CN114686605B - Genetic marker for evaluating boar semen quality, screening method and application - Google Patents
Genetic marker for evaluating boar semen quality, screening method and application Download PDFInfo
- Publication number
- CN114686605B CN114686605B CN202210614168.6A CN202210614168A CN114686605B CN 114686605 B CN114686605 B CN 114686605B CN 202210614168 A CN202210614168 A CN 202210614168A CN 114686605 B CN114686605 B CN 114686605B
- Authority
- CN
- China
- Prior art keywords
- boar
- genetic marker
- pig
- semen
- boars
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention relates to a genetic marker for evaluating boar semen quality, a screening method and application, and relates to the technical field of animal molecular breeding. The genetic marker is an SNP molecular marker, and the genetic marker is positioned at 33671231bp position of pig chromosome 9 or 38067414bp position of pig chromosome 1. According to the genetic marker, the boar semen quality evaluation and boar breeding are carried out, so that the sperm activity can be effectively improved, the sperm aberration rate is reduced, the genetic improvement speed of the boar semen quality is accelerated, and the generation interval is shortened.
Description
Technical Field
The invention relates to the technical field of animal molecular breeding, in particular to a genetic marker for evaluating boar semen quality, a screening method and application.
Background
In recent years, artificial insemination technology has been widely implemented with the maturity of the technology for preserving boar semen at normal temperature. Compared with the traditional mating technology, the artificial insemination has the advantages of reducing disease spread, improving the proportion of male and female animals, accelerating genetic progress and the like. The high-quality semen of the excellent boars can provide excellent genetic resources and improve the fertility of sows and the success rate of artificial insemination. The semen quality is often detected before mating, and is evaluated, so that the individual genetic potential is optimized.
Sperm motility and sperm aberration rate are important indexes for semen quality detection, low sperm motility is a common reason for semen disqualification, and common sperm malformation types include giant sperm, short sperm, broken tail, broken head, acrosome shedding, protoplasm, large head, double heads, double tails, broken tail and the like. The total sperm number and the effective sperm number of each semen of the boar can be obviously influenced by the sperm motility, so that the economic benefit of a commercial boar station is influenced, the semen hybridization with high aberration rate can bring certain damage to the reproductive performance of the sows, and the effective sperm number of each semen can be influenced by the sperm aberration rate, so that the dosage of each semen is influenced. Therefore, for a commercial boar station, the sperm motility can be improved, the semen qualification rate can be effectively improved, the sperm aberration rate can be reduced, the dosage of each semen can be effectively improved, the semen quality can be improved, the production cost can be reduced, and the economic benefit can be improved.
The conventional boar breeding method comprises the steps of raising boars to sexual maturity, carrying out induced climbing, collecting semen, and carrying out semen quality detection, wherein the common semen quality detection indexes comprise semen volume, semen density, semen vitality and semen aberration rate. Wherein, the sperm motility mainly depends on the auxiliary detection of a Computer Aided System (CASA). And then, scoring the boar semen according to the quality of the boar semen, wherein the common standard is that the sperm activity is lower than 70%, the semen with the sperm aberration rate higher than 20% is considered as unqualified semen, and boars which produce the unqualified semen for many times are eliminated. However, because the sexual maturity of boars is generally 6-8 months old, the breeding method commonly used at present is to carry out breeding according to the semen character, and the semen phenotype record data can be obtained at least after the sexual maturity of the boars for screening and elimination when the breeding of the semen character is carried out, so the breeding generation interval is longer, and the genetic improvement progress is slower.
Disclosure of Invention
Aiming at the problems, the invention provides a genetic marker for evaluating the boar semen quality, and the evaluation of the boar semen quality and the breeding of breeding boars are carried out according to the genetic marker, so that the sperm activity can be effectively improved, the sperm aberration rate can be reduced, the genetic improvement speed of the boar semen quality can be accelerated, and the generation interval can be shortened.
In order to achieve the above object, the present invention provides a genetic marker for evaluating boar semen quality, wherein the genetic marker is an SNP molecular marker, and the genetic marker is located at 33671231bp position of pig chromosome 9 or 38067414bp position of pig chromosome 1.
Because the boar semen quality is the character of low-medium heritability, a plurality of genes are used for regulation and control, and the major genes are difficult to be excavated by adopting the conventional genetic means. The whole genome association analysis is based on high-density SNP information covering the whole genome and character phenotype record of a large population, and accurately positions related sites and genes, and although certain defects exist, the whole genome association analysis is widely applied to key gene positioning of human complex diseases and important economic characters of livestock and poultry. With the declining price of low-density chip detection, genome-wide association analysis of large populations is promoted. Classical genome-wide association analysis is generally based on single-marker regression analysis of all markers individually by software such as Plink, followed by setting a significance threshold to screen for significant sites. The method often faces the problems of high calculation intensity, excessively high estimation marking effect, unreasonable setting of significance threshold, high false positive rate of results and the like. To further improve the efficiency of genome-wide association analysis, the inventors performed the analysis using the FarmCPU model in rMVP software. The method utilizes the fixed effect and the random effect to be mixed and used alternately, can quickly and accurately screen the SNP molecular marker related to the sperm motility character, effectively reduces the false positive rate of the whole genome correlation analysis result, and has important significance for improving the boar semen quality. The inventor utilizes a gene chip detection technology to carry out GWAS research on a pig group, quickly screens genetic markers which can be used for evaluating the sperm quality of boars, successfully screens large-effect molecular genetic markers which influence the sperm motility and the sperm aberration rate of the boars, and provides a favorable theoretical basis for the molecular breeding of the boars.
In one embodiment, the genetic marker is located at 33671231bp position of pig chromosome 9, and when the genetic marker is G, the genetic marker indicates that the sperm motility of the boar to be evaluated is high;
or the genetic marker is located at 38067414bp position of pig No. 1 chromosome, and when the genetic marker is A, the sperm teratospermia of the boar to be evaluated is low.
The invention also provides a gene sequence for evaluating the boar semen quality, which comprises the genetic marker;
when the genetic marker is located at 33671231bp position of pig chromosome 9, the gene sequence is as follows:
5 '-GCTTAACATTTAATCTGTTCACATACATTTTTCAAATGATACCTTGGGGCGAGGAGGCAAAGGAGAAAAAAATAGCTGTATTGCTTTACAAGGCAAAGGA (SEQ ID NO: 1) -E-GGTAACAGCAGGCTAATGCCTTAAAGACTGTGCTCCCCTTAGGAGAGATTGGGAGGTAGGTTTATAGTTTGCGGGAGTGAAAGATAGGGCTGCACATAAG-' 3 (SEQ ID NO: 2), wherein E is the mutation site of the genetic marker;
when the genetic marker is located at 38067414bp position of pig No. 1 chromosome, the gene sequence is as follows:
5 '-GCTGGCTCCTTATGGAAAGCTAGTACATTGGTGATAACATGAAATCAACTAAAAGCGCAATGATCATGCCCTCATGTTTTCTTTAAAATAAGCACCCATC (SEQ ID NO: 3) -F-TCTTAGTTATGTCTTATGAAACATTCTGATGGGCAAAGAAAAAGTTGAGGCAAAGGGCAGGATACAGAACAGAAAATAGCAAATATCTAGATGGCTCACA-' 3 (SEQ ID NO: 4), wherein F is the mutation site of the genetic marker.
The invention also provides a method for evaluating the boar semen quality, which comprises the steps of obtaining the detection result of the genetic marker and judging the boar semen quality according to the detection result.
In one embodiment, the genetic marker is located at 33671231bp position of pig chromosome 9, and when the genetic marker is G, the sperm motility of the boar is judged to be high.
In one embodiment, the genetic marker is located at 38067414bp position of pig No. 1 chromosome, and when the genetic marker is A, the sperm teratogenesis rate of the boar is judged to be low.
The invention also provides a boar breeding method, detection is carried out according to the method, the semen quality of the boar is judged according to the genotype of the genetic marker, and the boar with high semen quality is reserved; the genetic markers are located at the following positions: 33671231bp position of pig chromosome 9 or 38067414bp position of pig chromosome 1.
In one embodiment, the genetic marker is located at 33671231bp position of pig chromosome 9, and when the genotype of the genetic marker is GG, the sperm motility of the boar is judged to be high, and the boar is reserved; the boar is a Changbai pig.
The different genotypes of the genetic markers have obvious difference in the semen quality of the boars, wherein in the Changbai pig group, the sperm motility of the boars with the genotype of GG of the genetic markers is higher than that of the boars with the genotypes of AG and AA of the genetic markers, and the boars with the genotype of GG of the genetic markers are selected and reserved, so that the sperm motility of the boars can be effectively improved, the genetic improvement speed of the semen quality of the boars is accelerated, and the generation interval is shortened.
In one embodiment, the genetic marker is located at 38067414bp position of pig No. 1 chromosome, and when the genotype of the genetic marker is AA, the sperm teratogenesis rate of the boar is judged to be low, and the boar is reserved; the boar is a Changbai pig.
The different genotypes of the genetic markers have obvious difference in the semen quality of the boars, wherein in the long and white pig group, the sperm distortion rate of the boars with the genotypes of the genetic markers AA is lower than that of the boars with the genotypes of the genetic markers AG and GG, and the boars with the genotypes of the genetic markers AA are selected and reserved, so that the sperm distortion rate of the boars can be effectively reduced, the genetic improvement speed of the semen quality of the boars is accelerated, and the generation interval is shortened.
The invention also provides a screening method of the genetic marker, which comprises the following steps:
collecting phenotype data: collecting the phenotype data of the semen character of the pig to be detected;
obtaining SNP molecular markers: sampling the pig to be detected, extracting DNA, genotyping to obtain an SNP molecular marker covering the whole genome; carrying out physical position updating and quality control on the SNP molecular marker covering the whole genome;
and (3) data analysis: and (3) carrying out whole genome association analysis on the SNP molecular marker after quality control by combining the phenotype data, analyzing the difference condition of the semen quality of the pigs with different genotype groups, and screening to obtain the SNP molecular marker for evaluating the semen quality of the boars.
Compared with the prior art, the invention has the following beneficial effects:
the genetic marker, the screening method and the application for evaluating the boar semen quality have the advantages that the boars with different genotypes of the genetic marker have obvious difference in semen quality, the boars are selected and retained according to the genetic marker, the homozygous boars with high sperm motility or low sperm aberration rate are reserved, the semen quality can be effectively improved, the evaluation and the selection of the semen quality can be carried out after the sexual maturity of the boars as in the traditional breeding method, the genetic improvement speed of the boar semen quality can be accelerated, and the generation interval is shortened.
Drawings
FIG. 1 shows the ASGA0042475 marker genome location and the single semen collection sperm motility whole genome SNP effect distribution in example 1;
FIG. 2 shows the distribution of the genome-wide SNP effects of the DRGA0000604 marker genome location and single semen collection sperm teratospermia rate in example 1.
Detailed Description
To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
Defining:
SNP molecular markers: refers to the variation of a single nucleotide on the genome, resulting in a genetic marker.
The source is as follows:
GGP 50k SNP（GeneSeek，US）。
reagents, materials and equipment used in the embodiment are all commercially available sources unless otherwise specified; unless otherwise specified, all the experimental methods are routine in the art.
Example 1
A genetic marker for assessing boar semen quality.
The genetic marker was obtained by the following screening method.
1. Phenotype-pedigree data acquisition.
The basic study population for this example was a Changbai boar, all from Yang Xiang GmbH, Guangxi.
The complete pedigree comprises 12 generations of 5107 boars, wherein the characteristic phenotype data of 4 semen volume, density, vitality and sperm abnormality rate of 2216 boars at each semen collection are recorded in 2016-2021.
Sperm motility was obtained by analysis of fresh semen using the UltiMateTM CASA (Hamilton Thorne inc., Beverly, MA, USA) system; sperm teratogenicity was obtained by analysis of fresh semen using the UlltiMateTM CASA (Hamilton Thorne Inc., Beverly, MA, USA) system.
A total of 227134 observations of the semen trait were obtained (average of 102 data per boar).
2. Genotyping and quality control.
Collecting ear tissue samples or blood samples of 1349 boars, extracting total DNA, and carrying out genotyping by adopting GGP 50k SNP chip to obtain 50697 SNP markers covering the whole genome.
The physical location of all SNP markers was updated using the NCBI genome alignment program (https:// www.ncbi.nlm.nih.gov /) according to the latest version of the pig reference genome (Sstcofa 11.1). SNPs with unknown genomic positions were not used for association analysis. For SNP markers on all autosomes, quality control was performed using the Plink software, with the criteria: the individual detection rate is more than or equal to 90 percent; the SNP detection rate is more than or equal to 90 percent; the minimum allele frequency is more than or equal to 0.01; the Hardy-Weinberg equilibrium p value is more than or equal to 10 -6 . For deletion genotypes, filling in was performed using Beagle software (version 4.1). And (4) quality control is carried out again after filling, and the quality control conditions are completely the same as the above. Based on the above quality control criteria, 1238 boars and 43875 SNP markers remained for association analysis.
3. And (5) carrying out a statistical model.
Genome wide association analysis (GWAS) was performed using the rMVP package in the R statistical environment using a multi-label association model approach. The method comprises the steps of firstly, estimating a breeding value by utilizing a DMUAI module of DMU software based on a traditional optimal linear unbiased estimation method (BLUP), and then calculating an inverse regression breeding value (DEBV) of a boar individual.
The statistical model of BLUP is as follows:
y=Xb+Za+Wp+Age+Intv+e
wherein: y is a sperm motility observation value vector, b is a fixed effect vector comprising two effects of field-year-season and strain, a is an individual random additive effect vector, pe is a permanent environment effect vector, and X, Z, W is a matrix corresponding to b, a and p respectively. Age and Intv are respectively the boar semen collection Age and the interval between two adjacent semen collections, and are used as covariates, and e is a residual error.
The DEBV value calculation is based on the following formula:
DEBV=PA+(EBV-PA)/REL
wherein: PA is the mean breeding value of the male and female parents, EBV is the individual breeding value, REL is the reliability of the breeding value, SE (g) i ) 2 In order to be a standard error of the breeding value,
is the additive effect variance.
The GWAS analysis model is as follows:
Y n =T ni W i +P nj Q j +e n
wherein, Y n A table-type value vector, T, representing the nth individual ni The genotype of i pseudo QTNs and the first five main components controlling the genetic background of the population are fixed effects; w i Representing the corresponding effect; p nj A jth tag representing an nth individual; q j Represents the jth corresponding effect; e.g. of the type n Representing the residual vector, obeying a normal distribution,
representing the residual variance.
4. And (4) marker screening.
And (3) regarding the effect values of all the markers, taking the absolute values of the effect values to draw a Manhattan graph, and displaying and screening the SNP markers with large effects.
5. And (4) screening markers.
According to the analysis results obtained by the steps, the semen quality of boars with different genotypes marked by the ASGA0042475 and the DRGA0000604 is found to have obvious difference, so that the genetic marker ASGA0042475 and the genetic marker DRGA0000604 obtained by primary screening are related to the semen quality of boars.
(1) The results of analyzing the difference of single semen collection sperm motility of boars marked with different genotype groups by ASGA0042475 are shown in figure 1.
The ASGA0042475 marker is located on pig chromosome 9 at position 33671231bp, which is a G > a mutation (sscrofa 11.1). The 100bp sequences of the upstream and downstream of the SNP molecular marker are shown as follows:
5’-GCTTAACATTTAATCTGTTCACATACATTTTTCAAATGATACCTTGGGGCGAGGAGGCAAAGGAGAAAAAAATAGCTGTATTGCTTTACAAGGCAAAGGA（SEQ ID NO:1）-E-GGTAACAGCAGGCTAATGCCTTAAAGACTGTGCTCCCCTTAGGAGAGATTGGGAGGTAGGTTTATAGTTTGCGGGAGTGAAAGATAGGGCTGCACATAAG-’3（SEQ ID NO:2）。
the mutation wherein E at the 101 th base is A or G results in polymorphism of the nucleotide sequence.
The ASGA0042475 marker different genotype boars were analyzed for single semen collection sperm motility, and the results are shown in the following table.
TABLE 1 ASGA0042475 marker Single semen collection sperm motility of boars with different genotypes
The data in the embodiment are obtained under the same detection process, and the data recording amount is large, so that the sperm motility differences corresponding to different genotypes are obvious; in the actual production process, one boar can obtain 40-100 parts of 60mL diluted boar semen by single dilution, the effective sperm number generated by the GG genotype boar can be 2.3% higher than that generated by the AA genotype boar on the premise of the same sperm volume, sperm concentration and sperm aberration rate due to the different genotype sperm motility differences, and the part of the diluted boar semen is improved by 1-2 parts.
(2) The result of analyzing the difference of sperm teratospermia of a single semen collection sperm of a boar marked with different genotype groups by DRGA0000604 is shown in figure 2.
The DRGA0000604 marker is located on pig chromosome 1 at position 38067414bp, a G > a mutation (sscrofa 11.1). This mutation is located in the intron of the NKAIN2 gene. The 100bp sequences of the upstream and downstream of the SNP molecular marker are shown as follows:
5’-GCTGGCTCCTTATGGAAAGCTAGTACATTGGTGATAACATGAAATCAACTAAAAGCGCAATGATCATGCCCTCATGTTTTCTTTAAAATAAGCACCCATC（SEQ ID NO:3）-F-TCTTAGTTATGTCTTATGAAACATTCTGATGGGCAAAGAAAAAGTTGAGGCAAAGGGCAGGATACAGAACAGAAAATAGCAAATATCTAGATGGCTCACA-’3（SEQ ID NO:4）。
f at the above 101 base is A or G, and this mutation results in polymorphism of the above sequence nucleotide.
DRGA0000604 marks the single semen collection sperm teratogenesis rate of different genotypes of boars, and the results are shown in the following table.
TABLE 2 DRGA0000604 marker single semen collection sperm teratogenesis rate of boars with different genotypes
6. And (6) analyzing results.
(1) The sperm motility of the boar with the genotype of GG marked by ASGA0042475 is higher than that of the boar with the genotype of AG and AA marked by the genetic marker, and the boar with the genotype of GG marked by the genetic marker is selected and retained, so that the sperm motility of the boar can be effectively improved, the genetic improvement speed of the boar semen quality is accelerated, and the generation interval is shortened.
(2) The sperm aberration rate of the boar with the genotype of AA marked by DRGA0000604 is lower than that of the boar with the genotype of AG and GG marked by the genetic marker, and the boar with the genotype of AA marked by the genetic marker is selected and reserved, so that the sperm aberration rate of the boar can be effectively reduced, the genetic improvement speed of the boar semen quality is accelerated, and the generation interval is shortened.
Therefore, the 2 genetic markers are used for evaluating the boar semen quality and breeding the boars, the selection can be carried out on the boars at the early stage, the semen quality evaluation and selection can be carried out only after the sexual maturity of the boars, the generation interval is shortened, and the genetic improvement speed of the boar semen property is accelerated.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> institute of Buddha science and technology
<120> genetic marker for evaluating boar semen quality, screening method and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcttaacatt taatctgttc acatacattt ttcaaatgat accttggggc gaggaggcaa 60
aggagaaaaa aatagctgta ttgctttaca aggcaaagga 100
<210> 2
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggtaacagca ggctaatgcc ttaaagactg tgctcccctt aggagagatt gggaggtagg 60
tttatagttt gcgggagtga aagatagggc tgcacataag 100
<210> 3
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gctggctcct tatggaaagc tagtacattg gtgataacat gaaatcaact aaaagcgcaa 60
tgatcatgcc ctcatgtttt ctttaaaata agcacccatc 100
<210> 4
<211> 100
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tcttagttat gtcttatgaa acattctgat gggcaaagaa aaagttgagg caaagggcag 60
gatacagaac agaaaatagc aaatatctag atggctcaca 100
Claims (4)
1. A method for evaluating the semen quality of boars is characterized by comprising the steps of obtaining the detection result of a genetic marker and judging the semen quality of boars according to the detection result; the boar is a long white pig, the genetic marker is an SNP molecular marker, the genetic marker is positioned at 33671231bp position of pig chromosome 9 or 38067414bp position of pig chromosome 1, and the pig reference genome is Sscrofa 11.1;
the genetic marker is located at 33671231bp position of pig No. 9 chromosome, and when the genotype of the genetic marker is GG, the sperm motility of the boar is high, and the boar semen quality is high;
or the genetic marker is located at 38067414bp position of pig No. 1 chromosome, and when the genotype of the genetic marker is AA, the sperm aberration rate of the boar is judged to be low, and the boar semen quality is judged to be high.
2. A breeding method of boars, characterized in that the method of claim 1 is used for detection, the semen quality of boars is judged according to the genotype of genetic markers, and boars with high semen quality are reserved; the boar is a Changbai pig, the genetic marker is an SNP molecular marker, and the genetic marker is located at the following positions: the 33671231bp position of the pig chromosome 9 or the 38067414bp position of the pig chromosome 1, and the Sscrofa11.1 reference genome of the pig.
3. The breeding method according to claim 2, wherein the genetic marker is located on 33671231bp of pig chromosome 9, and when the genotype of the genetic marker is GG, the sperm motility of the boar is judged to be high, and the boar is reserved.
4. The breeding method according to claim 2, wherein the genetic marker is located at 38067414bp of pig No. 1 chromosome, and when the genotype of the genetic marker is AA, the sperm aberration rate of the boar is judged to be low, and the boar is reserved.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210614168.6A CN114686605B (en) | 2022-06-01 | 2022-06-01 | Genetic marker for evaluating boar semen quality, screening method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210614168.6A CN114686605B (en) | 2022-06-01 | 2022-06-01 | Genetic marker for evaluating boar semen quality, screening method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114686605A CN114686605A (en) | 2022-07-01 |
| CN114686605B true CN114686605B (en) | 2022-08-09 |
Family
ID=82131087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210614168.6A Active CN114686605B (en) | 2022-06-01 | 2022-06-01 | Genetic marker for evaluating boar semen quality, screening method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114686605B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116042849B (en) * | 2022-11-09 | 2023-11-17 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
| CN116004855B (en) * | 2023-01-17 | 2023-08-08 | 佛山科学技术学院 | Molecular marker related to mitochondrial membrane potential of Duroc pig sperm and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576380A (en) * | 2019-01-19 | 2019-04-05 | 华中农业大学 | One kind molecular labeling relevant to sperm motility of boars and total sperm count and application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110273007B (en) * | 2019-06-27 | 2022-11-18 | 广西贵港秀博基因科技股份有限公司 | SNP (Single nucleotide polymorphism) marker related to effective sperm number of boar as well as obtaining method and application thereof |
| CN110144414B (en) * | 2019-06-27 | 2022-11-18 | 广西贵港秀博基因科技股份有限公司 | Molecular genetic marker related to boar sperm teratospermia and application and acquisition method thereof |
-
2022
- 2022-06-01 CN CN202210614168.6A patent/CN114686605B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576380A (en) * | 2019-01-19 | 2019-04-05 | 华中农业大学 | One kind molecular labeling relevant to sperm motility of boars and total sperm count and application |
Non-Patent Citations (1)
| Title |
|---|
| 猪繁殖相关性状遗传标记研究进展;赵志超等;《猪业科学》;20110825(第08期);第46-48页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114686605A (en) | 2022-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114686605B (en) | Genetic marker for evaluating boar semen quality, screening method and application | |
| CN110218799B (en) | Molecular genetic marker for pig residual feed intake traits and application thereof | |
| CN114292928B (en) | Molecular marker related to sow breeding traits and screening method and application | |
| CN110358840B (en) | SNP molecular genetic marker of TPP2 gene related to residual feed intake | |
| CN111243667B (en) | Western Hua cattle genome selection method | |
| CN109355398B (en) | SNP (Single nucleotide polymorphism) marker primer related to number of live piglets born by Erhualian pig and application of SNP marker primer | |
| CN110358839B (en) | SNP molecular genetic marker of GCKR gene related to pig feed conversion rate | |
| CN113564264B (en) | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirth and litter size of sow and application thereof | |
| CN112575096B (en) | SNP molecular marker related to total nipple number of large white pigs and acquisition method thereof | |
| CN117385045B (en) | Application of goat AMHR2 gene as lambing number-associated molecular marker | |
| CN110273006B (en) | Boar effective sperm number related molecular genetic marker | |
| CN110144414B (en) | Molecular genetic marker related to boar sperm teratospermia and application and acquisition method thereof | |
| CN111370058B (en) | Method for tracing buffalo blood line source and carrying out genome matching based on whole genome SNP information | |
| CN110714085A (en) | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof | |
| CN114292927B (en) | Molecular marker related to sow farrowing uniformity and obtaining method and application thereof | |
| CN114736974B (en) | SNP molecular marker related to sow labor traits and application thereof | |
| CN110195116B (en) | Boar sperm motility related molecular genetic marker and application and acquisition method thereof | |
| CN110724745B (en) | Molecular genetic marker related to pig sperm teratogenesis rate and application thereof | |
| CN112779339A (en) | SNP molecular marker related to total papilla number of large white pigs as well as acquisition and application thereof | |
| CN113549699A (en) | Genome selection method for egg number of white feather broilers | |
| CN111455071A (en) | Detection method and application of SNP (single nucleotide polymorphism) marker on chromosome 8 of pig related to total number born of all births of Erhualian pig | |
| CN117987568A (en) | SNP molecular marker related to swine sperm count character and application thereof | |
| CN112725463B (en) | SNP molecular marker related to total nipple number of long white pigs, application and acquisition method thereof | |
| CN112877443B (en) | SNP molecular marker related to total nipple number of long white pigs and acquisition and application thereof | |
| CN116042849B (en) | Genetic marker for assessing pig feed intake and screening method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |