CN110257533B - Microsatellite marker locus of bullfight and primer thereof - Google Patents

Abstract

The invention discloses a bullfight microsatellite marker locus and a primer thereof, belonging to the field of biotechnology detection. The invention provides 14 microsatellite molecular marker loci of bullfight fish and a polymorphism primer thereof, as shown in a nucleotide sequence table, the amplification result of the obtained primer has high polymorphism and stability, provides technical data for the identification of genetic diversity and genetic relationship among populations of the bullfight fish, and makes up the defects of the prior art.

Description

Microsatellite marker locus of bullfight and primer thereof

Technical Field

The invention belongs to the field of biotechnology detection, and particularly relates to a bullfight microsatellite marker locus and a primer.

Background

The bullous coilia (Macropodosophalatus) belongs to Percifomes, Osphrynomeideae and Diplopoda, is a small freshwater fish in China and is widely distributed in natural habitats such as ponds, ditches, rice fields and the like in the north of Yangtze river basin. The wild bullfight mainly feeds on larvae of pests, and has important ecological effect on inhibiting and controlling the pests. The bullfight fish is favored by ornamental enthusiasts due to the gorgeous colorful body surface color and the exaggerated field behavior, and has potential economic value. The bullfight is a common species in the distribution area of the bullfight, rarely attracts people's attention, and when the natural water body is seriously polluted and the disruption of the habitat of the water body is intensified, the survival of the wild population is threatened, and the wild population condition of the species needs to be paid urgent attention and protected. Therefore, the method can quickly and effectively identify the families and sources of different bullfight fishes, and the enhancement of cultivation and natural population genetic management is particularly important for protecting the population diversity of the bullfight fishes.

Microsatellite markers (SSRs) or Short Tandem Repeats (STRs) are DNA molecular markers in the field of genetics that are widely used. SSRs are simple repetitive DNA fragments widely present in the genome of eukaryotes, generally only 1-6 bases per repeat unit, with the number of repeats being 10-20, with dinucleotides (CA/GT) n being the most common in animals. The microsatellite has the advantages of high polymorphism, more provided genetic information, good repeatability of PCR amplification effect, dispersion distribution in a genome and the like, and is commonly used for genetic diversity analysis, genetic mapping, cross breeding and the like of organisms. In addition, the requirement for samples is low due to the small amount of DNA used for microsatellite studies. Therefore, microsatellite analysis has wide applicability in the field of research on fish genetics.

The microsatellite locus detection method comprises agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis and fluorescence labeling full-automatic genome scanning. At present, a microsatellite fluorescent marker full-automatic genotyping technology is generally adopted, FAM, TET and HEX are utilized, 3 fluorescent dyes with different colors are utilized to mark microsatellite DNA primers, PCR products of various fluorescent markers and different amplified fragments can be electrophoresed in the same sample adding hole, the PCR product to be detected and DNA intrinsic molecular weight standard can be simultaneously loaded, and the size of the microsatellite allelic gene fragment can be accurately calculated by sequential gel electrophoresis and image analysis by software. The method has the advantages of high yield, low cost, rapidness, simplicity and convenience and the like, and shows wide application prospect. The laboratory establishes a foundation for genetic detection of the bullfight by screening the highly polymorphic microsatellite loci of the bullfight.

Disclosure of Invention

The technical problems to be solved by the invention are as follows: the invention aims to provide 14 microsatellite molecular marker loci of bullfight and a polymorphism primer thereof, provide data for identifying genetic diversity and population genetic relationship of the bullfight, and make up for the defects of the prior art.

The technical scheme is as follows: in order to solve the problems, the technical scheme adopted by the invention is as follows:

the invention utilizes RAD-seq high-throughput sequencing technology to screen 14 microsatellite loci from Tortoise round-tailed goby genome DNA, the marker number is Mo01-14, and the nucleotide sequence is shown as SEQIDNo.1-14.

The microsatellite locus primers are forward primers (F) and reverse primers (R) designed from flanking sequences at two ends of a Mo01-14 microsatellite, and the microsatellite primer sequences are SEQ D: 15-42.

The microsatellite loci, corresponding primer information, fluorescent labels and optimal annealing temperatures are shown in Table 1.

TABLE 1 Tortoise round-tailed mullet microsatellite loci and primers, fluorescent markers and optimal annealing temperatures thereof

The microsatellite polymorphism primer is used for detecting the genetic diversity of the bullfight fish and comprises the following steps:

1) extraction of genomic DNA: adopting an animal genome DNA extraction kit of Beijing Optimalaceae new biotechnology Limited;

2) micro-satellite PCR amplification: amplifying genome DNA of the bullfight with the tail by adopting FAM, HEX and TAMRA fluorescence labeled microsatellite primers to obtain an amplification product;

3) electrophoresis of the amplification product: performing electrophoresis on a capillary electrophoresis gene analyzer, using GS500LIZ as a molecular weight internal standard, and using a Genemapper to perform primary processing on capillary electrophoresis data of an individual amplification product;

4) genetic diversity analysis: genotypes were determined based on the molecular weight of each individual microsatellite amplification product and genetic diversity parameters were calculated using Cervus 3.0.7.

Has the advantages that: compared with the prior art, the invention has the advantages that:

the invention utilizes RAD-seq high-throughput sequencing technology to screen 14 microsatellite loci from genome DNA of the bullfight fish, and designs specific primers according to flanking sequences of the loci at two ends of the microsatellite loci, and the amplification result of the obtained primers has polymorphism and stability, so that the primer can be applied to the fields of population genetic diversity detection, individual identification and molecular assisted breeding of the bullfight fish, and lays a solid foundation for the microsatellite polymorphism detection of the bullfight fish.

Detailed Description

The invention is further described with reference to specific examples.

Example 1:

(1) extracting DNA of the bullfight: collecting 24 samples of the bullfight fish with round tail, storing the samples in absolute ethyl alcohol, and extracting DNA by adopting an animal genome DNA extraction kit with the catalogue number TSP201 of the Okinawa Biotechnology Limited company of Okinawa, the concrete steps are as follows: cutting fish tail with clean scissors, transferring into a centrifuge Tube, placing Spin Column in Collection Tube, adding 250 μ L Buffer BL, centrifuging at 12,000 × g for 1min, and activating silica gel membrane. Taking 20 mu L of protease K to the bottom of a 1.5mL centrifuge tube, adding 200 mu L of high-purity water diluted fishtail fragments, and carrying out vortex oscillation for 10 s; 200. mu.L of BuffergA1 was added and incubated at 56 ℃ for 1h with vortexing for 5 vortexes. After the incubation, 200. mu.L of absolute ethanol was added, and vortexed, shaken and mixed. The whole solution was transferred to Spin Column, centrifuged at 12,000 Xg for 1min, and the waste liquid was discarded. Then 500. mu.L of Buffer PW was added to Spin Column, centrifuged at 12,000 Xg for 30s, and the waste liquid was discarded and repeated once. To Spin Column was added 500. mu.L of a wind Buffer, centrifuged at 12,000 Xg for 30 seconds, and the waste liquid was discarded. The Spin Column was returned to the Collection Tube, centrifuged at 12,000 Xg for 2min, uncapped and air dried for 1 min. Spin Column was removed and placed in a clean 1.5mL centrifuge tube, 60. mu.L TE Buffer was added to the center of the adsorption membrane, and the tube was left at room temperature for 2min and centrifuged at 12,000 Xg for 2 min. Collecting all eluted DNA; the DNA concentration was determined and the samples were stored at 20 ℃ until use.

(2) Screening of plecoglossus rotundifolia polymorphism microsatellite primers:

according to the sequence of the Tortoise round-tailed goby genome RAD-SSR, RAD-SSR design of two to four nucleotide different repetitive motifs is selected, 20 pairs of microsatellite primers are designed by using software Primer Premier 5, and the main parameters of Primer design are as follows: the length of the primer is about 22bp, and the length of the product is 80-150 bp; a single primer is complementary by less than 3 nucleotides; ensuring the Tm values of the two primers to be above or below 55-60 ℃; the two primers are paired with less than 3 consecutive nucleotides, (G + C)% content is approximately (40% -60%). And performing PCR amplification detection on the 20 pairs of primers by using genome DNA of the Tianjin population Tortoise latipes as a template, and finally, stably amplifying a target band by 14 pairs of primers.

(3) Fluorescent labeling microsatellite PCR amplification and multiple capillary electrophoresis of the bullfight: and (3) labeling 14 pairs of microsatellite primers and forward primers obtained by screening in the step (2) with different fluorescent substances, wherein the fluorescent labels of Mo01, Mo09 and Mo14 are FAM, the fluorescent labels of Mo02, Mo03, Mo04, Mo05, Mo10 and Mo11 are HEX, the fluorescent labels of Mo06, Mo07, Mo08, Mo12 and Mo13 are TAMRA, and carrying out PCR amplification on the DNA sample of the bullfight fish obtained in the step (1) by using the fluorescent primers. The PCR reaction system is as follows: 5 μ L2 × Premix Taq^TM1. mu.L of template genomic DNA, 0.3. mu.L (concentration: 10. mu.M) of each of the upstream and downstream primers, and 3.4. mu.L of ddH₂O, the PCR amplification program is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 55-60 ℃ for 30s, and extension at 72 ℃ for 30s, and performing 30 cycles; finally, the extension is carried out for 5min at 72 ℃. After PCR is finished, 2 mu L of PCR amplification product is taken to carry out electrophoresis detection on agarose gel, concentration identification is carried out according to the electrophoresis detection result, the product is diluted to a certain extent according to the concentration identification value to form a double combination, finally, 1 mu L of diluted PCR product is taken to be added into 7 mu L of formamide containing fluorescence internal standard LIZ500, and the product is subjected to capillary fluorescence electrophoresis detection and genotyping by using a sequencer ABI 3730 XL. The information on the multiple capillary electrophoresis combinations of the microsatellite of the bullfight fish is detailed in table 2. The Allele number (Na), the desired heterozygosity (He) and the Polymorphic Information Content (PIC) of each microsatellite marker were calculated using the allee frequency analysis in the software Cervus v.3.0.7, and the results showed that the number of alleles per microsatellite locus varied from 2 to 6, the desired heterozygosity (He) ranged from 0.042 to 0.787 and the Polymorphic Information Content (PIC) ranged from 0.040 to 0.740, with the detailed results shown in table 2.

