CN110273006A - The relevant molecular genetic marker of the effective sperm count of one herd boar - Google Patents
The relevant molecular genetic marker of the effective sperm count of one herd boar Download PDFInfo
- Publication number
- CN110273006A CN110273006A CN201910489838.4A CN201910489838A CN110273006A CN 110273006 A CN110273006 A CN 110273006A CN 201910489838 A CN201910489838 A CN 201910489838A CN 110273006 A CN110273006 A CN 110273006A
- Authority
- CN
- China
- Prior art keywords
- boar
- genetic marker
- sperm count
- effective
- molecular genetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The disclosure provides the effective sperm count of a herd boar relevant molecular genetic marker, and by the association analysis of boar effective sperm count and full-length genome molecular genetic marker, successfully screening influences the big effector molecule genetic marker of the effective sperm count of each semen collection of boar.Identify the molecular labeling ALGA0123896 of an influence effective sperm count of boar sperm, the effective sperm count of label different genotype boar single semen collection has extremely significant difference, filter out the molecular genetic marker for influencing the effective sperm count of boar sperm, ALGA0123896 belongs to NC_010444 gene intron sequence, which is T > C mutation.By detecting the molecular labeling, the breeding of herd boar semen production can be applied to, the effective sperm quantity of boar can be effectively improved by selecting and remain the high homozygous boar of the effective sperm count content of each semen collection by lasting breeding, accelerate the breeding progress of high-quality boar semen yield.
Description
Technical field
This disclosure relates to pig gene technical field, the in particular to relevant molecular genetic of the effective sperm count of a herd boar
Label.
Background technique
In recent years, with the scale of aquaculture, intensivization development, more and more pig farms are awarded using the fresh pedestrian's work that progresses greatly
Essence, artificial insemination have become a kind of intensive tool of strong pig production height.Herd boar high-quality sperm can not only mention
For excellent genetic resources, and directly affect the reproductive capacity of sow and the success rate of artificial insemination.Therefore right before semen deposition
It is essential that sperm, which carries out detection,.By the way that boar health status and breeding potential can also be monitored to semen quality evaluation, from
And individual inheritance potentiality can be optimized, play maximum fertility.
Effective sperm count is an important indicator for evaluating semen quality.During artificial insemination, due to sperm shape
State and vigor are bad etc. and effective sperm quantity is caused to reduce, so as to cause pregnancy rate decline.Therefore, before artificial insemination,
Must form to sperm and vigor carry out analysis detection.Teratospermia be influence each effective sperm count of semen collection it is important because
Element, rate of teratosperm refer to the percentage of the total sperm of defective sperm Zhan.The abnormal sperm rate of boar is no generally no more than 18%
It should then discard.Defective sperm refers to that huge sperm, dwarf spermatozoa, docking, broken end, acrosome fall off, plasm, head are big, double end, double
The sperms such as tail, folding tail, cannot generally move along a straight line, and fertility is poor (detection and measurement standard of pig semen, comprehensive pig raising).
Giemsa staining method is commonly used now and measures abnormal rate, and such method counting is accurate but time-consuming and laborious, and (quality supervision and test quarantine is total
2009 Beijing boar room temperature sperm [S] office .GB23238-: China Standards Press, 2009).Abnormal rate is higher, by the several months
Normal weather and good feeding adjustment, then to herd boar sperm carry out morphologic observation, still have higher abnormal rate, then it is believed that
Abnormal rate height is to should give that superseded (Cheng Huachu, Cui Xia, Wu Yunhua herd boar sperm are abnormal as caused by herd boar inherent cause
The reason of form quotient increases and treatment Countermeasures [J] China animal and veterinary digest, 2017,33 (09): 70).In addition to abnormal rate, every time
The sperm volume of semen collection, density, vigor also influence effective sperm count.
It excavates and is had great significance using the gene of the new effective sperm count of raising for the genetic breeding of herd boar.Base
In the high density SNP data of covering full-length genome and the trait phenotypes record of big group, whole-genome association skill can be passed through
Art (GWAS) (Hirschhorn, J.N.&Daly, M.J.Genome-wide association studies for common
Diseases and complex traits.Nat.Rev.Genet.6,95-108 (2005)) time of control character is accurately positioned
Select gene.Although the technology still has some defect (De, R., Bush, W.S.&Moore, J.H.Bioinformatics
challenges in genome-wide association studies(GWAS).Methods Mol.Biol.1168,63–
81 (2014)), it has been widely used in mankind's complex disease candidate gene and has excavated and livestock and poultry important economical trait key gene
Positioning.Classical GWAS is generally basede on Plink (Purcell, S.et al.PLINK:A Tool Set for Whole-
Genome Association and Population-Based Linkage Analyses.Am.J.Hum.Genet.813,
559-575 (2007)) etc. softwares carry out single label regression analysis to all labels one by one, set a remarkable threshold then to sieve
Select significant site.Such methods often face calculate big intensity, excessively high estimation marker effect, conspicuousness threshold value set it is unreasonable etc.
Problem.In order to further increase the efficiency of GWAS, new method and software are constantly suggested.Wherein, one-step method full-length genome is associated with
Analyze (wssGWAS (WANG, H., MISZTAL, I., AGUILAR, I.LEGARRA, A.&MUIR, W.M.Genome-wide
association mapping including phenotypes from relatives without
genotypes.Genet Res94,73–83(2012))；(Wang,H.et al.Genome-wide association
mapping including phenotypes from relatives without genotypes in a single-
step(ssGWAS)for 6-week body weight in broiler chickens.Front.Genet.5,1–10
(2014)) it) is associated analysis using pedigree, history individual phenotypic record and genotype data simultaneously, is suitable for a large amount of individuals
Possess phenotypic record the case where only a small amount of individual possesses genotype data, is particularly suitable for the complete of livestock and poultry important economical trait
Genome association analysis.Based on GBLUPf90 software (Misztal, I.et al.BLUPF90and related programs
(BGF90).in Proc.7th World Congr.Genet.Appl.Livest.Prod.21–22(2002).doi:
9782738010520) wssGWAS, can be realized easily.In different research groups, forefathers have navigated to some effects
The candidate gene or genome area of boar semen character, see reference document (Marques, D.B.D.D.et
al.Weighted single-step GWAS and gene network analysis reveal new candidate
genes for semen traits in pigs.Genet.Sel.Evol.50,1–14(2018))；(Kaewmala,K.et
al.Association study and expression analysis of CD9as candidate gene for boar
sperm quality and fertility traits.Anim.Reprod.Sci.125,170–179(2011))；
(Kaewmala,K.et al.Investigation into association and expression of PLCz and
COX-2as candidate genes for boar sperm quality and
fertility.Reprod.Domest.Anim.47,213–223(2012))；(Gunawan,A.et al.Investigation
on association and expression of ESR2as a candidate gene for boar sperm
quality and fertility.Reprod.Domest.Anim.47,782–790(2012))；(Diniz,D.B.et al.A
genome-wide association study reveals a novel candidate gene for sperm
motility in pigs.Anim.Reprod.Sci.151,201–207(2014)))。
Summary of the invention
In view of the above technical problems, the disclosure provides the effective sperm count of a herd boar relevant molecular genetic marker, passes through
The association analysis of boar effective sperm count and full-length genome molecular genetic marker, successfully it is effectively smart to influence each semen collection of boar for screening
The disclosure is applied to the breeding of herd boar semen production, it is effective to select and remain each semen collection by the big effector molecule genetic marker of subnumber
The big homozygous boar of sperm quantity, can effectively improve effective sperm quantity.
By identifying the molecular labeling ALGA0123896 of an influence effective sperm count of boar sperm, the label is different
The effective sperm count of genotype boar single semen collection has extremely significant difference, filters out the molecule something lost for influencing the effective sperm count of boar sperm
Label is passed, ALGA0123896 belongs to NC_010444 gene intron sequence, which is T > C mutation, and T > C, that is, T is big
The allele of frequency, C be small frequency allele, symbol > be gene frequency size, label be influence boar sperm
The allele of effective sperm count, ALGA0123896 genetic marker i.e. No. SNP be directed to are the mutation of ALGA0123896
Pig genome database (Sscrofall.1) in NCBI is seen in site.
This disclosure relates to SNP molecular genetic marker (ALGA0123896), refering to Ensembl database (http: //
Asia.ensembl.org/Sus_scrofa/Search/New? db=core), the NC_ that accession number is ALGA0123896 is obtained
010444 genetic fragment (No. RS is rs81324094), ALGA0123896 label is located at chromosome 147528447bp of pig No. 2
It sets, which is that a T > C is mutated (mutational site), and T > C, that is, T is the allele of big frequency, and C is the equipotential base of small frequency
Cause, symbol > it is gene frequency size, and the mutation belongs to NC_010444 gene intron sequence.The SNP molecular genetic
The nucleotide sequence of the upstream and downstream 100bp in the mutational site of label is as follows:
5’-ATCAACTATGACTTTCTTTTCAGAAAAAAAGCAGCTGCAATTCTACACCAGGAATGCAGGTAATC
ACACTTA ACAAGTAATATAGTGTCTGCTGCAGCTAR(T/C)TAAATCTCGTATTTTTCAACCTCACACAATGAAT
ACTCCTCATCAA TTAAAAGAAAAACAAAAACAACTGCAGTTCCCATTGCGGCTCAGTGGTAACGAA-3'；R is prominent
Point is conjugated, when the R at 101 nucleotide of above-mentioned sequence is T or C, i.e. when R (T/C), leads to above-mentioned sequence polymorphism；When above-mentioned
When 101st nucleotide of nucleotide sequence is C, pig significantly improves effective sperm count, and 5 '-and -3 ' respectively indicate nucleotides sequence
5 ' the ends and 3 ' ends of column.
