCFH-DA in the ROS detection kit is diluted by a serum-free RPMI1640 culture medium in a ratio of 1:500, 40 mu L of each EP tube is added, water bath is carried out for 30min at 37 ℃, the mixture is washed for 3 times by the serum-free RPMI1640 culture medium, 200 mu L of the serum-free RPMI1640 culture medium is added, the mixture is transferred to a black 96-well plate for detection, and the fluorescence intensity is detected by a full-wave scanning type multifunctional enzyme-labeled instrument. The detection conditions are as follows: excitation wavelength is 485nm, detection wavelength is 525nm.
The experimental results are as follows
Evaluation of transfection effect: the transfected echinococcosis granulosa protonodes were observed by an inverted fluorescence microscope, and the results are shown in FIG. 1 (A, B: egRPS9-siRNA interference group; C, D: negative control group; E, F: blank control group). The EgRPS9-siRNA interference group and the negative control group in FIG. 1 showed bright green fluorescent spots (i.e., gray spots shown in FIG. 1) in echinococcosis granulosa prototubers; and the blank control group has no green fluorescent spots in the echinococci granulosa protohead. FIG. 1 illustrates that the green fluorescent interference sequence can be successfully introduced into the echinococcosis granulosa protojoint by an electroporation apparatus by using the transfection parameters and the transfection system, and the transfection effect is better.
Echinococcosis granulosa protohead segment in vitroTolerance H 2 O 2 Maximum concentration of intervention: different concentrations of H 2 O 2 In vitro intervention of echinococcosis granulosa protocorm in natural state for 1H, protocorm activity was detected by 1% eosin exclusion assay, and the results are shown in FIG. 2 (A: 0.2mM; B:0.4mM; C:0.6mM; D:0.8mM; E:1.0mM; F:2.0 mM), FIG. 2 shows protocorm at 0.2, 0.4mM H 2 O 2 The final concentration is not colored after dry, indicating good activity; at 0.6mM H 2 O 2 Part started to color after the final concentration was intervened, with H 2 O 2 The final concentration of the intervention is increased, and the coloring rate is increased; at 2.0mM H 2 O 2 The final concentration was totally colored after the dry and indicated total death of the echinococci granulosa proto-node. FIG. 2 illustrates H 2 O 2 Induce DNA oxidative damage of echinococcosis granulosa protohead segment, H 2 O 2 The final concentration of intervention gradually increases, and its own reparative action begins to be unable to completely resist H 2 O 2 And the DNA is damaged by oxidation. Thus determining in vitro tolerance H of echinococcosis granulosa protohead 2 O 2 The maximum concentration of intervention was 0.4mM and the intervention time was 1h.
Detection result of activity of echinococcosis granulosa protohead after specific interference EgRPS9 gene expression
1) Results of eosin refusal staining test for detecting survival rate of echinococcosis granulosa protohead
The survival rate of the EgRPS9-siRNA interference group echinococcosis granulosa protohead is (26.59 +/-2.76)%, compared with the negative control group [ (92.97 +/-1.87)%]And blank [ (95.31.+ -. 1.46).%)]The difference is statistically significant (χ) 2 = 14.618, 15.973, P < 0.01), the result is as shown in fig. 3 (a: egRPS9-siRNA interference group; b: a negative control group; c: blank control group), FIG. 3 illustrates the ratio of proto-head segment to H after interfering EgRPS9 gene expression 2 O 2 The EgRPS9 gene is important for growth survival of the prototheca and parasitism in the host (Eg is called Latin chemical name of Echinococcus granulosus).
2) Alkaline phosphatase Activity assay results
The linear equation of the alkaline phosphatase standard working solution drawn by the enzyme labeling method is as follows: y= 0.1585X-0.0524, r 2 =0.9989 (n=5), the linear relationship is good. Group A 405 The values are brought into a linear equation, and the activity of alkaline phosphatase in the original head section of the EgRPS9-siRNA interference group is 0.008+/-0.001, and compared with a negative control group (0.094+/-0.001) and a blank control group (0.098+/-0.001), the difference has statistical significance (t=9.257 and 9.946, and P is less than 0.01), so that the EgRPS9 gene of the original head section has larger influence on the activity after being interfered.
Interference of EgRPS9 Gene expression changes in EgRPS9-mRNA expression levels in echinococci granulosa protocorm
qRT-PCR detects the change of EgRPS9-mRNA expression level of each group, the EgRPS9-siRNA interference group EgRPS9-mRNA expression level is 0.223+/-0.060, and compared with a negative control group (1.001+/-0.013) and a blank control group (1.001+/-0.009), the EgRPS9-mRNA expression level is significantly reduced (t=8.026, 7.939, and P is less than 0.01).