TABLE 2 detection of microsatellite loci

Sequence listing

<110> Nanjing university of forestry

<120> bullfight microsatellite marker locus and primer thereof

<130>100

<160>42

<170>SIPOSequenceListing 1.0

<210>1

<211>212

<212>DNA

<213>Macropodus ocellatus

<400>1

aaggaggaca cagtctcaga ggggcagcga gtgtgtgatg ggccagtgag tgtgatctga 60

cctactgtga tattaagatt tttaggccat tttctacaag gaagaagaag aaaacttaaa 120

gttaatacgt gtaatgtacc taaagttacc gtaaaagttt ataatcattg acctgatttc 180

aggtactgtg aacagacgaa ttcatccaca ga 212

<210>2

<211>212

<212>DNA

<213>Macropodus ocellatus

<400>2

cacacgtctc catgttggtg agacgtggca ttgttatcgt gtcagggtgg agtaaataag 60

ataacaagga ctttatttat cattctaaca tgttacatgt acaacaacaa caaaaaaggg 120

agtttaacat gtaatagtgt tgatcgtggc ccatatttgt ttgctttagt taagagaact 180

actgaagtag ttggaaaata agatgatttc tt 212

<210>3

<211>212

<212>DNA

<213>Macropodus ocellatus

<400>3

tctacaaata actgtataat gaattgggaa acatctgtat attctcacct aatatttgct 60

ctgtaatgag tctacagaat attgaaggct ctagagtttc tgtgtgtgtg tgtacaagta 120

tcatctgtaa tccacgatga tcaggtctgt ggatcctagg atcaacggca ttatctggac 180

tgactgaaca ggaaaacaca gacttcagtt gt 212

<210>4

<211>212

<212>DNA

<213>Macropodus ocellatus

<400>4

acattgatca ggaaagtggt ttgtagaagt agcaacattt atagattcac tgcgagtgct 60

tcattttttg ttgaaacccc ggaccagtag gtggcagtgt tgtgtgtgtg tggtgagttt 120

cttttagcct gaattaatgg atgaatgtgt gcatgacatt ttttttaagt gtagagtagg 180

aaacacgagc gcattacctt cctccatgtc ac 212

<210>5

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>5

cataggtggg agtgtgcgag tgactggttg tgcgtctata tgtgtgtggc cctgctgcag 60

actggtatag gctccagcca ggggaaaaag ctgtagaaaa tgagtgagtg agtgagagaa 120

ataaacttgg ataagaagtt taacaaacaa aacacaagtt tgaaaacaat ggtgacaaat 180

aattggatct tttggccttt tcacattcac agcaat 216

<210>6

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>6

cccgcatgtg tcgctctcat cgctgttctt gccaatgccc gaacgcacat atctattttc 60

taccggctgc cctgtgaaac accggagctt ggtctgctca gtgtgtgtgt gtgtgtttgt 120

cgccccataa tcgctgtaac tgacttctta agcttttcct tcagttcacc ccccccctgg 180

cgcggaaaag atcccccgct gctcctgggg gggggt 216

<210>7

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>7

tcacatatta gcgcgtccta gcatattagc gcatgctaat aactacggtc tacgaaaaaa 60

ggtaacagaa gcaaaacact gagtttagta gaactttgtt taactaacta actaacttta 120

ctctcacata catttttaat cactcttccc ccacaaaacc atcaacgtca tcatctgcct 180

ccagtattag taaaggtagt ttctctgtgt caaaca 216

<210>8

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>8

ccacacattg aatctgacac tgtcattctg agaaattgat tcttcacaga aattaattaa 60

ttttcatttg gccccaagcg gcagcttaaa tcaggacaag ctcactcact cactcactga 120

tcctttcgct ctctctcctt cactctctct ctctctctct ctgtttcctt gcttaataac 180

ttgctgtctt atcatatcaa cactctttag ccctga 216

<210>9

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>9

ctcctctgcc ctattacatt taacaaaaac gccctgaaac tcatttggat gctacagaac 60

agatgtacac tgttgcatgt tagtaatatt gtttgcatac tgtatgtatg tatgtaaaca 120

cattctcatg cgtataatga agaggcatag actgaacccc aggggactct cgggcttaat 180

cattcacgtc gcctgctatt cttttaaata gagtca 216

<210>10

<211>214

<212>DNA

<213>Macropodus ocellatus

<400>10

tttattcgga gagcattttt actgggagtg acactaccac cttggacagt ataaatcaag 60

acatatatac acacagcatt tcaaaaaaca tgttgtttga atatatatat atatgtatct 120

cattttctaa tgctatatag atagtgcgta ctagatctac gttgcatgat ctctacagct 180

acagtacata taaggacagt acatatctac tgaa 214

<210>11

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>11

cgcgaagtct cagtcactac aagcttttcc tgtcacaggc catctagacc cacattctct 60

ccatctttca tcagcaacaa catattcaga ttagaactag ctgactgact gactgagtgc 120

tctgaaaaca gttgcttttc aagccgccag ctgactcttt ctttccaacg agcccgttga 180

ccttttacac aggagaaggc tgttagtcac cactca 216

<210>12

<211>212

<212>DNA

<213>Macropodus ocellatus

<400>12

ctgtctgggc ctgaaagatg tgagatgtgc aacattactc atctggatga atcagcgttt 60

aaagctcagt atcagataac agactgttgt aacttctact cacacacaca caaggacctt 120

ccaccaacat gtctcacatt cttttccatt cacagagttg aaatgacctc tcggttggcc 180

tgggaacgcc tcggggtccc cccggaagag ct 212

<210>13

<211>216

<212>DNA

<213>Macropodus ocellatus

<400>13

ttggtgtcaa gggtgccact cctgcttcac actctgtggt gatgggcctg ttgccatggc 60

agcagcagag cagctcatta gcaaatatta cccgtggccc agagagagag agagagcagg 120

gtgctgattt gatggacaac agacatcaaa taacaggttt acttctaata agaagaggga 180

ggcgccatga acaacgggag gagagacgat ctcgtg 216

<210>14

<211>218

<212>DNA

<213>Macropodus ocellatus

<400>14

ccgtactgcg tctcccaggt tcttggggcc tatgtagcat cagggctcgt ctatctggtc 60

tattacggtt cgtcatgtca cagaaagcta tacagaaaac tatatatata tatatatatg 120

tatatatgta tatgtatatg tatatgtgca tatgtgtctg cacacaaacc tacagtacgt 180

gcagatttac tgtttgcctc atctaagtat ctgtttct 218

<210>15

<211>20

<212>DNA

<213> Mo01F primer sequence (Artificial)

<400>15

ttaggccatt ttctacaagg 20

<210>16

<211>20

<212>DNA

<213> Mo01R primer sequence (Artificial)

<400>16

ctgtggatga attcgtctgt 20

<210>17

<211>20

<212>DNA

<213> Mo02F primer sequence (Artificial)

<400>17

gtcagggtgg agtaaataag 20

<210>18

<211>20

<212>DNA

<213> Mo02R primer sequence (Artificial)

<400>18

ggccacgatc aacactatta 20

<210>19

<211>25

<212>DNA

<213> Mo03F primer sequence (Artificial)

<400>19

tgggaaacat ctgtatattc tcacc 25

<210>20

<211>23

<212>DNA

<213> Mo03R primer sequence (Artificial)

<400>20

cagacctgat catcgtggat tac 23

<210>21

<211>23

<212>DNA

<213> Mo04F primer sequence (Artificial)

<400>21

cattgatcag gaaagtggtt tgt 23

<210>22

<211>23

<212>DNA

<213> Mo04R primer sequence (Artificial)

<400>22

tgcacacatt catccattaa ttc 23

<210>23

<211>23

<212>DNA

<213> Mo05F primer sequence (Artificial)

<400>23

caggggaaaa agctgtagaa aat 23

<210>24

<211>23

<212>DNA

<213>gaaaaggccaaaagatccaatta(Artificial)

<400>24

gaaaaggcca aaagatccaa tta 23

<210>25

<211>23

<212>DNA

<213> Mo06F primer sequence (Artificial)

<400>25

ccgaacgcac atatctattt tct 23

<210>26

<211>23

<212>DNA

<213> Mo06R primer sequence (Artificial)

<400>26

aagtcagtta cagcgattat ggg 23

<210>27

<211>23

<212>DNA

<213> Mo07F primer sequence (Artificial)

<400>27

acatattagc gcgtcctagc ata 23

<210>28

<211>23

<212>DNA

<213> Mo07R primer sequence (Artificial)

<400>28

gtgggggaag agtgattaaa aat 23

<210>29

<211>23

<212>DNA

<213> Mo08F primer sequence (Artificial)

<400>29

ttaattaatt ttcatttggc ccc 23

<210>30

<211>23

<212>DNA

<213> Mo08R primer sequence (Artificial)

<400>30

gcaaggaaac agagagagag aga 23

<210>31

<211>23

<212>DNA

<213> Mo09F primer sequence (Artificial)

<400>31

cctgaaactc atttggatgc tac 23

<210>32

<211>23

<212>DNA

<213> Mo09R primer sequence (Artificial)

<400>32

gggttcagtc tatgcctctt cat 23

<210>33

<211>23

<212>DNA

<213> Mo10F primer sequence (Artificial)

<400>33

tgacactacc accttggaca gta 23

<210>34

<211>23

<212>DNA

<213> Mo10R primer sequence (Artificial)

<400>34

gtagctgtag agatcatgca acg 23

<210>35

<211>23

<212>DNA

<213> Mo11F primer sequence (Artificial)

<400>35

ccacattctc tccatctttc atc 23

<210>36

<211>23

<212>DNA

<213> Mo11R primer sequence (Artificial)

<400>36

agccttctcc tgtgtaaaag gtc 23

<210>37

<211>23

<212>DNA

<213> Mo12F primer sequence (Artificial)

<400>37

ctgaaagatg tgagatgtgc aac 23

<210>38

<211>23

<212>DNA

<213> Mo12R primer sequence (Artificial)

<400>38

tgtgaatgga aaagaatgtg aga 23

<210>39

<211>23

<212>DNA

<213> Mo13F primer sequence (Artificial)

<400>39

tcattagcaa atattacccg tgg 23

<210>40

<211>24

<212>DNA

<213> Mo13R primer sequence (Artificial)

<400>40

cctgttattt gatgtctgtt gtcc 24

<210>41

<211>23

<212>DNA

<213> Mo14F primer sequence (Artificial)

<400>41

tattacggtt cgtcatgtca cag 23

<210>42

<211>23

<212>DNA

<213> Mo14R primer sequence (Artificial)

<400>42

gatgaggcaa acagtaaatc tgc 23

Claims (7)

1. The microsatellite molecular marker for the bullfight fish is characterized in that the nucleotide sequence of the microsatellite molecular marker is shown as any one of SEQ ID No.1 to SEQ ID No 14 in a sequence table, and the microsatellite molecular marker is respectively marked with the numbers of Mo01, Mo02, Mo03, Mo04, Mo05, Mo06, Mo07, Mo08, Mo09, Mo10, Mo11, Mo12, Mo13 and Mo 14.

2. The bullfight microsatellite molecular marker combination of claim 1 wherein two or more selected from the bullfight microsatellite molecular markers Mo01, Mo02, Mo03, Mo04, Mo05, Mo06, Mo07, Mo08, Mo09, Mo10, Mo11, Mo12, Mo13, Mo 14.

3. The microsatellite molecular marker primer for bullfight fish of claim 1, which is characterized in that: the primer sequence is SEQ ID No.15-42, wherein the sequence SEQ ID No.15-16 is used for amplifying Mo01, and the like.

4. The combination of microsatellite molecular marker primers for bullfight fish of claim 3 selected from two or more sets of primer pairs amplifying Mo01 to Mo 14.

5. The use of the microsatellite molecular markers of bullfight fish of claim 1 or the combination of microsatellite molecular markers of bullfight fish of claim 2 for population genetic diversity detection, individual identification or molecular assisted breeding of bullfight fish.

6. The round-tailed pollack microsatellite molecular marker primer set as set forth in claim 3 or the round-tailed pollack microsatellite molecular marker primer set as set forth in claim 4 is applied to population genetic diversity detection, individual identification or molecular assisted breeding of the round-tailed pollack.

7. The use according to claim 5 or 6, characterized in that the detection of the genetic diversity of bullfight comprising the steps of:

1) extraction of genomic DNA: adopting an animal genome DNA extraction kit of Beijing Optimalaceae new biotechnology Limited;

2) micro-satellite PCR amplification: amplifying genome DNA of the bullfight with the tail by adopting FAM, HEX and TAMRA fluorescence labeled microsatellite primers to obtain an amplification product;

3) electrophoresis of the amplification product: performing electrophoresis on a capillary electrophoresis gene analyzer, using GS500LIZ as a molecular weight internal standard, and using a Genemapper to perform primary processing on capillary electrophoresis data of an individual amplification product;

4) genetic diversity analysis: genotypes were determined based on the molecular weight of each individual microsatellite amplification product and genetic diversity parameters were calculated using Cervus 3.0.7.