The effective sperm count of single semen collection differs 44.53 between above-mentioned ALGA0123896 marker genetype CC and TT boar individual
Hundred million, C allele significantly improve effective sperm count, select and remain the high CC genotype homozygosis pig of the effective sperm count content of each semen collection,
By lasting breeding, effective sperm quantity can be effectively improved, accelerates the breeding progress of high-quality boar, (since the DNA of pig is reversed
It is CC genotype homozygosis pig when the mutational site nucleotide of spiral duplex structure, two chains is C, wherein each chain has one
A nucleotide sequence, C indicate that a mutational site is C, and CC genotype is that the mutational site of double-strand is all the homozygous pig of C, similarly,
TT genotype is that the mutational site of double-strand is all the homozygous pig of T；CT genotype is that the mutational site of a chain is T another prominent
Displacement point is the pig of C).
Screen the method for the relevant molecular genetic marker of the effective sperm count of a herd boar specifically includes the following steps:
1, the process step of the acquisition of molecular labeling
1.1, the ear tissue sample or blood sample of boar are acquired, extracts total DNA, and quality testing is carried out to DNA.Using
GGP50k SNP (GeneSeek, US) chip carries out Genotyping, obtains the SNP marker genotype of covering full-length genome.
1.2, genome (Sscrofall.1) is referred to according to the pig of latest edition, using NCBI genome alignment program
(https: //www.ncbi.nlm.nih.gov/) is updated the physical location of all SNP markers.Genomic locations are unknown
SNP be not used in association analysis.
1.3 carry out quality control, standard for the SNP marker on all autosomes, using Plink software are as follows: individual
Recall rate >=90%；SNP recall rate >=90%；Small gene frequency >=0.01；Hardy-Weinberg equilibrium p value >=10-6.It is right
In deletion Genotype, it is filled using Beagle software (version 4.1).
2, the process step of the verifying of molecular labeling
2.1, boar pedigree is arranged, mainly includes the information such as boar individual number, father, mother and nascent date.Using
UltiMateTM CASA (Hamilton Thorne Inc., Beverly, MA, USA) system carries out analysis to fresh semen and obtains
The effective sperm count trait phenotypes data of sperm are obtained, phenotype-genotype association analysis is used for.
2.2, using the one-step method whole-genome association method of weighting (weighted single step genome-
Wide association study, wssGWAS) carry out whole-genome association.This method is primarily based on mixed model side
Cheng Zulai estimates individual breeding value, is then converted to breeding value based on breeding value model and the equivalence relation of marker effect model
Marker effect.The whole-genome association model that the present invention uses is as follows:
Y=Xb+Za+Wp+Age+Intv+e
Wherein, y is effective sperm count observation vector；X, Z and W are design matrix；B is that fixed effect vector is (overall equal
Value and year-Ji Xiaoying)；For breeding value vector；For the permanent environmental effect of individual；Age and
Monthly age and semen collection interval when Intv is respectively boar semen collection are covariant；For residual error.H is while integrating
The affiliation matrix of spectrum and SNP marker, inverse matrix calculation formula are as follows:
Wherein, A is the affiliation matrix based on pedigree；A22To there is the corresponding matrix in block form of genotype individuals in A；Gω=
0.9G+0.1A22,For the affiliation square based on full-length genome SNP marker, Z is small gene frequency
Genotype matrix after (minor allele frequency, MAF) correction, wherein 0-2p, 1-2p and 2-2p respectively represent AA,
Tri- kinds of genotype of Aa and aa, p are small gene frequency；D is diagonal matrix, indicates the weight of SNP；piIt is marked for i-th
Small gene frequency；M is marker number.
For above-mentioned mixed model, using AI-REML (average information restricted maximum
Likelihood) method estimate variance component, and breeding value is obtained by solving Mixed model mixed.It is obtained by way of iteration
Weight must be marked, key step is as follows:
Step 1: initialization (t=1), D(t)=I, G(t)=λ ZD(t)Z ',
Step 2: individual breeding value is calculated by ssGBLUP；
Step 3: pass through formulaIndividual breeding value is converted into SNP effect, whereinTo there is gene
The breeding value of type individual；
Step 4: formula is utilizedIt calculates SNP weight and is used for next round iteration；
Step 5: formula is utilizedSNP weight is standardized, to guarantee that variance is consistent；
Step 6: formula G is utilized(t+1)=λ ZD(t+1)Z ' calculating affiliation matrix is used for next round iteration；
Step 7: t=t+1, and the next round iteration since step 2 are enabled.
Above-mentioned steps iteration is three times, final to obtain SNP marker effect.The marker effect that third round iteration is exported is as most
Whole result.Calculating process mainly calls BLUPF90 software to realize by statisticalling analyze platform programming in R, wherein
AIREMLF90 program is used for variance component estimate, and BLUPF90 program is for calculating breeding value, and postGSf90 is for calculating label
Effect.
3, the effective sperm count genescreen of different genotype boar single semen collection
Effect value markd for institute, takes its absolute value to draw Manhattan figure, shows and screen the SNP marker of big effect.
And using variance analysis and Multiple range test (R statisticallys analyze platform), analysis different genotype group boar single semen collection is effectively smart
Subnumber difference condition.
The disclosure has the beneficial effect that present disclose provides the relevant molecular genetic marker of the effective sperm count of a herd boar,
By detecting the molecular labeling, it can be applied to the breeding of herd boar semen production, select and remain the effective sperm count content of each semen collection
High homozygous boar can effectively improve effective sperm quantity by lasting breeding, accelerate the breeding progress of high-quality boar.
Detailed description of the invention
By the way that the embodiment in conjunction with shown by attached drawing is described in detail, above-mentioned and other features of the disclosure will
More obvious, identical reference label indicates the same or similar element in disclosure attached drawing, it should be apparent that, it is described below
Attached drawing be only some embodiments of the present disclosure, for those of ordinary skill in the art, do not making the creative labor
Under the premise of, it is also possible to obtain other drawings based on these drawings, in the accompanying drawings:
Fig. 1 show the method workflow of the relevant molecular genetic marker of the effective sperm count of one herd boar of screening of the disclosure
Cheng Tu；
Fig. 2 show the marker gene group position ALGA0123896 and the effective sperm count full-length genome SNP effect of single semen collection
Distribution.
Specific embodiment
It is carried out below with reference to technical effect of the embodiment and attached drawing to the design of the disclosure, specific structure and generation clear
Chu, complete description, to be completely understood by the purpose, scheme and effect of the disclosure.It should be noted that the case where not conflicting
Under, the features in the embodiments and the embodiments of the present application can be combined with each other.
As shown in Figure 1 for according to the method for the relevant molecular genetic marker of the effective sperm count of one herd boar of screening of the disclosure
Work flow diagram illustrates the relevant molecular genetic of the effective sperm count of one herd boar of screening according to the disclosure below with reference to Fig. 1
The method of label.
The method that the disclosure screens the relevant molecular genetic marker of the effective sperm count of a herd boar, specifically includes following step
It is rapid:
(1) phenotype-pedigree data acquisition
The basic research group of this patent is Duroc boars, all is from Guangxi scale boar station.Complete pedigree
In include 12 generations, 5284 boars, wherein had recorded between 2015-2018 2693 each semen collections of boar sperm volume,
4 sperm concentration, sperm motility, rate of teratosperm character phenotypic datas.Rate of teratosperm passes through UltiMateTM CASA
(Hamilton Thorne Inc., Beverly, MA, USA) system carries out analysis acquisition to fresh semen.It obtains in total
143114 sperm character observations (average every 53 data of boar), are used for phenotype-genotype association analysis.By above-mentioned
4 characters calculate the effective sperm count of single semen collection (hundred million), the calculation formula of the effective sperm count of single semen collection are as follows:
Effective sperm count=sperm volume × sperm concentration × sperm motility × (1- rate of teratosperm).
(2) Genotyping and quality control
The ear tissue sample or blood sample of 1733 boars are acquired, extracts total DNA, and use GGP 50k SNP
(GeneSeek, US) chip carries out Genotyping, obtains 50705 SNP markers of covering full-length genome.According to the pig of latest edition
With reference to genome (Sscrofall.1), using NCBI genome alignment program (https: //www.ncbi.nlm.nih.gov/)
The physical location of all SNP markers is updated.The unknown SNP of genomic locations is not used in association analysis.For all normal
SNP marker on chromosome carries out quality control, standard are as follows: individual recall rate >=90% using Plink software；SNP recall rate
>=90%；Small gene frequency >=0.01；Hardy-Weinberg equilibrium p value >=10-6.For deletion Genotype, using Beagle
Software (version 4.1) is filled.Based on the above quality control standard, remaining 1623 boars and 28289 SNP markers
For association analysis, wherein the effective sperm count phenotypic data of the existing single semen collection of 1231 boars, also there is genotype data.