Interference of changes in the degree of oxidative damage to echinococcosis granulosa protocercaria DNA after EgRPS9 Gene expression
The single cell gel electrophoresis image of each group of DNA oxidative damage is shown in figure 4 (A: blank control group; B: negative control group; C: egRPS9-siRNA interference group), under the same electrophoresis condition, the EgRPS9-siRNA interference group echinococcosis granulosa original head segment DNA fragments leave the nucleus to migrate to the anode to form tailing; the cell nucleus of the echinococcosis granulosa protonode of the negative control group and the blank control group is compact in structure, and no tailing phenomenon exists. The comet tail distance OTM value of the EgRPS9-siRNA interference group is 14.357 ±2.005, and the difference is statistically significant (t= 12.959, 13.285, P < 0.01) compared with the negative control group (0.087±0.031) and the blank control group (0.065±0.028). FIG. 4 illustrates that interfering with EgRPS9 gene expression results in more severe DNA oxidative damage to the proto-head, i.e., egRPS9 gene fails to exert its function of repairing DNA oxidative damage.
Detection of ROS content in echinococcosis granulosa protonema after interference EgRPS9 gene expression
After interference by the EgRPS9-siRNA sequence, the ROS content in the echinococcosis granulosa protocephalum was 14.105 + -0.247, and the difference was statistically significant (t= 10.003, 10.978, P < 0.01) compared with the negative control group (2.633 + -0.059) and the blank control group (2.396 + -0.021). The EgRPS9-siRNA interference group has more serious oxidation injury degree of the original head node than the other two groups, so that the DNA oxidation injury degree is aggravated after the EgRPS9 gene expression is interfered.
Therefore, in view of the above results, we can see that the invention designs an interference sequence aiming at EgRPS9 target genes, adopts electroporation transfection technology, specifically down regulates a set of antioxidant enzyme systems including superoxide enzyme, catalase and the like in the echinococcosis granulosa protoknot of EgRPS9 expression, can remove ROS continuously generated in the metabolic process, and ensures that ROS in a body is in a relatively stable level. By H 2 O 2 Oxidative damage to echinococci granulosa protonode DNA is induced, and a series of peroxidation reactions are initiated to cause the echinococci granulosa protonode DNA to be damaged, and an increase in ROS content is a key element in the peroxidation reaction. After EgRPS9-siRNA is applied, the effect of EgRPS9 gene in repairing the DNA oxidative damage of echinococcosis granulosa protocorm, the activity of protocorm is reduced, the degree of DNA oxidative damage of protocorm is increased, and based on the experimental result, the interference RNA can be found to successfully inhibit EgRPS9 gene expression and inhibit the effect of EgRPS9 gene.
In conclusion, the invention discloses a target sequence of interfering RNA for inhibiting the expression of echinococcosis granulosa protohead DNA oxidative damage repair genes for the first time, and also discloses application of the target sequence in preparation of echinococcosis granulosa medicaments for the first time. The invention inhibits EgRPS9 gene expression by interfering RNA, and influences the repair effect of the DNA oxidative damage of the echinococcus granulosus protocorm to inhibit and kill the growth of the echinococcus granulosus protocorm, thereby effectively treating echinococcosis.
The technical characteristics form the embodiment of the invention, have stronger adaptability and implementation effect, and can increase or decrease unnecessary technical characteristics according to actual needs so as to meet the requirements of different situations.
TABLE 1
| Blank control | Standard substance | Sample of | |
| Detection buffer solution | 50μL | (100-X)μL | (50-Y)μL |
| Chromogenic substrate | 50μL | - | 50μL |
| Sample of | - | - | YμL |
| Working solution for standard product | - | XμL | - |
Claims (4)
1. An interfering RNA for inhibiting the expression of echinococcosis granulosa protojoint DNA oxidative damage repair genes is characterized in that the target sequence of the interfering RNA is forward CCGUGUUCGUAAGCAGCUUTT and reverse AAGCUGCUUACGAACACGGTT.
2. Use of an interfering RNA according to claim 1 that inhibits the expression of echinococcosis granulosa protoknob DNA oxidative damage repair genes in the preparation of a medicament for the treatment of echinococcosis granulosa.
3. Use of an interfering RNA that inhibits the expression of an echinococcus granulosus protonode DNA oxidative damage repair gene according to claim 1 in the preparation of a medicament for the treatment of inhibiting echinococcus granulosus protonode DNA oxidative damage repair.
4. Use of an interfering RNA that inhibits the expression of echinococci granulosa protonode DNA oxidative damage repair genes according to claim 1 in the preparation of a medicament for the treatment of inhibiting echinococci granulosa protonode RPS9 gene expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910356795.2A CN110283820B (en) | 2019-04-29 | 2019-04-29 | Interference RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910356795.2A CN110283820B (en) | 2019-04-29 | 2019-04-29 | Interference RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110283820A CN110283820A (en) | 2019-09-27 |
| CN110283820B true CN110283820B (en) | 2023-07-28 |
Family
ID=68001550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910356795.2A Active CN110283820B (en) | 2019-04-29 | 2019-04-29 | Interference RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110283820B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111714638A (en) * | 2020-06-23 | 2020-09-29 | 新疆医科大学第一附属医院 | Composition of DNA damage causing compound and DNA damage repair inhibitor and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007072977A1 (en) * | 2005-12-20 | 2007-06-28 | Locomogene, Inc. | Pharmaceutical composition for allergic disease |
| CN104357445A (en) * | 2014-10-23 | 2015-02-18 | 吕海龙 | Interfering RNA for inhibiting and treating echinococcus granulosus disease and application thereof |
| RU2609858C1 (en) * | 2016-04-22 | 2017-02-06 | ФАНО России Федеральное государственное бюджетное научное учреждение Всероссийский научно-исследовательский институт фундаментальной и прикладной паразитологии животных и растений им. К.И. Скрябина (ФГБНУ "ВНИИП им. К.И. Скрябина") | Method for prevention of larval stage of echinococcosis alveolaris |
| CN106754930A (en) * | 2017-01-16 | 2017-05-31 | 中国农业科学院兰州兽医研究所 | The Serum miRNA biomarker of hydatidosis detection and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2000160A3 (en) * | 2002-10-30 | 2009-03-11 | Gambro Lundia AB | Method and apparatuses for determining the efficiency of dialysis |
-
2019
- 2019-04-29 CN CN201910356795.2A patent/CN110283820B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007072977A1 (en) * | 2005-12-20 | 2007-06-28 | Locomogene, Inc. | Pharmaceutical composition for allergic disease |
| CN104357445A (en) * | 2014-10-23 | 2015-02-18 | 吕海龙 | Interfering RNA for inhibiting and treating echinococcus granulosus disease and application thereof |
| RU2609858C1 (en) * | 2016-04-22 | 2017-02-06 | ФАНО России Федеральное государственное бюджетное научное учреждение Всероссийский научно-исследовательский институт фундаментальной и прикладной паразитологии животных и растений им. К.И. Скрябина (ФГБНУ "ВНИИП им. К.И. Скрябина") | Method for prevention of larval stage of echinococcosis alveolaris |
| CN106754930A (en) * | 2017-01-16 | 2017-05-31 | 中国农业科学院兰州兽医研究所 | The Serum miRNA biomarker of hydatidosis detection and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110283820A (en) | 2019-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110283820B (en) | Interference RNA for inhibiting echinococcosis granulosa protohead DNA oxidative damage repair gene expression and application thereof | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN108277279A (en) | A kind of application of lncRNA in diagnosing and/or treating breast cancer | |
| CN107604058A (en) | The application of the nucleotide analogs of piRNA 514 and its GEM 132 and apply its product | |
| CN104083761A (en) | Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis | |
| CN107982536A (en) | A kind of composition of drug target and application | |
| CN104561000B (en) | Inhibit nucleic acid oligomer and its application of CD44 genes | |
| WO2024045251A1 (en) | Small interfering rna for treating neovascular retinal diseases and dna tetrahedral complex thereof | |
| CN110684841A (en) | Application of let-7b and rSjp40 in preparation of medicine for preventing or treating schistosome infection liver fibrosis | |
| CN109045001A (en) | P300 activator CTPB and its derivative are in the purposes for improving collagen Col17A1 expression | |
| CN107858351A (en) | A kind of applications of double-strand siRNA in the medicine for preparing malignant tumour | |
| CN109223817B (en) | Antagonist of micro non-coding RNA and application thereof | |
| CN115317619A (en) | Nucleic acid nano drug carrier and application thereof | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| Wu et al. | Extracellular vesicles derived from Pinctada martensii mucus regulate skin inflammation via the NF-κB/NLRP3/MAPK pathway | |
| CN111568915A (en) | Application of miRNA-182, miRNA-188 and miRNA-199a inhibitors | |
| CN110946823A (en) | Recombinant human interferon α 2a suppository and preparation method thereof | |
| CN114588264B (en) | Application of reagent for knocking down or inhibiting EGR3 in preparation of myocardial ischemia reperfusion injury drugs | |
| CN111979239B (en) | siRNA for schistosoma japonicum insect and egg reduction and application thereof | |
| CN113546176B (en) | Synthesis method of drug specifically used for inhibiting intraocular angiogenesis | |
| KR102580940B1 (en) | Extraction Method of high purity Poly Deoxy Ribo Nucleotide from meats of Salmonid fish | |
| CN111321145B (en) | SiRNA of schistosoma japonicum PHB1 and PHB2 genes and application thereof | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN108795935B (en) | SiRNA of SjELAV-like 1 gene of schistosoma japonicum and application thereof | |
| CN106478794A (en) | A kind of artemia masculinizing factor and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |