CN104083761A - Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis - Google Patents
Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis Download PDFInfo
- Publication number
- CN104083761A CN104083761A CN201410290697.0A CN201410290697A CN104083761A CN 104083761 A CN104083761 A CN 104083761A CN 201410290697 A CN201410290697 A CN 201410290697A CN 104083761 A CN104083761 A CN 104083761A
- Authority
- CN
- China
- Prior art keywords
- microrna
- cartilage
- inhibitor
- pharmaceutical composition
- osteoarthritis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses an application of a microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis, and belongs to the field of biomedicine. In an osteoarthritis animal model, the articular cartilage injury is exacerbated when a microRNA-101 analog is injected into the knuckle articular cavity, and the expression levels of extracellular matrix II type collagen and proteoglycan causing cartilage specificity are reduced; while the cartilage injury of the analog can be remarkably improved by injecting the microRNA-101 inhibitor into the knuckle articular cavity, the cartilage injury process of the osteoarthritis animal model can be retarded, and a role of protecting cartilage can be played, so that degradation of cartilage tissues can be retarded by inhibiting expression of the microRNA-101, namely through the microRNA-101 inhibitor, and the effect of stabilizing the cartilage cell phenotype can be achieved, so that articular cartilage injury can be controlled, and cartilage repairing can be promoted. Therefore, the microRNA-101 inhibitor can be used for preparing medicaments for controlling osteoarticular injury and promoting cartilage repairing.
Description
Technical field
The present invention relates to biomedical sector, the particularly application of a kind of microRNA-101 inhibitor in the medicine of preparation prevention or treatment osteoarthritis.
Background technology
MicroRNA (being called for short miRNA) is a class endogenous non-coding single stranded RNA, and length is 21-25 nucleotide, on evolving, has high conservative, timing and tissue specificity, is almost present in all multicellular organisms.Up to the present, the data base miRBase that includes specially miRNA sequence has been contained the 8000 kinds of miRNA that surpass that comprise plant, animal and virus, wherein, has 800 mankind miRNA of surpassing to be present in miRBase data base.MiRNA is regulating the gene of one of trichotomy by inference, participates in the many pathological processes of body.MiRNA Main Function directly causes the degraded of target gene mRNA or suppresses the translation of target gene mRNA in the 3' untranslated region of target gene.
MiRNA can participate in regulating cell function, has important effect in the regulation process of human diseases.At present preliminary study damage relevant miRNA to cartilage of osteoarthritis.Miyaki report, in the post-stimulatory human chondrocytes of interleukin (hereinafter to be referred as IL-1 β), the expression of miRNA-140 declines, cross and express miRNA-140 and can suppress the rise that the cartilage cell epimatrix digestive enzyme that caused by IL-1 β is expressed, make the decline that the cartilage cell epimatrix gene protein polysaccharide that caused by IL-1 β expresses (referring to Miyaki S etc., MicroRNA-140is expressed in differentiated human articular chondrocytes and modulates interleukin-1responses.Arthritis and rheumatism2009, 60 (9): 2723-2730).In the post-stimulatory chondrocyte of IL-1 β, miRNA-34a obtains high expressed, suppress can to offset after the expression of miRNA-34a the decline that Col2a1 albumen that IL-1 β causes and inducible nitric oxide synthase Nos2 (iNOS) express, by suppressing miRNA-34a, can prevent cartilage destruction (referring to Abouheif MM etc., Silencing microRNA-34a inhibits chondrocyte apoptosis in a rat osteoarthritis model in vitro.Rheumatology (Oxford) 2010,49 (11): 2054-2060).In contrast, the expression that IL-1 β suppresses miRNA-27b in chondrocyte causes the increase that the direct target gene MMP13 (the another kind of enzyme of cartilage cell epimatrix degraded) of microRNA-27b expresses, cause cartilage cell epimatrix degraded (referring to Akhtar N etc., MicroRNA-27b regulates the expression of matrix metalloproteinase13in human osteoarthritis chondrocytes.Arthritis and rheumatism2010,62 (5): 1361-1371).Also there are some researches show, miRNA-675 can promote to cause expression (the Dudek KA etc. of the epimatrix gene II Collagen Type VI of cartilage specificity, Type II collagen expression is regulated by tissue-specific miR-675in human articular chondrocytes.J Biol Chem2010,285 (32): 24381-24387).
Visible, aspect cartilage of osteoarthritis injury in treating, seek a kind of new miRNA that is used for the treatment of cartilage of osteoarthritis damage and have great importance.
Summary of the invention
In order to solve the problem of prior art, the application of the inhibitor that the embodiment of the present invention provides a kind of microRNA-101 in the medicine of preparation prevention or treatment osteoarthritis.Described technical scheme is as follows:
First aspect, the application of the inhibitor that the embodiment of the present invention provides a kind of microRNA-101 in the medicine of preparation prevention or treatment osteoarthritis.
Particularly, the nucleotides sequence of described microRNA-101 is classified 5'-UACAGUACUGUGAUAACUGAA-3' as.
Particularly, as preferably, described microRNA-101 is further modified, and the microRNA-101 after modification keeps the activity of described microRNA-101.
Particularly, described modification is selected from least one in ribose modification, base modification, phosphoric acid backbone modification.
Particularly, as preferably, the nucleotide in described microRNA-101 is further partially replaced or increases and decreases, nucleotide be further partially replaced or increase and decrease after microRNA-101 keep the activity of described microRNA-101.
Second aspect, it is a kind of for preventing or treat the pharmaceutical composition of osteoarthritis that the embodiment of the present invention provides, and described pharmaceutical composition comprises the inhibitor of the microRNA-101 of effective dose.
Particularly, as preferably, described pharmaceutical composition also comprises other medicine classes and pharmaceutically acceptable carrier and/or the adjuvant with the inhibitor compatibility of described microRNA-101.
Particularly, as preferably, the dosage form of described pharmaceutical composition is selected from solution, suspension agent, Emulsion, Controlled release formulation or extended release preparation.
Particularly, as preferably, the administering mode of described pharmaceutical composition is selected from drug administration by injection or oral administration.
The beneficial effect that the technical scheme that the embodiment of the present invention provides is brought is:
The application of the inhibitor that the embodiment of the present invention provides a kind of microRNA-101 in the medicine of preparation prevention or treatment osteoarthritis, in the rat cartilage in primary osteoarthritis of iodoacetic acid induction, the analogies that give rat knee joint cavity injection microRNA-101 can cause that rat bone arthritis cartilage injury increases the weight of, and cause that the epimatrix gene II Collagen Type VI of cartilage specificity and the expression of Dan Baiduotang proteoglycan PG decline.The inhibitor that gives rat knee joint cavity injection microRNA-101 can significantly improve its cartilage injury, delays cartilage injury's process of cartilage in primary osteoarthritis, plays the protective effect of cartilage.So by suppressing the expression of microRNA-101, can slow down the degraded of cartilaginous tissue by the inhibitor of microRNA-101, play the effect of stablize chondrocyte phenotype, thereby control osteoarthrosis destroys and promotes repair of cartilage.The inhibitor of above-mentioned microRNA-101 is to stablizing chondrocyte phenotype, the effect of prevention cartilage cell epimatrix degraded by regulation and control chondrocyte with Chondrocyte Differentiation, the stable relevant crucial transcription factor Sox9 gene of phenotype is achieved.This shows that the inhibitor of microRNA-101 can be used for preparation and controls the medicine that osteoarthrosis destroyed and promoted repair of cartilage.
Accompanying drawing explanation
In order to be illustrated more clearly in the technical scheme in the embodiment of the present invention, below the accompanying drawing of required use during embodiment is described is briefly described, apparently, accompanying drawing in the following describes is only some embodiments of the present invention, for those of ordinary skills, do not paying under the prerequisite of creative work, can also obtain according to these accompanying drawings other accompanying drawing.
Fig. 1 a is in the cartilage of osteoarthritis damage model of the iodoacetic acid induction that provides of the embodiment of the present invention 1, microRNA-101 expression schematic diagram;
Fig. 1 b is in the cartilage of osteoarthritis damage model of the iodoacetic acid induction that provides of the embodiment of the present invention 1, the expression schematic diagram of Sox9mRNA;
Fig. 1 c is in the cartilage of osteoarthritis damage model of the iodoacetic acid induction that provides of the embodiment of the present invention 1, the expression schematic diagram of Sox9 albumen;
Fig. 2 a is the confocal microscopy result schematic diagram of the rat knee cartilage frozen section of each animal model group of providing of the embodiment of the present invention 1;
Fig. 2 b is the expression schematic diagram of the miR-101a of each animal model group of providing of the embodiment of the present invention 1;
Fig. 2 c is the Sox9mRNA expression schematic diagram of each animal model group of providing of the embodiment of the present invention 1;
Fig. 2 d is the expression schematic diagram of the Sox9 albumen of each animal model group of providing of the embodiment of the present invention 1;
Fig. 3 a is the observed result schematic diagram of the cartilaginous tissue of each animal model group of providing of the embodiment of the present invention 1;
Fig. 3 b is the histological score result schematic diagram of each animal model group of providing of the embodiment of the present invention 1 after 7 days;
Fig. 3 c is the histological score result schematic diagram of each animal model group of providing of the embodiment of the present invention 1 after 14 days;
Fig. 4 is the HE coloration result schematic diagram (10 times of amplifications, scale=400 micron) of the cartilaginous tissue of each animal model group of providing of the embodiment of the present invention 1;
Fig. 5 is the Dan Baiduotang proteoglycan PG coloration result schematic diagram (10 times of amplifications, scale=400 micron) of the cartilaginous tissue of each animal model group of providing of the embodiment of the present invention 1;
Fig. 6 is the II Collagen Type VI immunohistochemical staining result schematic diagram (10 times of amplifications, scale=400 micron) of each animal model group of providing of the embodiment of the present invention 1.
The specific embodiment
For making the object, technical solutions and advantages of the present invention clearer, below in conjunction with accompanying drawing, embodiment of the present invention is described further in detail.
Osteoarthritis (osteoarthritis is called for short OA) claims again osteoarthritis, and osteoarthritis, is the Articular cartilage degeneration being caused by many reasons such as wound, joint deformities.The clinical even dysfunction of arthralgia, limitation of activity and joint deformity that produces.Because OA is difficult for curing, seriously hinder one's work, affect quality of life, become the second common cause of disability after 50 years old, be only second to heart disease.To the clinical treatment of OA be mainly by easing the pain, relief of symptoms, to delay disease be object.For instance, Drug therapy: the medicine (as analgesic, NSAID (non-steroidal anti-inflammatory drug) etc.), hormone, the Chondroprotective agents (as joint cavity injection hyaluronate sodium, oral glucosamine etc.) that use alleviating pain symptom.Operative treatment: use arthroscopic flushing, Drilling, microfrature, bone cartilage transplantation, chondrocyte or mesenchymal stem cell transplantation.And for joint deformity severe patient, need the orthopaedy of row osteotomy; Destruction of joint, dysfunction severe patient need row artificial joint replacement.Above-mentioned these Therapeutic Method can only alleviate the pathological changes symptom that osteoarthrosis has occurred, and cannot reverse or end its pathological changes symptom.
Research is found: the generation of OA and development comprise several important pathological changes: articular cartilage degeneration, Subchondral bone sclerosis, synovial membrane inflammation and hyperosteogeny form.Wherein, articular cartilage degeneration is to produce at first in osteoarthritis, and treatment means cannot reverse at present, is also most important pathological change.Articular cartilage is comprised of chondrocyte and extracellular matrix (extracellular matrix, ECM).Chondrocyte is cell type unique in articular cartilage, can synthesize and decompose extracellular matrix.The extracellular matrix of cartilage is mainly comprised of II Collagen Type VI (Collagen type II, COL2A1) and Dan Baiduotang proteoglycan PG (Aggrecan).The structure that chondrocyte and extracellular matrix maintain articular cartilage jointly with and the stable state of extracellular environment.When there is OA, this stable state is broken, and shows as the degraded of cartilage cell epimatrix, the regression of chondrocyte etc.In OA process, the regression of chondrocyte and extracellular matrix degradation mainly divide two stages: biosynthesis stage and degradation period.In the biosynthesis stage, chondrocyte attempts going to repair the cartilage cell epimatrix of damage.But, because the gene expression dose of synthetic cell epimatrix is very low, can not effectively synthesize enough extracellular matrixs.In degradation period, under the effect of inflammatory factor, chondrocyte produces the relevant enzymes of extracellular matrix degradation by peptic cell epimatrix, causes extracellular matrix degradation.Meanwhile, inflammatory factor can also cause that the gene expression of synthetic cell epimatrix further declines, and synthesizing of extracellular matrix is more not enough, causes vicious cycle, causes the sharply destruction of cartilage.Therefore, the synthetic deficiency of cartilage cell epimatrix and the degraded of cartilage cell epimatrix are pathological changes main in OA cartilage injury.
According to the research to OA pathological process, in order to slow down osteoarthritis symptoms, and effectively reverse or termination osteoarthritis, the present invention has further studied the gene that plays an important role in the pathological process of OA, Gene regulation network, epigenetics and has changed and the miRNA that is correlated with, the application of the inhibitor that a kind of microRNA-101 is provided in the medicine of preparation prevention or treatment osteoarthritis.
The present invention studies discovery, and in the rat model that the cartilage of osteoarthritis of inducing at iodoacetic acid destroys, microRNA-101 in rat cartilaginous tissue (being microRNA-101a) level significantly raises.The analogies that give rat knee joint cavity injection microRNA-101, can cause that rat bone arthritis cartilage injury increases the weight of.The inhibitor that gives rat knee joint cavity injection microRNA-101 can significantly improve its cartilage injury, plays the protective effect of cartilage.So by suppressing the expression of microRNA-101, can slow down the degraded of cartilaginous tissue by the inhibitor of microRNA-101, play the effect of stablize chondrocyte phenotype, thereby control osteoarthrosis destroys and promotes repair of cartilage.The inhibitor of above-mentioned microRNA-101 is to stablizing chondrocyte phenotype, the effect of prevention cartilage cell epimatrix degraded by regulation and control chondrocyte with Chondrocyte Differentiation, the stable relevant crucial transcription factor Sox9 gene of phenotype is achieved.Visible, the inhibitor of microRNA-101 can be used in the medicine of preparation prevention or treatment osteoarthritis.
Be understandable that, the inhibitor of microRNA-101 has implication known in this field.The design of the inhibitor of microRNA-101 and preparation method are also well known in the art.For instance, those skilled in the art design its antisense RNA according to microRNA-101, or microRNA-101 is contacted with specific material, detect the expression of microRNA-101, and the candidate substances of selecting special inhibition microRNA-101 to express, to obtain the inhibitor of microRNA-101.Be understandable that, the inhibitor of microRNA-101 can be can be special any material of inhibition microRNA-101 to the regulating and controlling effect of target gene, also can be the material that special inhibition microRNA-101 expresses in cell, can also be to there is the interactional material of specificity with microRNA-101, for example, with the material of microRNA-101 specific binding, or special inhibition microRNA-101 and the interactional material of DICER.Particularly, the inhibitor of microRNA-101 can be a kind of micromolecule nucleic acid, and it can effectively suppress the expression of microRNA-101.
Particularly, the nucleotides sequence of microRNA-101 is classified 5'-UACAGUACUGUGAUAACUGAA-3' as.
Due to microRNA-101 nucleotides sequence, to be listed between each species (as mice, rat, pig etc.) very conservative, so in the embodiment of the present invention, microRNA-101 is selected from people's microRNA-101, its serial number in miRbase is: MI0000103, nucleotides sequence is classified 5'-UACAGUACUGUGAUAACUGAA-3' as, and it has the specific biological activity that increases the weight of osteoarthritis symptoms.
In the embodiment of the present invention, microRNA-101 had both referred to the interior life, the noncoding Microrna that contain 5'-UACAGUACUGUGAUAACUGAA-3' sequence, the microRNA molecule that also can refer to exercise the core sequence of microRNA-101 function, can also refer to the external synthetic microRNA molecules with 5'-UACAGUACUGUGAUAACUGAA-3' sequence (also can be referred to as the analogies of microRNA-101).Wherein the external synthetic method of above-mentioned microRNA molecules is known in this field.Therefore, the inhibitor of microRNA-101 can be the inhibitor of the microRNA-101 that obtains according to above-mentioned microRNA-101.
Particularly, as preferably, microRNA-101 is further modified, and the microRNA-101 after modification keeps the activity of this microRNA-101.
In the embodiment of the present invention, the stability when keeping microRNA-101 to operate in vitro, can modify further to it, and still, the microRNA-101 after modification keeps the activity of this microRNA-101.Be understandable that, the inhibitor of microRNA-101 can be the inhibitor obtaining according to microRNA-101 above-mentioned, after modifying.
Wherein, it is active that " activity of microRNA-101 " refers to the specific biological that microRNA-101 can cause that the epimatrix gene II Collagen Type VI (Col2A1) of cartilage specificity and the expression of Dan Baiduotang proteoglycan PG (Aggrecan) decline, cause that cartilage injury increases the weight of.Particularly, above-mentioned modification is selected from least one in ribose modification, base modification, phosphoric acid backbone modification.
Particularly, as preferably, the nucleotide in microRNA-101 is further partially replaced or increases and decreases, nucleotide be further partially replaced or increase and decrease after microRNA-101 keep the activity of microRNA-101.
Wherein, it is active that " activity of microRNA-101 " refers to the specific biological that microRNA-101 can cause that the epimatrix gene II Collagen Type VI (Col2A1) of cartilage specificity and the expression of Dan Baiduotang proteoglycan PG (Aggrecan) decline, cause that cartilage injury increases the weight of equally.
Second aspect, it is a kind of for preventing or treat the pharmaceutical composition of osteoarthritis that the embodiment of the present invention provides, and this pharmaceutical composition comprises the inhibitor of the microRNA-101 of effective dose.
The pharmaceutical composition of the inhibitor of the microRNA-101 that contains effective dose, it has the specific effect of the inhibitor of microRNA-101 equally, stablizes chondrocyte phenotype, the degraded of prevention cartilage cell epimatrix.
Wherein, " effective dose " refer to human or animal body produced to function or activity, and can be by the amount that human or animal accepted.
When the inhibitor of microRNA-101 is a kind of micromolecule nucleic acid, it can effectively suppress the expression of microRNA-101.Further, the nucleotide in this microRNA-101 inhibitor is further partially replaced or increases and decreases, nucleotide be further partially replaced or increase and decrease after the inhibitor of microRNA-101 keep to suppress the activity that microRNA-101 expresses.
Particularly, as preferably, this pharmaceutical composition also comprises other medicine classes and pharmaceutically acceptable carrier and/or the adjuvant with the inhibitor compatibility of microRNA-101.
When the inhibitor of microRNA-101 is during for prevention or treatment osteoarthritis, it can use separately, also can be used in conjunction with other compatible medicine classes and pharmaceutically acceptable carrier and/or adjuvant.Wherein, " pharmaceutically acceptable carrier and/or adjuvant " refers to and is applicable to people's live animal and without excessive bad side reaction (as toxicity, stimulation and allergy), has carrier and/or the adjuvant of rational benefit/risk ratio.
Particularly, this carrier can be nano-particle, liposome, cholesterol, chitosan and virus etc.
Particularly, as preferably, the dosage form of this pharmaceutical composition is selected from solution, suspension agent, dry powder doses, Emulsion, Controlled release formulation or extended release preparation.The administering mode of this pharmaceutical composition is selected from drug administration by injection (for example, intravenous injection, articular cavity local injection or intramuscular injection etc.) or oral administration.
Below will the present invention be described further by specific embodiment.
The unreceipted condition person of following specific embodiment, all according to the condition of normal condition or manufacturer's suggestion, carry out.The unreceipted person of production firm of agents useful for same or instrument is can be by the conventional products of commercial acquisition.
Wherein, the analogies of microRNA-101 are synthetic from Shanghai Ji Kai company, production code member: GCD950817.
The inhibitor of microRNA-101 is synthetic from Shanghai Ji Kai company, production code member: GCD950818.
Embodiment 1
1) iodoacetic acid induction cartilage in primary osteoarthritis is set up
SD rat dorsal position is fixed in assistant's hands, and patient's left hand touches the joint space of rat, patellar ligament.Then with No. 26 syringe needles, pass the patellar ligament of rat, feel and have a kind of broken empty sense, prove that syringe needle enters articular cavity, with microsyringe, inject iodoacetic acid (iodoacetic acid of 2mg is dissolved in 50 μ l PBS (phosphate buffered solution)).Normal diet, makes rat freely movable in cage.
2) animal grouping
The SD rat of 32 (totally 64 knee joints) weight 150g is equally divided into 4 groups, comprises respectively: first group (only inject iodoacetic acid and do not carry out miRNA intervention); Second group (injection iodoacetic acid, and utilize contrast miRNA to intervene; The 3rd group (injection iodoacetic acid, carries out the analogies intervention of microRNA-101, crosses expression microRNA-101 group); The 4th group (injection iodoacetic acid, carries out the inhibitor intervention of microRNA-101, suppresses microRNA-101 expression group).Two knee joints of same rat cause respectively different processed group.
3) laboratory animal is carried out miRNA therapeutic intervention
At injection iodoacetic acid, after 3 days, SD rat is started to carry out miRNA intervention, every 3 days once, until experiment is ended.
4) sacrifice of animal, draw materials
The 7th day and the 14th day after iodoacetic acid in injection respectively, excessive narcotization is put to death SD rat, gets its knee joint, after finishing, puts into fixative.
5) Histological evaluation
After SD rat is put to death, the leading section of femur (having 8 samples in each group) is cut off, and then in 4% paraformaldehyde (pH7.4), fixes 48 hours, at 4 ℃ then by sample decalcification 2 days in decalcifying Fluid fast.Decalcification specimen is repaired, and gradient ethanol dehydration, is embedded in paraffin.Be cut into the thick sagittal slices of 5 μ m and carry out hematoxylin-eosin staining (being called for short HE dyeing) and Toluidine blue staining, II Collagen Type VI antibody carries out immunohistochemical analysis.Histological score adopts the mankin methods of marking of improvement.(referring to Mankin, H.J., Dorfman, H., Lippiello, L. & Zarins, A.Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips.II.Correlation of morphology with biochemical and metabolic data.The Journal of bone and joint surgery.American volume53,523-537 (1971) .)
6) expression of microRNA-101 in immunofluorescence analyzing rat knee cartilage
The knee cartilage of rat (after injection in the 1st day) rinsing in PBS, and be embedded in OCT compound.Utilize frozen section that freezing microtome is cut into 8 micron thickness on microscope slide.Then, will cut into slices with Hoechst33342 dye liquor dyeing 5 minutes.PBS washing 3 times is observed microscope slide under Laser Scanning Confocal Microscope.
7) RNA extracting and Real-time pcr analysis
With TRIzol reagent, in extracting MIA rat knee cartilage, extract total RNA.Separated RNA carries out reverse transcription, and uses in real time ABI step 1 to add QPCR system and carry out pcr analysis instrument (ABI, Foster city, California, the U.S.) and select main mixture (ABI) with SYBR.The condition of Real-time PCR is as follows: 50 ℃ 2 minutes, carry out 2 minutes at 95 ℃, subsequently 95 ℃ 15 seconds, carry out 40 circulations, 60 ℃ 30 seconds.Add solubility curve and there is no non-specific amplification to determine.The primer of Real-time PCR is as follows:
Sox9 (FW), 5'-AGGAAGCTGGCAGACCAGTA-3' and (RV), 5'-ACGAAGGGTCTCTTCTCGCT-3';
18S RNA FW, 5'-GTAACCCGTTGAACCCCATT-3', and RV, 5'-CCATCCAATCGGTAGTAGCG-3'.
For reverse transcription, the expression analysis of microRNA-101, adopt Bulge-loop
tMmiRNA test kit operates (being purchased from the sharp rich biology in Guangzhou) according to description.Use 2-Δ Δ CT method to measure the expression of Sox9 and miR-101.
8) Separation of Proteins and immunoblotting
With lysis buffer, extract protein (the Tris-hydrochloric acid of 50mM, pH is 7.4,150mM sodium chloride, 1%NP-40 and 0.1% sodium lauryl sulphate), BCA protein determination kit (Pierce company) is used in concentration determination, uses bovine serum albumin as standard substance.Protein in SDS-PAGE gel (10%) 1.5 hours, then at 4 ℃ electrotransfer to nitrocellulose filter 2 hours.Primary antibodie (II Collagen Type VI) 1:4000 dilutes latter 4 ℃ and spends the night; Under two anti-1:1000 dilution room temperatures of horseradish peroxidase-labeled, hatch 1 hour.By chemoluminescence method, detect protein expression level.β-actin (Sigma company, 1:10000 dilution) is as internal reference.
Statistical analysis
The variance analysis for showing property of group difference (ANOVA) analytical calculation.The result of same group adopts Student-t check to evaluate.P value is less than 0.05 and is considered to have remarkable significant difference.All data represent with mean ± standard deviation.
Result of study
The expression in first group of rat knee cartilage of microRNA-101 and Sox9 gene
In order to check whether microRNA-101 participates in the process of first group of rat cartilage degradation, rat knee cartilage is drawn materials after one day and is done further to analyze at injection iodine acetic acid.As shown in Figure 1a, compare with normal rat (without the acid-treated rat of iodine vinegar), the Real-time PCR result of first group is shown, microRNA-101 expression significantly rises after injection iodoacetic acid.Yet, RNA and the protein level of Sox9 significantly decline (referring to Fig. 1 b and Fig. 1 c).Visible, Sox9's is a target of microRNA-101, and Sox9 is subject to the regulation and control of microRNA-101 in cartilage cell epimatrix degradation process.In sum, microRNA-101 participates in the cartilage degradation process of MIA rat, and its function realizes by the expression of regulation and control Sox9.
The effect of the inhibitor expression vector of the analogies of microRNA-101 and microRNA-101 to articular cartilage
In order to test the carrier of adenovirus mediated microRNA-101, whether can be penetrated into cartilage and play a role, first, the frozen section of the rat knee cartilage of the injection analogies (the 3rd group) of microRNA-101 and the inhibitor (the 4th group) of microRNA-101 is carried out to immunofluorescence analysis observation under Laser Scanning Confocal Microscope.The nucleus of chondrocyte to be detected is carried out to fluorescent labeling (referring to Fig. 2 a), in the carrier of analogies of microRNA-101 and the carrier of the inhibitor of microRNA-101, be provided with Green Fluorescent Protein, whether the expression of green fluorescent protein can show whether the analogies of microRNA-101 and the inhibitor of microRNA-101 express.
Laser Scanning Confocal Microscope result shows, green fluorescent protein can be at cartilage, meniscus, even in synovial membrane, express (referring to Fig. 2 a).This carrier that shows microRNA-101 and analogies or inhibitor can infiltrate cartilage.Secondly, in order to detect expression vector, can in cartilage, play a role, the RNA of rat knee cartilage tissue, by Real-time PCR method, detect the expression of microRNA-101 in the cartilaginous tissue of injecting over-express vector, result shows, in the injection sample (the 3rd group) of analogies of microRNA-101 and the sample (the 4th group) of the inhibitor of microRNA-101, the expression of microRNA-101 significantly increases (referring to Fig. 2 b) with respect to second group.And in the sample (the 3rd group) of the analogies of injection microRNA-101, the mrna expression level of Sox9 decline (referring to Fig. 2 c and 2d); And in the sample (the 4th group) of inhibitor of injection microRNA-101, the expression of the mRNA of Sox9 be improved significantly (referring to Fig. 2 c and 2d).Visible, the analogies of adenovirus mediated microRNA-101 and the inhibitor of microRNA-101 can be penetrated into cartilage, and can play a role, and regulate the expression of its target spot Sox9.
Each is organized knee joint coaster cartilage and observes
None example is dead after rat joint cavity injection and in therapeutic process, and none example infects, and above-mentioned four groups of rats are drawn materials respectively after injection iodoacetic acid for 7 days and 14 days.Observation shows, in the time of 7 days, in above-mentioned four groups of rats, knee joint coaster part cartilage destruction is obvious, the performance that has slight subchondral bone to expose.But the degree difference of the cartilage degeneration of four groups is little (referring to Fig. 3 a).In the time of 14 days, in four groups, there is difference in the cartilage degeneration at knee joint coaster position, specifically first group and second group of cartilage degeneration situation similar, have phenomenon that slight subchondral bone exposes (referring to Fig. 3 a); And the cartilage degeneration of the 3rd group of trochlear surface is obvious, subchondral bone exposes obviously (referring to Fig. 3 a); The 4th group, cartilage degeneration is very slight, and the degree of cartilage degeneration is than first group and second group little, and cartilage surface smoother, does not occur that subchondral bone exposes (referring to Fig. 3 a).
Each is organized knee joint coaster cartilaginous tissue and learns scoring
Knee joint scoring of each group is mainly assessed according to the mankin marking system of improvement, mainly from three broad aspect, assesses cartilage degeneration degree: abnormal (comprise chondrocyte increases, loose, bunch collection), the substrate dyeing of the structure of cartilage (comprise that cartilage surface irregularity, crack to emitting layer, pannus, top layer disappear, slight disorganization, crack to subchondral bone, disorganization etc.), chondrocyte (comprise that top layer dyeing reduces, in born of the same parents substrate dyeing reduce, only extracellular matrix dyeing, dye-free).The low explanation cartilage degeneration of mark is lighter, and the high explanation of mark cartilage degeneration weight.
From tissue scoring, in the time of 7 days, it is not obvious that each organizes diversity of values.But, to compare with other groups, the 4th group of scoring is low, and between the histological score of other groups, relatively has significant difference, and the 4th group of cartilage injury little (referring to Fig. 3 b) is described.In the time of 14 days, obvious difference between the overall histological score of each group, the scoring that is mainly manifested in the 4th group has been compared statistical significance with first group with second group; The scoring of the 3rd group is compared with second group and is also had statistical significance (referring to Fig. 3 c) with first group.Visible, the scoring of the 3rd group is low, illustrates that cartilage degeneration is few; And the scoring of the 4th group is high, illustrate that cartilage degeneration is many, illustrate that the analogies of microRNA-101 increase the weight of bone pass inflammation, the inhibitor of microRNA-101 improves bone and closes scorching.
Each treated animal knee joint coaster cartilaginous tissue HE coloration result
As shown in Figure 4, from HE, dye, concrete animal model cartilage degeneration comprises: the uneven and crack of cartilage surface, and the attenuation of cartilaginous calcification layer, damp line is unintelligible.In the time of 7 days, between the overall HE dyeing of each group, relatively there is no notable difference.In the time of 14 days, each thickness of organizing cartilage was compared equal attenuation with 7 days, and still, the degree of the 4th group of attenuation is low weight.The articular cartilage of first group, second group and the 3rd group is very not tight with being connected of subchondral bone, and cartilage surface has crack deeply to reach subchondral bone simultaneously, and the 4th group do not have cartilage surface smooth, there is no crack.Visible, after the analogies of joint cavity injection microRNA-101, cartilage injury increases the weight of, structure disturbance, cartilage layers attenuation; And after the inhibitor of injection microRNA-101, cartilage structure is comparatively normal.
The Toluidine blue staining of each treated animal knee joint coaster cartilage cell epimatrix and II Collagen Type VI immunohistochemical staining result
II Collagen Type VI and Dan Baiduotang proteoglycan PG are the chief component compositions of cartilaginous tissue extracellular matrix, are also the Specific markers of cartilage.When cartilaginous tissue regression, cartilaginous tissue extracellular matrix is degraded gradually, and the amount of II Collagen Type VI and Dan Baiduotang proteoglycan PG reduces gradually; Toluidine blue staining can reflect the Dan Baiduotang proteoglycan PG content outside chondrocyte, and II Collagen Type VI immunohistochemical staining mainly reflects the variation of II Collagen Type VI amount.Therefore, II Collagen Type VI and Dan Baiduotang proteoglycan PG are also the main detection indexs of cartilage degeneration.
As shown in accompanying drawing 5 and accompanying drawing 6, Toluidine blue staining and the demonstration of II Collagen Type VI immunohistochemical staining result, each group does not have notable difference on the expression of Dan Baiduotang proteoglycan PG and II Collagen Type VI.
In the time of 14 days, aspect Toluidine blue staining and II Collagen Type VI immunohistochemical staining result, there is difference in each group, be in particular in: the Toluidine blue staining of the 4th group is compared with three groups of II Collagen Type VI immunohistochemical staining and other, dyeing is dark, and few (referring to Fig. 5 and Fig. 6) of the cartilaginous tissue extracellular matrix regression of the 4th group is described.Meanwhile, aspect Toluidine blue staining and II Collagen Type VI immunohistochemical staining, compare, there is no notable difference for other three groups.
In sum, after the analogies of joint cavity injection microRNA-101, cartilage cell epimatrix: Dan Baiduotang proteoglycan PG dyeing is thin out, illustrates cartilage cell epimatrix degraded; After the inhibitor of injection microRNA-101, it is dark that cartilaginous tissue Toluidine blue staining is compared other group dyeing, illustrates that the inhibitor of injection microRNA-101 can prevent cartilage cell epimatrix degraded.
After the analogies of joint cavity injection microRNA-101, another extracellular matrix of cartilage: the dyeing of II Collagen Type VI is thin out, illustrates cartilage cell epimatrix degraded; After the inhibitor of injection microRNA-101, it is dark that cartilaginous tissue II Collagen Type VI immunohistochemical staining is compared other group dyeing, illustrates that the inhibitor of injection microRNA-101 can prevent cartilage cell epimatrix degraded.
Embodiment 2
The inhibitor medicaments of preparation microRNA-101:
1) design of the inhibitor of microRNA-101: according to the sequence of microRNA-101, according to the antisense oligonucleotide of principle of complementarity design microRNA-101, the Antisensedigonucleotsequence sequence of microRNA-101 is: 5 ' ATGTCATGACACTATTGACTT3 '.
2) utilize lock nucleic acid to modify microRNA-101 inhibitor: by 5 ' ATGTCATGACACTATTGACTT3 ' in the Antisensedigonucleotsequence sequence of microRNA-101,1,2,3,4,5,6,7 or more nucleotide from 5 ' end in 1-21 position is locked nucleotide (LNA) and modified.This lock nucleotide is selected from β-D-oxygen-lock nucleotide, (can also substitute with β-D-sulfur-lock nucleotide, β-D-amino-lock nucleotide and/or α-L-oxygen-lock nucleotide).This lock nucleotide is prepared according to following method (referring to international monopoly: WO99/14226, WO00/56746, WO00/56748, WO00/66604 etc.).Thereby prepare the inhibitor medicaments of the microRNA-101 after modification.The stability of the inhibitor medicaments of the microRNA-101 that this prepares improves, can be specifically in conjunction with the microRNA molecule that suppresses the endogenous maturation of cell
IL-1 β and TNF-α can cause chondrocyte regression after acting on human cartilage tissue, and extracellular matrix degradation, causes cartilage injury.The inhibitor medicaments of the prepared microRNA-101 of effective dose is added in the culture fluid of human chondrocytes; carry out again after the stimulation of IL-1 β and TNF-α; the inhibitor medicaments of finding microRNA-101 can reverse the human chondrocytes regression that IL-1 β and TNF-α cause; extracellular matrix degradation; play protection chondrocyte, make it avoid the cartilage injury that inflammatory factor causes.Visible, the inhibitor medicaments of the microRNA-101 that the embodiment of the present invention provides has Saving cortilage chondrocyte, is beneficial to the effect of repair of cartilage.
The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
Claims (9)
1.microRNA-101 the application of inhibitor in preparation prevention or treatment osteoarthritis medicine.
2. application according to claim 1, is characterized in that, the nucleotides sequence of described microRNA-101 is classified 5'-UACAGUACUGUGAUAACUGAA-3' as.
3. application according to claim 2, is characterized in that, described microRNA-101 is further modified, and the microRNA-101 after modification keeps the activity of described microRNA-101.
4. application according to claim 3, is characterized in that, described modification is selected from least one in ribose modification, base modification, phosphoric acid backbone modification.
5. application according to claim 2, is characterized in that, the nucleotide in described microRNA-101 is further partially replaced or increases and decreases, nucleotide be further partially replaced or increase and decrease after microRNA-101 keep the activity of described microRNA-101.
6. for preventing or treat a pharmaceutical composition for osteoarthritis, described pharmaceutical composition comprises the inhibitor of the microRNA-101 of effective dose.
7. pharmaceutical composition according to claim 6, is characterized in that, described pharmaceutical composition also comprises other medicine classes and pharmaceutically acceptable carrier and/or the adjuvant with the inhibitor compatibility of described microRNA-101.
8. pharmaceutical composition according to claim 7, is characterized in that, the dosage form of described pharmaceutical composition is selected from solution, suspension agent, dry powder doses, Emulsion, Controlled release formulation or extended release preparation.
9. pharmaceutical composition according to claim 7, is characterized in that, the administering mode of described pharmaceutical composition is selected from drug administration by injection or oral administration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410290697.0A CN104083761A (en) | 2014-06-25 | 2014-06-25 | Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410290697.0A CN104083761A (en) | 2014-06-25 | 2014-06-25 | Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104083761A true CN104083761A (en) | 2014-10-08 |
Family
ID=51631584
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410290697.0A Pending CN104083761A (en) | 2014-06-25 | 2014-06-25 | Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104083761A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104586876A (en) * | 2014-12-29 | 2015-05-06 | 中国人民解放军第三军医大学 | Application of microRNA-29b in articular cartilage repair as drug target |
| CN107050454A (en) * | 2016-12-09 | 2017-08-18 | 南方医科大学 | A kind of 5p inhibitor medicaments of miRNA 483 and its purposes in treatment osteoarthritis drugs |
| CN110903381A (en) * | 2019-12-04 | 2020-03-24 | 广州领晟医疗科技有限公司 | Peptide KAI11 for promoting cartilage regeneration and application thereof |
| CN113018265A (en) * | 2021-03-30 | 2021-06-25 | 深圳市第二人民医院(深圳市转化医学研究院) | Preparation method and application of targeted chondrocyte exosome |
| CN114686477A (en) * | 2020-12-28 | 2022-07-01 | 广州中医药大学(广州中医药研究院) | miR-90 and its simulant and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101495498A (en) * | 2005-02-07 | 2009-07-29 | 基因信息公司 | Mild osteoarthritis biomarkers and uses thereof |
| CN102803284A (en) * | 2009-06-08 | 2012-11-28 | 米拉根医疗公司 | Chemical modification motifs for miRNA inhibitors and mimetics |
-
2014
- 2014-06-25 CN CN201410290697.0A patent/CN104083761A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101495498A (en) * | 2005-02-07 | 2009-07-29 | 基因信息公司 | Mild osteoarthritis biomarkers and uses thereof |
| CN102803284A (en) * | 2009-06-08 | 2012-11-28 | 米拉根医疗公司 | Chemical modification motifs for miRNA inhibitors and mimetics |
Non-Patent Citations (2)
| Title |
|---|
| DONGKYUN KIM ET AL: "Two non-coding RNAs,MicroRNA-101 and HOTTIP contribute cartilage integrity by epigenetic and homeotic regulation of integrin-α1", 《CELLULAR SIGNALLING》 * |
| LINGHUI DAI ET AL: "Silencing of microRNA-101 prevents IL-1β-induced extracellular matrix degradation in chondrocytes", 《ARTHRITIS RESEARCH & THERAPY》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104586876A (en) * | 2014-12-29 | 2015-05-06 | 中国人民解放军第三军医大学 | Application of microRNA-29b in articular cartilage repair as drug target |
| CN104586876B (en) * | 2014-12-29 | 2017-07-18 | 中国人民解放军第三军医大学 | Applications of the MicroRNA 29b as drug target in articular cartilage reparation |
| CN107050454A (en) * | 2016-12-09 | 2017-08-18 | 南方医科大学 | A kind of 5p inhibitor medicaments of miRNA 483 and its purposes in treatment osteoarthritis drugs |
| CN107050454B (en) * | 2016-12-09 | 2019-12-03 | 南方医科大学 | A kind of miRNA-483-5p inhibitor medicaments and its purposes in treatment osteoarthritis drugs |
| CN110903381A (en) * | 2019-12-04 | 2020-03-24 | 广州领晟医疗科技有限公司 | Peptide KAI11 for promoting cartilage regeneration and application thereof |
| CN114686477A (en) * | 2020-12-28 | 2022-07-01 | 广州中医药大学(广州中医药研究院) | miR-90 and its simulant and application |
| CN114686477B (en) * | 2020-12-28 | 2024-01-09 | 广州中医药大学(广州中医药研究院) | miR-90 and mimic and application thereof |
| CN113018265A (en) * | 2021-03-30 | 2021-06-25 | 深圳市第二人民医院(深圳市转化医学研究院) | Preparation method and application of targeted chondrocyte exosome |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DK2358373T3 (en) | Injectable polydeoxyribonukleotidsammensætning for the treatment of osteoarticular diseases | |
| CN101146546A (en) | Muscle regeneration | |
| CN104083761A (en) | Application of microRNA-101 (micro-ribonucleic acid-101) inhibitor in preparing medicaments for preventing or treating osteoarthritis | |
| EP2882772B1 (en) | Use of pedf-derived polypeptides for promoting muscle or tendon regeneration or arteriogenesis | |
| JP6958933B2 (en) | How to treat ectopic ossification | |
| Liu et al. | The role of MicroRNAs in tendon injury, repair, and related tissue engineering | |
| Zhu et al. | Icariin-loaded hydrogel regulates bone marrow mesenchymal stem cell chondrogenic differentiation and promotes cartilage repair in osteoarthritis | |
| Du et al. | Pentamethylquercetin protects against cardiac remodeling via activation of Sestrin2 | |
| Mathison et al. | Cardiac reprogramming factor Gata4 reduces postinfarct cardiac fibrosis through direct repression of the profibrotic mediator snail | |
| EA030022B1 (en) | Use of pedf-derived polypeptides for treating osteoarthritis | |
| Zhou et al. | Anti-fibrotic action of pirfenidone in Dupuytren’s disease-derived fibroblasts | |
| Lee et al. | VEGF-attenuated platelet-rich plasma improves therapeutic effect on cartilage repair | |
| EP3835413A1 (en) | Method and composition for promoting cell growth and tissue repair | |
| CA3067910A1 (en) | Methods and compositions for controlling cardiac fibrosis and remodeling | |
| US11622964B2 (en) | Method for destroying cellular mechanical homeostasis and promoting regeneration and repair of tissues and organs, and use thereof | |
| Wang et al. | Transplantation of Nogo-66 receptor gene-silenced cells in a poly (D, L-lactic-co-glycolic acid) scaffold for the treatment of spinal cord injury/1 | |
| Liu et al. | Effect of warm acupuncture combined with bone marrow mesenchymal stem cells transplantation on cartilage tissue in rabbit knee osteoarthritis | |
| CN109069661A (en) | Utilize the treatment of polymeric protein conjugate | |
| CN107982536B (en) | Composition of drug action target and application | |
| Zhang et al. | Exosomes derived from bone marrow mesenchymal stem cells pretreated with decellularized extracellular matrix enhance the alleviation of osteoarthritis through miR‐3473b/phosphatase and tensin homolog axis | |
| CN112138159B (en) | Use of lactate dehydrogenase in the treatment of tissue inflammation and fibrosis | |
| Ni et al. | Cyclin-dependent kinase 9 (CDK9) inhibitor atuveciclib suppresses intervertebral disk degeneration via the inhibition of the NF-κB signaling pathway | |
| Cheng et al. | miR-214-3p protects and restores the myocardial tissue of rat myocardial infarction model by targeting PTEN | |
| EP3834834A1 (en) | Drug used for treating tissue necrosis or for improving cardiac function | |
| Huang et al. | Transfection of TGF-β shRNA by Using Ultrasound-targeted Microbubble Destruction to Inhibit the Early Adhesion Repair of Rats Wounded Achilles Tendon In vitro and In vivo |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20141008 |