(3) statistical model
In order to make full use of all phenotypic datas and genotype data, the invention patent is using the one-step method full genome weighted
Group correlation fractal dimension (weighted single step genome-wide association study, wssGWAS) carries out
Whole-genome association.This method is primarily based on Mixed model mixed to estimate individual breeding value, is then based on breeding value
Breeding value is converted to marker effect by the equivalence relation of model and marker effect model.The full-length genome association point that the present invention uses
It is as follows to analyse model:
Y=Xb+Za+Wp+Age+Intv+e,
Wherein, y is effective sperm count observation vector；X, Z and W are design matrix；B is that fixed effect vector is (overall equal
Value and year-Ji Xiaoying)；For breeding value vector；For the permanent environmental effect of individual；Age and
Monthly age and semen collection interval when Intv is respectively boar semen collection are covariant；For residual error.H is while integrating
The affiliation matrix of spectrum and SNP marker, inverse matrix calculation formula are as follows:
Wherein, A is the affiliation matrix based on pedigree；A22To there is the corresponding matrix in block form of genotype individuals in A；Gω=
0.9G+0.1A22,For the affiliation square based on full-length genome SNP marker, Z is small gene frequency
Genotype matrix after (minor allele frequency, MAF) correction, wherein 0-2p, 1-2p and 2-2p respectively represent AA,
Tri- kinds of genotype of Aa and aa, p are small gene frequency；D is diagonal matrix, indicates the weight of SNP；piIt is marked for i-th
Small gene frequency；M is marker number.
Corresponding above-mentioned mixed model, using AI-REML (average information restricted maximum
Likelihood) method estimate variance component, and breeding value is obtained by solving Mixed model mixed.It is obtained by way of iteration
Weight must be marked, key step is as follows:
Step 1: initialization (t=1), D(t)=I, G(t)=λ ZD(t)Z ',
Step 2: individual breeding value is calculated by ssGBLUP；
Step 3: pass through formulaIndividual breeding value is converted into SNP effect, whereinTo there is gene
The breeding value of type individual；
Step 4: formula is utilizedIt calculates SNP weight and is used for next round iteration；
Step 5: formula is utilizedSNP weight is standardized, to guarantee that variance is consistent；
Step 6: formula G is utilized(t+1)=λ ZD(t+1)Z ' calculating affiliation matrix is used for next round iteration；
Step 7: t=t+1, and the next round iteration since step 2 are enabled.
Above-mentioned steps iteration is three times, final to obtain SNP marker effect.The marker effect that third round iteration is exported is as most
Whole result.Calculating process mainly calls BLUPF90 software to realize by statisticalling analyze platform programming in R, wherein
AIREMLF90 program is used for variance component estimate, and BLUPF90 program is for calculating breeding value, and postGSf90 is for calculating label
Effect.
(4) label screening
Effect value markd for institute, takes its absolute value to draw Manhattan figure, shows and screen the SNP marker of big effect.
And using variance analysis and Multiple range test (R statisticallys analyze platform), analysis ALGA0123896 marks different genotype group boar
The effective sperm count difference condition of single semen collection.
Analyze the effective sperm count of different genotype boar single semen collection:
Effect value markd for institute, takes its absolute value to draw Manhattan figure, shows and screen the SNP marker of big effect
(as shown in Figure 2), Fig. 2 show the marker gene group position ALGA0123896 and the effective sperm count full-length genome SNP of single semen collection
Effect distribution.And using variance analysis and Multiple range test (R statisticallys analyze platform), analysis different genotype group boar single is adopted
Smart effectively sperm count difference condition (table 1).
The relevant molecular genetic marker of the effective sperm count of one herd boar is influencing the effective sperm count assisted Selection of boar sperm
In application:
The disclosure identifies the molecular labeling ALGA0123896 of an influence effective sperm count of boar sperm, can by table 1
Know, which has extremely significant difference, and (table 1 is that ALGA0123896 is marked not
The effective sperm count of homogenic type boar single semen collection)；
1 ALGA0123896 of table marks the effective sperm count of different genotype boar single semen collection
The effective sperm count of single semen collection differs 44.53 hundred million, C between ALGA0123896 marker genetype CC and TT boar individual
Allele significantly improves effective sperm count.
Herd boar breeding is assisted by detection ALGA0123896 marker genetype, can be entered by selecting and remain CC homozygosis boar
Boar station, improves effective sperm count, improves herd boar utilization efficiency.
The SNP molecular genetic marker (ALGA0123896 label) of the disclosure is located at chromosome 147528447bp of pig No. 2
It sets, which is that a T > C is mutated (mutational site), and the mutation is located on NC_010444 gene intron.The SNP molecule
The nucleotide sequence of the upstream and downstream 100bp in the mutational site of genetic marker is as follows:
5’-ATCAACTATGACTTTCTTTTCAGAAAAAAAGCAGCTGCAATTCTACACCAGGAATGCAGGTAATC
ACACTTAACAAGTAATATAGTGTCTGCTGCAGCTAR(T/C)TAAATCTCGTATTTTTCAACCTCACACAATGAATA
CTCCTCATCAATTAAAAGAAAAACAAAAACAACTGCAGTTCCCATTGCGGCTCAGTGGTAACGAA-3'；R is mutation
Site when the R at 101 nucleotide of above-mentioned sequence is T or C, i.e. when R (T/C), leads to above-mentioned sequence polymorphism；When above-mentioned core
When 101st nucleotide of nucleotide sequence is C, pig significantly improves effective sperm count, and 5 '-and -3 ' respectively indicate nucleotide sequence
5 ' end and 3 ' end.
(sequence such as sequence table SEQ IDNo.1 shown in nucleotide sequence of the above-mentioned sequence when being mutated point and being C), sequence
List SEQ IDNo.1 is that the present invention screens to obtain ALGA0123896 genetic marker (i.e. No. RS mutational site for rs81324094)
The nucleotide sequence of upstream and downstream 100bp.
Leading reference:
Beijing the boar room temperature of general bureau .GB23238-2009 sperm [S] 1. quality supervision and test are quarantined: Chinese Industrial Standards (CIS) is published
Society, 2009；
2. the reason of Cheng Huachu, Cui Xia, Wu Yunhua herd boar rate of teratosperm increase and the herding for the treatment of Countermeasures [J] China
Animal doctor's digest, 2017,33 (09): 70；
3.Hirschhorn,J.N.&Daly,M.J.Genome-wide association studies for common
diseases and complex traits.Nat.Rev.Genet.6,95–108(2005)；
4.De,R.,Bush,W.S.&Moore,J.H.Bioinformatics challenges in genome-wide
association studies(GWAS).Methods Mol.Biol.1168,63–81(2014)；
5.Purcell,S.et al.PLINK:A Tool Set for Whole-Genome Association and
Population-Based Linkage Analyses.Am.J.Hum.Genet.813,559–575(2007)；
6.WANG,H.,MISZTAL,I.,AGUILAR,I.LEGARRA,A.&MUIR,W.M.Genome-wide
association mapping including phenotypes from relatives without
genotypes.Genet Res94,73–83(2012)；
7.Wang,H.et al.Genome-wide association mapping including phenotypes
from relatives without genotypes in a single-step(ssGWAS)for 6-week body
weight in broiler chickens.Front.Genet.5,1–10(2014)；
8.Misztal,I.et al.BLUPF90and related programs(BGF90).in Proc.7th
World Congr.Genet.Appl.Livest.Prod.21–22(2002).doi:9782738010520；
9.Marques,D.B.D.D.et al.Weighted single-step GWAS and gene network
analysis reveal new candidate genes for semen traits in
pigs.Genet.Sel.Evol.50,1–14(2018)；
10.Kaewmala,K.et al.Association study and expression analysis of
CD9as candidate gene for boar sperm quality and fertility
traits.Anim.Reprod.Sci.125,170–179(2011)；
11.Kaewmala,K.et al.Investigation into association and expression of
PLCz and COX-2as candidate genes for boar sperm quality and
fertility.Reprod.Domest.Anim.47,213–223(2012)；
12.Gunawan,A.et al.Investigation on association and expression of
ESR2 as a candidate gene for boar sperm quality and
fertility.Reprod.Domest.Anim.47,782–790(2012)；
13.Diniz,D.B.et al.A genome-wide association study reveals a novel
candidate gene for sperm motility in pigs.Anim.Reprod.Sci.151,201–207(2014)。
Sequence table
<110>Foshan Science &. Technology College
The relevant molecular genetic marker of<120>the one effective sperm counts of herd boar
<141> 2019-06-05
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 201
<212> DNA
<213> Sscrofa10.2
<220>
<221> gene
<222> (1)..(201)
<220>
<221> mutation
<222> (101)..(101)
<400> 1
atcaactatg actttctttt cagaaaaaaa gcagctgcaa ttctacacca ggaatgcagg 60
taatcacact taacaagtaa tatagtgtct gctgcagcta ctaaatctcg tatttttcaa 120
cctcacacaa tgaatactcc tcatcaatta aaagaaaaac aaaaacaact gcagttccca 180
ttgcggctca gtggtaacga a 201
Claims (5)
1. the relevant molecular genetic marker of the effective sperm count of a herd boar, which is characterized in that the molecular genetic marker is SNP points
Sub- genetic marker, SNP molecular genetic marker are located at No. 2 positions chromosome 147528447bp of pig, belong in NC_010444 gene
Containing subsequence, position is the mutational site of T > C mutation, and pig is Sscrofa11.1 with reference to genome.
2. the relevant molecular genetic marker of the effective sperm count of a herd boar according to claim 1, which is characterized in that described
The sequence of SNP molecular genetic marker is the upstream and downstream 100bp sequence in mutational site.
3. the relevant molecular genetic marker of the effective sperm count of a herd boar according to claim 2, which is characterized in that described
The sequence of SNP molecular genetic marker is as shown below:
5’-ATCAACTATGACTTTCTTTTCAGAAAAAAAGCAGCTGCAATTCTACACCAGGAATGCAGGTAATCACAC
TTAACAAGTAATATAGTGTCTGCTGCAGCTARTAAATCTCGTATTTTTCAACCTCACACAATGAATACTCCTCATC
AATTAAAAGAAAAACAAAAACAACTGCAGTTCCCATTGCGGCTCAGTGGTAACGAA -3 ', wherein R is mutational site,
When R is C, pig significantly improves effective sperm count.
4. the relevant molecular genetic marker of the effective sperm count of a herd boar as claimed in claim 3 is to influence boar sperm effectively smart
Application in subnumber assisted Selection.
5. molecular genetic marker according to claim 4 is influencing answering in the effective sperm count assisted Selection of boar sperm
With, which is characterized in that molecular genetic marker is SNP molecular genetic marker ALGA0123896, ALGA0123896 marker genetype
The effective sperm count of single semen collection differs 44.53 hundred million, C allele and significantly improves effective sperm count between CC and TT boar individual, selects
The CC genotype homozygosis pig for staying the effective sperm count content of each semen collection high can effectively improve effective sperm count by lasting breeding
Amount, accelerates the breeding progress of high-quality boar.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910489838.4A CN110273006B (en) | 2019-06-06 | 2019-06-06 | Boar effective sperm number related molecular genetic marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910489838.4A CN110273006B (en) | 2019-06-06 | 2019-06-06 | Boar effective sperm number related molecular genetic marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110273006A true CN110273006A (en) | 2019-09-24 |
| CN110273006B CN110273006B (en) | 2023-03-28 |
Family
ID=67961927
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910489838.4A Active CN110273006B (en) | 2019-06-06 | 2019-06-06 | Boar effective sperm number related molecular genetic marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110273006B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724745A (en) * | 2019-10-18 | 2020-01-24 | 佛山科学技术学院 | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof |
| CN116463413A (en) * | 2023-06-12 | 2023-07-21 | 佛山科学技术学院 | Molecular marker of WWOX gene related to pig venereal disease and application thereof |
| CN116769933A (en) * | 2023-07-24 | 2023-09-19 | 中国农业大学 | SNP combination related to boar semen character, application thereof and excavation method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007133075A2 (en) * | 2006-05-12 | 2007-11-22 | Institute For Pig Genetics B.V. | Igf2 marker assisted selection for porcine reproductive traits |
| CN106544412A (en) * | 2016-08-30 | 2017-03-29 | 华中农业大学 | A kind of molecular marker related to sperm motility of boars character and application |
| CN107144518A (en) * | 2017-05-03 | 2017-09-08 | 安徽省农业科学院畜牧兽医研究所 | A kind of detection method of the effective sperm count of pig semen |
| CN109554487A (en) * | 2019-01-19 | 2019-04-02 | 华中农业大学 | A kind of molecular labeling and application with boar semen amount trait associations |
| CN109576380A (en) * | 2019-01-19 | 2019-04-05 | 华中农业大学 | One kind molecular labeling relevant to sperm motility of boars and total sperm count and application |
| CN109837348A (en) * | 2019-01-19 | 2019-06-04 | 华中农业大学 | A kind of molecular labeling with boar sperm concentration trait associations |
-
2019
- 2019-06-06 CN CN201910489838.4A patent/CN110273006B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007133075A2 (en) * | 2006-05-12 | 2007-11-22 | Institute For Pig Genetics B.V. | Igf2 marker assisted selection for porcine reproductive traits |
| CN106544412A (en) * | 2016-08-30 | 2017-03-29 | 华中农业大学 | A kind of molecular marker related to sperm motility of boars character and application |
| CN107144518A (en) * | 2017-05-03 | 2017-09-08 | 安徽省农业科学院畜牧兽医研究所 | A kind of detection method of the effective sperm count of pig semen |
| CN109554487A (en) * | 2019-01-19 | 2019-04-02 | 华中农业大学 | A kind of molecular labeling and application with boar semen amount trait associations |
| CN109576380A (en) * | 2019-01-19 | 2019-04-05 | 华中农业大学 | One kind molecular labeling relevant to sperm motility of boars and total sperm count and application |
| CN109837348A (en) * | 2019-01-19 | 2019-06-04 | 华中农业大学 | A kind of molecular labeling with boar sperm concentration trait associations |
Non-Patent Citations (3)
| Title |
|---|
| A GUNAWAN 等: "Investigation on association and expression of ESR2 as a candidate gene for boar sperm quality and fertility", 《REPROD DOMEST ANIM》 * |
| NULL: "rs81324094", 《ENSEMBL》 * |
| 张腾 等: "暑热季节采用10cm适度深部输精与常规输精研究不同剂量和有效精子数对丹系大白母猪繁殖性能的影响", 《养猪》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724745A (en) * | 2019-10-18 | 2020-01-24 | 佛山科学技术学院 | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof |
| CN110724745B (en) * | 2019-10-18 | 2023-01-24 | 佛山科学技术学院 | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof |
| CN116463413A (en) * | 2023-06-12 | 2023-07-21 | 佛山科学技术学院 | Molecular marker of WWOX gene related to pig venereal disease and application thereof |
| CN116463413B (en) * | 2023-06-12 | 2023-10-03 | 佛山科学技术学院 | Molecular marker of WWOX gene related to pig venereal disease and application thereof |
| CN116769933A (en) * | 2023-07-24 | 2023-09-19 | 中国农业大学 | SNP combination related to boar semen character, application thereof and excavation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110273006B (en) | 2023-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107967409B (en) | Pig whole genome low-density SNP chip and manufacturing method and application thereof | |
| CN110218799A (en) | The molecular genetic marker of pig residue feed intake character and application | |
| CN110273006A (en) | The relevant molecular genetic marker of the effective sperm count of one herd boar | |
| CN110358840A (en) | The SNP molecular genetic marker of TPP2 gene relevant to remaining feed intake | |
| CN114686605B (en) | Genetic marker for evaluating boar semen quality, screening method and application | |
| CN110295236A (en) | The SNP molecular genetic marker of pannage conversion ratio | |
| Qiao et al. | Population genetic structure analysis and identification of backfat thickness loci of Chinese synthetic Yunan pigs | |
| CN110358839A (en) | The SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio | |
| CN110358838A (en) | SNP genetic marker relevant to pannage conversion in FA2H genetic fragment | |
| US20240043912A1 (en) | Genomic selection (gs) breeding chip of huaxi cattle and use thereof | |
| CN112575096A (en) | SNP molecular marker related to total papilla number of large white pigs and acquisition method thereof | |
| CN110273007B (en) | SNP (Single nucleotide polymorphism) marker related to effective sperm number of boar as well as obtaining method and application thereof | |
| CN110144414A (en) | Molecular genetic marker relevant to boar sperm abnormal rate and its application and acquisition methods | |
| CN114736974B (en) | SNP molecular marker related to sow labor traits and application thereof | |
| CN110714085A (en) | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof | |
| CN114752678B (en) | SNP molecular marker related to backfat thickness of pig reaching 115kg body weight and application thereof | |
| CN113322333B (en) | CNV molecular marker combination related to Guangxi hemp chicken body size and slaughter traits based on whole genome sequencing screening and application | |
| CN110878363B (en) | Detection method and application of correlation between VIPR1 gene and chicken testicular character | |
| CN111004851B (en) | Detection method and application of correlation between VIPR1 gene and cock body quality and slaughter trait | |
| CN110724745B (en) | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof | |
| CN112779339A (en) | SNP molecular marker related to total papilla number of large white pigs as well as acquisition and application thereof | |
| CN110195116A (en) | One kind molecular genetic marker relevant to sperm motility of boars and its application and acquisition methods | |
| CN117904317B (en) | SNP molecular marker combination for detecting propagation traits of Nile-Lafei buffalo and application | |
| CN114521533B (en) | Black pig core group re-selection breeding method | |
| CN114736975B (en) | SNP molecular marker related to sow litter size traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |