CN110358839A - The SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio - Google Patents
The SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio Download PDFInfo
- Publication number
- CN110358839A CN110358839A CN201910489896.7A CN201910489896A CN110358839A CN 110358839 A CN110358839 A CN 110358839A CN 201910489896 A CN201910489896 A CN 201910489896A CN 110358839 A CN110358839 A CN 110358839A
- Authority
- CN
- China
- Prior art keywords
- weight gain
- feed
- genetic marker
- snp
- molecular genetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The disclosure provides the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio, the molecular labeling DIAS0000543 of boar feed weight gain ratio is influenced by identification one, there were significant differences for the feed weight gain ratio of the label different genotype boar, and the weight gain of boar feed is carried out than the association analysis with full-length genome molecular genetic marker, the big effector molecule genetic marker for influencing pannage weight gain ratio is screened in success, enter core group by selecting and remain AA homozygosis boar, feed weight gain ratio is reduced, feed consumption and aquaculture cost are effectively reduced；Frequently GG genotype individuals are low for the feed weight gain of AA genotype individuals, by selecting and remain the homozygous pig of low feed weight gain ratio, can effectively reduce feed consumption in production process, improve Business Economic Benefit and competitiveness.
Description
Technical field
This disclosure relates to pig gene technical field, in particular to GCKR gene relevant to pannage conversion ratio
SNP molecular genetic marker.
Background technique
The feed efficiency economic characters important as one, are constantly subjected to pig raising enterprise both at home and abroad and boar improves company
It pays close attention to.20th century mid-term, continue to use both at home and abroad feed weight gain than (Feed/Gain ratio, F/G) study feed efficiency, should
Character is medium heritability quantitative character.(Mignon G S, rideau N, the Gabriel I, et such as Mignon G in 2015
al.Detection of QTL controlling feed efficiency and excretion in chickens fed
A wheat-based diet.Genetics Selection Evolution, 47 (1): 74 (2015)) it is detected in chicken
13 QTLs related with feed conversion rate.It is reported that (the Suppressor of of cell signalling inhibiting factor 2 of pig
Cytokine Signalling 2, CRADD) gene, Melanocortin receptor 4 (Melanocortin 4receptor, MC4R) base
Because exist to the significant relevant single nucleotide polymorphism of feed conversion rate (single nucleotide polymorphism,
SNP) site.(Kim O Y, Kwak S Y, Lim H, the et al.Genotype effects of glucokinase such as Kim
regulator on lipid profiles and glycemic status are modified by circulating
calcium levels:results from the Korean Genome and Epidemiology
Study.Nutrition Research, 60,96-105 (2018) .Doi:10.1016/j.nutres.2018.09.008) it grinds
Study carefully and show that GCKR gene (Glucokinase Regulator) is related with the circulation calcium level for controlling lipid and blood glucose, can reduce
Triglyceride levels and glucose level.Therefore, medium heritability of the feed conversion rate as evaluation food utilization efficiency
Shape has good selection to react.
Have using SNP marker assist-breeding food utilization efficiency correlated traits to pig production management and Business Economic Benefit
It has a major impact.(Vigors S, Sweeney T, Oshea C J, et higher than the food utilization efficiency of pig 1. low feed increases weight
al.Pigs that are divergent in feed efficiency,differ in intestinal enzyme and
nutrient transporter gene expression,nutrient digestibility and microbial
Activity.Animal, 10 (11): 1848-1855 (2016)), the feed usage amount and production cost in production can be reduced, into
And feed resource has been saved, also the blowdown flow rate of pig can be reduced to a certain degree, to slow down pig and human competition grain resource and support
The pressure of pig industry environmental issue.2. developing effective molecular labeling to work for the breeding of feed efficiency correlated traits, greatly shorten
Cultivation period reduces and cultivates cost, improves seed selection accuracy, accelerates genetic progress, is avoided that and introduces a fine variety that-degeneration-introduces a fine variety again
Phenomenon.
Therefore, it excavates and is had great significance using new increasing weight with feed than genetic breeding of the related gene for pig.
The trait phenotypes record of high density SNP data and big group based on covering full-length genome, can pass through whole-genome association
Technology (GWAS) (Hirschhorn, J.N.&Daly, M.J.Genome-wide association studies for
Common diseases and complex traits.Nat.Rev.Genet.6,95-108 (2005)) control is accurately positioned
The candidate gene of character.Although the technology still have some defects (De, R., Bush, W.S.&Moore,
J.H.Bioinformatics challenges in genome-wide association studies(GWAS)
.Methods Mol.Biol.1168,63-81 (2014)), it has been widely used in the excavation of mankind's complex disease candidate gene
With the positioning of livestock and poultry important economical trait key gene.Classical GWAS is generally basede on Plink (Purcell, S.et
al.PLINK:A Tool Set for Whole-Genome Association and Population-Based Linkage
Analyses.Am.J.Hum.Genet.813,559-575 (2007)) etc. softwares single label carried out to all labels one by one return
Analysis sets a remarkable threshold then to screen significant site.Such methods, which often face, calculates that intensity is big, excessively high estimation is marked
Remember that effect, conspicuousness threshold value set the problems such as unreasonable.In order to further increase the efficiency of GWAS, new method and software constantly quilt
It proposes.Wherein, one-step method whole-genome association (wssGWAS (WANG, H., MISZTAL, I., AGUILAR, I.,
LEGARRA,A.&MUIR,W.M.Genome-wide association mapping including phenotypes from
relatives without genotypes.Genet Res94,73–83(2012))；(Wang,H.et al.Genome-
wide association mapping including phenotypes from relatives without
genotypes in a single-step(ssGWAS)for 6-week body weight in broiler
Chickens.Front.Genet.5,1-10 (2014))) pedigree, history individual phenotypic record and genotype data are utilized simultaneously
Be associated analysis, possess phenotypic record suitable for a large amount of individuals and the case where only a small amount of individual possesses genotype data, especially
It is suitable for the whole-genome associations of livestock and poultry important economical trait.Based on GBLUPf90 software (Misztal, I.et
al.BLUPF90and related programs(BGF90).in Proc.7th World
Congr.Genet.Appl.Livest.Prod.21-22 (2002) .doi:9782738010520), it can realize easily
wssGWAS.It is filtered out to pannage weight gain using wssGWAS than relevant SNP marker, is domestic pig feed efficiency character
Hereditary choosing amount provides feasible way, is of great significance to pig breeding industry.
Summary of the invention
In view of the above technical problems, the disclosure provides the SNP molecular genetic of GCKR gene relevant to pannage conversion ratio
Label influences the molecular labeling DIAS0000543 of boar feed weight gain ratio, the label different genotype boar by identification one
Feed weight gain ratio there were significant differences, and carry out boar feed weight gain compare and full-length genome molecular genetic marker association analysis,
The big effector molecule genetic marker for influencing pannage weight gain ratio is screened in success, and this patent is applied to the breeding of boar, is selected and remain low
The homozygous pig of feed weight gain ratio, can effectively reduce feed consumption in production process, improves Business Economic Benefit and competitiveness,
Involved in DIAS0000543 genetic marker, that is, No. SNP be DIAS0000543 mutational site, see pig genome number in NCBI
According to library (Sscrofa11.1).
The SNP molecular genetic marker (DIAS0000543) of the disclosure, refering to Ensembl database (http: //
Asia.ensembl.org/Sus_scrofa/Search/New? db=core), the base that accession number is DIAS0000543 is obtained
Because of segment (No. RS is rs345879479), SNP molecular genetic marker is located at No. 3 positions chromosome 111663762bp of pig, and belongs to
In the exon sequence of GCKR gene, which is that a G > A is mutated (mutational site), and G > A, that is, G is the equipotential base of big frequency
Cause, A be small frequency allele, symbol > be gene frequency size, the SNP molecular genetic marker is in mutational site
Upstream and downstream 100bp sequence is as follows:
5’-CGGGAGGGGGCCCGGGTGTGAGTTCCAGCAAGGCCTTCCTACAGATGACAATCCTGCCCCTCTCG
CCGCCACCTCTGTCTTTCCAGACCCCTCTGAAGAAR(A/G)CTCTTCCCTTCCATCATCAGCATCACGTGGCCACT
GCTTTTCTTCGAATATGAAGGGAACTTCATCCAGGTATGGGGGATGGGGAGGTAAGATCTGCAGT-3'；R is mutation
Site, the R at 101 nucleotide of above-mentioned sequence is A or G, i.e. R (A/G) leads to above-mentioned sequence polymorphism；When above-mentioned nucleotide
When 101st nucleotide of sequence is A, pig has lower feed weight gain ratio, and 5 '-and -3 ' be respectively the 5 ' of nucleotide sequence
End and 3 ' ends.
Feed weight gain ratio differs 0.14, AA individual ratio between above-mentioned DIAS0000543 marker genetype AA and GG boar individual
GG body feedstuff weight gain ratio reduces 6.57%, and feed intake reduces 69.97g/ days, so, A is to advantageously reduce feed weight gain
The allele of ratio, by selecting and remain AA homozygosis boar, reduction feed weight gain ratio effectively reduces feed consumption and aquaculture cost,
By selecting and remain the homozygous pig of low feed weight gain ratio, feed consumption in production process can effectively reduce (since the DNA of pig is reversed
It is AA genotype homozygosis pig when the mutational site nucleotide of spiral duplex structure, two chains is A, wherein each chain has one
A nucleotide sequence, A indicate that a mutational site is A, and AA genotype is that the mutational site of double-strand is all the homozygous pig of A, similarly,
GG genotype is that the mutational site of double-strand is all the homozygous pig of G；AG genotype is that the mutational site of a chain is A another prominent
Displacement point is the pig of G).
The method for screening the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio specifically includes following step
It is rapid:
1, the process step of the acquisition of molecular labeling
1.1, the ear tissue sample or blood sample of boar are acquired, extracts total DNA, and quality testing is carried out to DNA.Using
GGP50k SNP (GeneSeek, US) chip carries out Genotyping, obtains the SNP marker genotype of covering full-length genome.
1.2, genome (Sscrofa11.1) is referred to according to the pig of latest edition, using NCBI genome alignment program
(https: //www.ncbi.nlm.nih.gov/) is updated the physical location of all SNP markers.Genomic locations are unknown
SNP be not used in association analysis.
1.3, for the SNP marker on all autosomes, quality control, standard are carried out using Plink software are as follows: individual
Recall rate >=90%；SNP recall rate >=90%；Small gene frequency >=0.01；Hardy-Weinberg equilibrium p value >=10-6.It is right
In deletion Genotype, it is filled using Beagle software (version 4.1).
2, the process step of the verifying of molecular labeling
2.1, boar pedigree is arranged, mainly includes the information such as boar individual number, father, mother and nascent date.UsingThe growth data that formula records full-automatic boar performance test system (FIRE, the U.S.) carries out analysis and obtains
Feed weight gain is obtained than phenotypic data, is used for phenotype-genotype association analysis.Wherein, FCR is feed weight gain ratio；WaFor living body increasing
Weight；WfFor feed consumption.
2.2, statistical model, using one-step method whole-genome association method (the weighted single step of weighting
Genome-wide association study, wssGWAS) carry out whole-genome association.This method is primarily based on mixing
Model equation group estimates individual breeding value, and the equivalence relation then based on breeding value model and marker effect model is by breeding value
Be converted to marker effect.The whole-genome association model that the present invention uses is as follows:
Y=Xb+Za+Wp+e,
Wherein, y is that observation vector is compared in feed weight gain；X, Z and W are design matrix；B is fixed effect vector (environment, day
Age)；For breeding value vector；For the permanent environmental effect of individual；For residual error.H
To integrate the affiliation matrix of pedigree and SNP marker simultaneously, inverse matrix calculation formula is as follows:
Wherein, A is the affiliation matrix based on pedigree；A22To there is the corresponding matrix in block form of genotype individuals in A；Gω=
0.9G+0.1A22,For the affiliation square based on full-length genome SNP marker, Z is small gene frequency
Genotype matrix after (minor allele frequency, MAF) correction, wherein 0-2p, 1-2p and 2-2p respectively represent AA,
Tri- kinds of genotype of Aa and aa, p are small gene frequency；D is diagonal matrix, indicates the weight of SNP；piIt is marked for i-th
Small gene frequency；M is marker number.
For above-mentioned mixed model, using AI-REML (average information restricted maximum
Likelihood) method estimate variance component, and breeding value is obtained by solving Mixed model mixed.It is obtained by way of iteration
Weight must be marked, key step is as follows:
Step 1: initialization (t=1), D(t)=I, G(t)=λ ZD(t)Z ',
Step 2: individual breeding value is calculated by ssGBLUP；
Step 3: pass through formulaIndividual breeding value is converted into SNP effect, whereinTo there is gene
The breeding value of type individual；
Step 4: formula is utilizedIt calculates SNP weight and is used for next round iteration；
Step 5: formula is utilizedSNP weight is standardized, to guarantee that variance is consistent；
Step 6: formula G is utilized(t+1)=λ ZD(t+1)Z ' calculating affiliation matrix is used for next round iteration；
Step 7: t=t+1, and the next round iteration since step 2 are enabled.
Above-mentioned steps iteration is three times, final to obtain SNP marker effect.The marker effect that third round iteration is exported is as most
Whole result.Calculating process mainly calls BLUPF90 software to realize by statisticalling analyze platform programming in R, wherein
AIREMLF90 program is used for variance component estimate, and BLUPF90 program is for calculating breeding value, and postGSf90 is for calculating label
Effect.
3, label screening
Effect value markd for institute, takes its absolute value to draw Manhattan figure, shows and screen the SNP marker of big effect.
And using variance analysis and Multiple range test (R statisticallys analyze platform), analysis DIAS0000543 marks different genotype group boar
Difference condition is compared in feed weight gain.
The disclosure has the beneficial effect that the disclosure provides the SNP molecule something lost of GCKR gene relevant to pannage conversion ratio
Pass label, the label show different genotype boar feed weight gain ratio there were significant differences；DIAS0000543 marker genetype AA
Feed weight gain reduces 6.57% than differing GG body feedstuff weight gain ratio of 0.14, AA individual ratio between GG boar individual；Pass through inspection
It surveys DIAS0000543 marker genetype and assists boar breeding, core group can be entered by selecting and remain AA homozygosis boar, reduce feed and increase
Compare again, effectively reduce feed consumption and aquaculture cost, by selecting and remain the homozygous pig of low feed weight gain ratio, can effectively reduce production
Feed consumption in the process improves Business Economic Benefit and competitiveness.
Detailed description of the invention
By the way that the embodiment in conjunction with shown by attached drawing is described in detail, above-mentioned and other features of the disclosure will
More obvious, identical reference label indicates the same or similar element in disclosure attached drawing, it should be apparent that, it is described below
Attached drawing be only some embodiments of the present disclosure, for those of ordinary skill in the art, do not making the creative labor
Under the premise of, it is also possible to obtain other drawings based on these drawings, in the accompanying drawings:
Fig. 1 show the SNP molecular genetic marker of the screening GCKR gene relevant to pannage conversion ratio of the disclosure
Method work flow diagram；
Fig. 2 show the marker gene group position DIAS0000543 of the disclosure and feed increases weight than full-length genome SNP effect
Distribution.
Specific embodiment
It is carried out below with reference to technical effect of the embodiment and attached drawing to the design of the disclosure, specific structure and generation clear
Chu, complete description, to be completely understood by the purpose, scheme and effect of the disclosure.It should be noted that the case where not conflicting
Under, the features in the embodiments and the embodiments of the present application can be combined with each other.
As shown in Figure 1 for according to the SNP molecular genetic of the screening GCKR gene relevant to pannage conversion ratio of the disclosure
The method work flow diagram of label illustrates relevant to pannage conversion ratio according to the screening of the disclosure below with reference to Fig. 1
The method of the SNP molecular genetic marker of GCKR gene.
The method that the disclosure screens the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio is specific to wrap
Include following steps:
(1) phenotype-pedigree data acquisition
The basic research group of the disclosure is Duroc boars, all is from Guangxi core kind pig farm.In complete pedigree
Comprising 4 generations, 735 boars, the feed that 370 Duroc boars are wherein had recorded between 2015-2018 increases weight than character table
Type data.Feed weight gain is than usingFormula records full-automatic boar performance test system (FIRE, the U.S.)
Growth data carry out analysis acquisition, be used for phenotype-genotype association analysis.Wherein, FCR is feed weight gain ratio；WaFor living body
Gain in weight；WfFor feed consumption.
(2) Genotyping and quality control
The ear tissue sample or blood sample of 1733 boars are acquired, extracts total DNA, and use GGP 50k SNP
(GeneSeek, US) chip carries out Genotyping, obtains 50705 SNP markers of covering full-length genome.According to the pig of latest edition
With reference to genome (Sscrofa11.1), using NCBI genome alignment program (https: //www.ncbi.nlm.nih.gov/)
The physical location of all SNP markers is updated.The unknown SNP of genomic locations is not used in association analysis.For all normal
SNP marker on chromosome carries out quality control, standard are as follows: individual recall rate >=90% using Plink software；SNP recall rate
>=90%；Small gene frequency >=0.01；Hardy-Weinberg equilibrium p value >=10-6.For deletion Genotype, using Beagle
Software (version 4.1) is filled.Based on the above quality control standard, remaining 1623 boars and 28289 SNP markers
For association analysis.
(3) statistical model
In order to make full use of all phenotypic datas and genotype data, the present invention discloses the one-step method full genome using weighting
Group correlation fractal dimension (weighted single step genome-wide association study, wssGWAS) carries out
Whole-genome association.This method is primarily based on Mixed model mixed to estimate individual breeding value, is then based on breeding value
Breeding value is converted to marker effect by the equivalence relation of model and marker effect model.The full-length genome association point that the present invention uses
It is as follows to analyse model:
Y=Xb+Za+Wp+e,
Wherein, y is that observation vector is compared in feed weight gain；X, Z and W are design matrix；B is fixed effect vector (environment, day
Age)；For breeding value vector；For the permanent environmental effect of individual；For residual error.H
To integrate the affiliation matrix of pedigree and SNP marker simultaneously, inverse matrix calculation formula is as follows:
Wherein, A is the affiliation matrix based on pedigree；A22To there is the corresponding matrix in block form of genotype individuals in A；Gω=
0.9G+0.1A22,For the affiliation square based on full-length genome SNP marker, Z is small gene frequency
Genotype matrix after (minor allele frequency, MAF) correction, wherein 0-2p, 1-2p and 2-2p respectively represent AA,
Tri- kinds of genotype of Aa and aa, p are small gene frequency；D is diagonal matrix, indicates the weight of SNP；piIt is marked for i-th
Small gene frequency；M is marker number.
Corresponding above-mentioned mixed model, using AI-REML (average information restricted maximum
Likelihood) method estimate variance component, and breeding value is obtained by solving Mixed model mixed.It is obtained by way of iteration
Weight must be marked, key step is as follows:
Step 1: initialization (t=1), D(t)=I, G(t)=λ ZD(t)Z ',
Step 2: individual breeding value is calculated by ssGBLUP；
Step 3: pass through formulaIndividual breeding value is converted into SNP effect, whereinTo there is gene
The breeding value of type individual；
Step 4: formula is utilizedIt calculates SNP weight and is used for next round iteration；
Step 5: formula is utilizedSNP weight is standardized, to guarantee that variance is consistent；
Step 6: formula G is utilized(t+1)=λ ZD(t+1)Z ' calculating affiliation matrix is used for next round iteration；
Step 7: t=t+1, and the next round iteration since step 2 are enabled.
Above-mentioned steps iteration is three times, final to obtain SNP marker effect to get SNP marker effect is arrived.Third round iteration is defeated
Marker effect out is as final result.Calculating process mainly calls BLUPF90 software by statisticalling analyze platform programming in R
It realizes, wherein AIREMLF90 program is used for variance component estimate, and BLUPF90 program is for calculating breeding value, postGSf90
For calculating marker effect.
(4) label screening
Effect value markd for institute, takes its absolute value to draw Manhattan figure, shows and screen the SNP marker of big effect.
And using variance analysis and Multiple range test (R statisticallys analyze platform), analysis DIAS0000543 marks different genotype group boar
Difference condition is compared in feed weight gain.
Analyze different genotype boar feed weight gain ratio
Effect value markd for institute, takes its absolute value to draw Manhattan figure, shows and screen the SNP marker of big effect
(as shown in Fig. 2, Fig. 2 show the marker gene group position DIAS0000543 of the disclosure and feed increases weight than full-length genome SNP
Effect distribution).And using variance analysis and Multiple range test (R statisticallys analyze platform), different genotype group boar feed is analyzed
Weight gain is than difference condition (table 1).
The SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio is in pannage conversion ratio assisted Selection
Application:
The disclosure identifies the molecular labeling DIAS0000543 for influencing boar feed weight gain ratio as shown in Table 1 should
Marking the feed weight gain of different genotype boar than there were significant differences, (table 1 is that DIAS0000543 marks different genotype boar
Feed weight gain ratio)；
Table 1DIAS0000543 marks different genotype boar feed weight gain ratio
Boar breeding is assisted by detection DIAS0000543 marker genetype, core can be entered by selecting and remain AA homozygosis boar
Heart group reduces feed weight gain ratio, effectively reduces feed consumption and aquaculture cost；
The SNP molecular genetic marker (DIAS0000543) of the disclosure, refering to Ensembl database (http: //
Asia.ensembl.org/Sus_scrofa/Search/New? db=core), the base that accession number is DIAS0000543 is obtained
Because of segment (No. RS is rs345879479), SNP molecular genetic marker is located at No. 3 positions chromosome 111663762bp of pig, and belongs to
In the exon sequence of GCKR gene, which is that a G > A is mutated (mutational site), and the SNP molecular genetic marker is prominent
Displacement point upstream and downstream 100bp sequence is as follows:
5’-CGGGAGGGGGCCCGGGTGTGAGTTCCAGCAAGGCCTTCCTACAGATGACAATCCTGCCCCTCTCG
CCGCCACCTCTGTCTTTCCAGACCCCTCTGAAGAAR(A/G)CTCTTCCCTTCCATCATCAGCATCACGTGGCCACT
GCTTTTCTTCGAATATGAAGGGAACTTCATCCAGGTATGGGGGATGGGGAGGTAAGATCTGCAGT-3'；R is mutation
Site, the R at 101 nucleotide of above-mentioned sequence is A or G, i.e. R (A/G) leads to above-mentioned sequence polymorphism；When above-mentioned nucleotide
When 101st nucleotide of sequence is A, pig has lower feed weight gain ratio, and 5 '-and -3 ' be respectively the 5 ' of nucleotide sequence
End and 3 ' ends.
(sequence such as sequence table SEQ IDNo.1 shown in nucleotide sequence of the above-mentioned sequence when being mutated point and being A), sequence
List SEQ IDNo.1 is that the present invention screens to obtain genetic marker (i.e. No. SNP is DIAS0000543, and No. RS is rs345879479)
Mutational site upstream and downstream 100bp nucleotide sequence.
Feed weight gain ratio differs 0.14, AA individual ratio between above-mentioned DIAS0000543 marker genetype AA and GG boar individual
GG body feedstuff weight gain ratio reduces 6.57%, and feed intake reduces 69.97g/ days, so, A is to advantageously reduce feed weight gain
The allele of ratio.
Leading reference:
1.Mignon G S,rideau N,Gabriel I,et al.Detection of QTL controlling
feed efficiency and excretion in chickens fed a wheat-based diet.Genetics
Selection Evolution,47(1):74(2015)。
2.Kim O Y,Kwak S Y,Lim H,et al.Genotype effects of glucokinase
regulator on lipid profiles and glycemic status are modified by circulating
calcium levels:results from the Korean Genome and Epidemiology
Study.Nutrition Research,60,96–105(2018).Doi:10.1016/j.nutres.2018.09.008。
3.Vigors S,Sweeney T,Oshea C J,et al.Pigs that are divergent in feed
efficiency,differ in intestinal enzyme and nutrient transporter gene
expression,nutrient digestibility and microbial activity.Animal,10(11):1848-
1855(2016)。
4.Hirschhorn,J.N.&Daly,M.J.Genome-wide association studies for common
diseases and complex traits.Nat.Rev.Genet.6,95–108(2005)。
5.De,R.,Bush,W.S.&Moore,J.H.Bioinformatics challenges in genome-wide
association studies(GWAS).Methods Mol.Biol.1168,63–81(2014)。
6.Purcell,S.et al.PLINK:A Tool Set for Whole-Genome Association and
Population-Based Linkage Analyses.Am.J.Hum.Genet.813,559–575(2007)。
7.WANG,H.,MISZTAL,I.,AGUILAR,I.,LEGARRA,A.&MUIR,W.M.Genome-wide
association mapping including phenotypes from relatives without
genotypes.Genet Res94,73–83(2012)。
8.Wang,H.et al.Genome-wide association mapping including phenotypes
from relatives without genotypes in a single-step(ssGWAS)for 6-week body
weight in broiler chickens.Front.Genet.5,1–10(2014)。
9.Misztal,I.et al.BLUPF90and related programs(BGF90).in Proc.7th
World Congr.Genet.Appl.Livest.Prod.21–22(2002).doi:9782738010520。
Sequence table
<110>Foshan Science &. Technology College
<120>the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio
<141> 2019-06-05
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 201
<212> DNA
<213> Sscrofa11.1
<220>
<221> gene
<222> (1)..(201)
<220>
<221> mutation
<222> (100)..(101)
<400> 1
cgggaggggg cccgggtgtg agttccagca aggccttcct acagatgaca atcctgcccc 60
tctcgccgcc acctctgtct ttccagaccc ctctgaagaa actcttccct tccatcatca 120
gcatcacgtg gccactgctt ttcttcgaat atgaagggaa cttcatccag gtatggggga 180
tggggaggta agatctgcag t 201
Claims (5)
1. the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio, which is characterized in that the SNP molecule is lost
It passes label and is located at No. 3 positions chromosome 111663762bp of pig, and belong to the exon sequence of GCKR gene, which is a G
> A mutation, pig are Sscrofa11.1 with reference to genome.
2. the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio according to claim 1, feature
It is, the sequence of the SNP molecular genetic marker is the upstream and downstream 100bp sequence in mutational site.
3. the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio according to claim 1, feature
It is, the sequence of the SNP molecular genetic marker is as shown below:
5’-CGGGAGGGGGCCCGGGTGTGAGTTCCAGCAAGGCCTTCCTACAGATGACAATCCTGCCCCTCTCGCCGC
CACCTCTGTCTTTCCAGACCCCTCTGAAGAARCTCTTCCCTTCCATCATCAGCATCACGTGGCCACTGCTTTTCTT
CGAATATGAAGGGAACTTCATCCAGGTATGGGGGATGGGGAGGTAAGATCTGCAGT-3'；R is mutational site, when R is
When A, pig has lower feed weight gain ratio.
4. the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio as claimed in claim 3 turns in pannage
Application in rate assisted Selection.
5. the SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio according to claim 4 is raised in pig
Expect the application in conversion ratio assisted Selection, which is characterized in that No. SNP of the SNP molecular genetic marker is DIAS0000543,
Feed weight gain increases than differing GG body feedstuff of 0.14, AA individual ratio between DIAS0000543 marker genetype AA and GG boar individual
Again than reducing 6.57%, feed intake is reduced 69.97g/ days, by selecting and remain AA homozygosis boar, reduces feed weight gain ratio, effectively
Feed consumption and aquaculture cost are reduced, by selecting and remain the homozygous pig of low feed weight gain ratio, can effectively reduce in production process and raise
Expect consumption.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910489896.7A CN110358839B (en) | 2019-06-06 | 2019-06-06 | SNP molecular genetic marker of GCKR gene related to pig feed conversion rate |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910489896.7A CN110358839B (en) | 2019-06-06 | 2019-06-06 | SNP molecular genetic marker of GCKR gene related to pig feed conversion rate |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110358839A true CN110358839A (en) | 2019-10-22 |
| CN110358839B CN110358839B (en) | 2023-07-07 |
Family
ID=68215638
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910489896.7A Active CN110358839B (en) | 2019-06-06 | 2019-06-06 | SNP molecular genetic marker of GCKR gene related to pig feed conversion rate |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110358839B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500746A (en) * | 2020-05-22 | 2020-08-07 | 华中农业大学 | SNP molecular marker related to feed conversion efficiency of pigs |
| CN113699247A (en) * | 2021-07-26 | 2021-11-26 | 华南农业大学 | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof |
| CN116042849A (en) * | 2022-11-09 | 2023-05-02 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070186298A1 (en) * | 2006-01-04 | 2007-08-09 | Blowe Charlotte D | Follistatin gene as a genetic marker for reproductive and performance traits in pigs |
| WO2008144940A1 (en) * | 2007-05-31 | 2008-12-04 | The University Of Western Ontario | Biomarker for hypertriglyceridemia |
| US20150356243A1 (en) * | 2013-01-11 | 2015-12-10 | Oslo Universitetssykehus Hf | Systems and methods for identifying polymorphisms |
| CN105624155A (en) * | 2016-02-29 | 2016-06-01 | 华南农业大学 | Molecular marker influencing feed conversion ratio character of pig and application |
| CN105648077A (en) * | 2016-02-29 | 2016-06-08 | 华南农业大学 | Molecular marker affecting daily gain character of pigs and application of molecular marker |
| CN107937556A (en) * | 2017-11-14 | 2018-04-20 | 中国农业大学 | One and the relevant SNP site of pannage conversion ratio and its application |
| CN108913779A (en) * | 2018-06-14 | 2018-11-30 | 华南农业大学 | A kind of SNP marker and its application influencing daily gain in pigs character |
-
2019
- 2019-06-06 CN CN201910489896.7A patent/CN110358839B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070186298A1 (en) * | 2006-01-04 | 2007-08-09 | Blowe Charlotte D | Follistatin gene as a genetic marker for reproductive and performance traits in pigs |
| WO2008144940A1 (en) * | 2007-05-31 | 2008-12-04 | The University Of Western Ontario | Biomarker for hypertriglyceridemia |
| US20150356243A1 (en) * | 2013-01-11 | 2015-12-10 | Oslo Universitetssykehus Hf | Systems and methods for identifying polymorphisms |
| CN105624155A (en) * | 2016-02-29 | 2016-06-01 | 华南农业大学 | Molecular marker influencing feed conversion ratio character of pig and application |
| CN105648077A (en) * | 2016-02-29 | 2016-06-08 | 华南农业大学 | Molecular marker affecting daily gain character of pigs and application of molecular marker |
| CN107937556A (en) * | 2017-11-14 | 2018-04-20 | 中国农业大学 | One and the relevant SNP site of pannage conversion ratio and its application |
| CN108913779A (en) * | 2018-06-14 | 2018-11-30 | 华南农业大学 | A kind of SNP marker and its application influencing daily gain in pigs character |
Non-Patent Citations (6)
| Title |
|---|
| É F SILVA等: "A genome-wide association study for feed efficiency-related traits in a crossbred pig population", 《ANIMAL》 * |
| É F SILVA等: "A genome-wide association study for feed efficiency-related traits in a crossbred pig population", 《ANIMAL》, vol. 13, no. 11, 28 May 2019 (2019-05-28), pages 2447 - 2456 * |
| 无: "rs345879479 (SNP)", 《ENSEMBL DATABASE》 * |
| 无: "rs345879479 (SNP)", 《ENSEMBL DATABASE》, 30 April 2019 (2019-04-30) * |
| 蒲蕾等: "猪饲料利用效率的研究进展", 《中国农业大学学报》 * |
| 蒲蕾等: "猪饲料利用效率的研究进展", 《中国农业大学学报》, vol. 21, no. 4, 15 April 2016 (2016-04-15), pages 77 - 85 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500746A (en) * | 2020-05-22 | 2020-08-07 | 华中农业大学 | SNP molecular marker related to feed conversion efficiency of pigs |
| CN113699247A (en) * | 2021-07-26 | 2021-11-26 | 华南农业大学 | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof |
| CN113699247B (en) * | 2021-07-26 | 2023-07-14 | 华南农业大学 | SNP molecular marker related to pig residual feed intake on pig chromosome 1 and application thereof |
| CN116042849A (en) * | 2022-11-09 | 2023-05-02 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
| CN116042849B (en) * | 2022-11-09 | 2023-11-17 | 佛山科学技术学院 | Genetic marker for assessing pig feed intake and screening method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110358839B (en) | 2023-07-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110218799A (en) | The molecular genetic marker of pig residue feed intake character and application | |
| CN110358840A (en) | The SNP molecular genetic marker of TPP2 gene relevant to remaining feed intake | |
| CN112002371B (en) | Genome selection method for residual feed intake of white-feather broilers | |
| CN110358839A (en) | The SNP molecular genetic marker of GCKR gene relevant to pannage conversion ratio | |
| CN108410994A (en) | It is a kind of influence sheep Fecundity Trait SNP marker and its application | |
| CN110295236A (en) | The SNP molecular genetic marker of pannage conversion ratio | |
| CN110358838A (en) | SNP genetic marker relevant to pannage conversion in FA2H genetic fragment | |
| CN111926085B (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
| CN114921561B (en) | Duroc whole genome low-density SNP chip and preparation method and application thereof | |
| CN114941033A (en) | Method for breeding local high-quality white-feather chicken high-egg-yield strain based on SNP locus assistance | |
| Wang et al. | Genetic differentiation and selection signatures in two bay scallop (Argopecten irradians) breeds revealed by whole-genome resequencing analysis | |
| CN111926086A (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN110273006A (en) | The relevant molecular genetic marker of the effective sperm count of one herd boar | |
| Qiao et al. | Population genetic structure analysis and identification of backfat thickness loci of Chinese synthetic Yunan pigs | |
| Lv et al. | Genomic differentiation and selection signatures of two elite varieties of Yesso scallop Mizuhopecten yessoensis | |
| CN111199773B (en) | Evaluation method for fine positioning character associated genome homozygous fragments | |
| US20240043912A1 (en) | Genomic selection (gs) breeding chip of huaxi cattle and use thereof | |
| CN117070638A (en) | Application of SNP genetic marker related to body weight gain in chicken egg producing period in chicken genetic breeding | |
| CN114752678B (en) | SNP molecular marker related to backfat thickness of pig reaching 115kg body weight and application thereof | |
| CN113322333B (en) | CNV molecular marker combination related to Guangxi hemp chicken body size and slaughter traits based on whole genome sequencing screening and application | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
| Kang et al. | Genome-wide association study for sow lifetime productivity related traits in a Landrace purebred population | |
| CN116042849B (en) | Genetic marker for assessing pig feed intake and screening method and application thereof | |
| CN113897443B (en) | SNP molecular marker related to milk fat percentage of southern Holstein cows, kit and application and breeding method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |