CN107012224B - Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit - Google Patents
Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit Download PDFInfo
- Publication number
- CN107012224B CN107012224B CN201710261331.4A CN201710261331A CN107012224B CN 107012224 B CN107012224 B CN 107012224B CN 201710261331 A CN201710261331 A CN 201710261331A CN 107012224 B CN107012224 B CN 107012224B
- Authority
- CN
- China
- Prior art keywords
- homozygote
- growing
- site
- snp
- population
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and a kit for rapidly screening a fast growing individual of a spinibarbus hollandii and application. The nucleotides at the-686 position and the-522 position of the promoter of the melanocortin receptor of the barbel barb are named as SNP1 and SNP2 respectively and are detected; the SNP1 is a fast growing population when being a CT heterozygote, a second fast growing population when being a C homozygote, and a disadvantaged population when being a T homozygote; the SNP2 is a fast growing population when being an AG heterozygote, a second fast growing population when being a G homozygote, and a disadvantaged population when being an A homozygote; due to the additive effect of the micro-effect genes, the growth speed is fastest when the SNP1 site and the SNP2 site are both heterozygotes, the growth speed is second when only one of the two sites is a heterozygote and the other site is a homozygote which grows faster, and the rest can be analogized. According to the method, the kit is obtained and is used for rapidly screening individuals with the rapid growth of the spinibarbus grahami.
Description
Technical Field
The invention belongs to the technical field of aquatic inheritance and molecular breeding, and particularly relates to a method for rapidly screening a fast-growing individual of barbel grahami, a kit and application.
Background
Barcheilus grahami (Spinibarbus hollandi) belongs to Cyprinales, Cyprinaceae, Barcheilus subfamily, and Barcheilus grahami. Has the advantages of large size, fast growth, wide eating quality, hypoxia tolerance, strong disease resistance, easy cultivation, etc. Is distributed in various water systems of Yangtze river, Qiantangjiang river, Minjiang river, Jiulongjiang river, Zhujiang river, Yuanjiang river, Taiwan island, Hainan island and the like. Because the sinocyclocheilus grahami inbreeding and the grazing hybridization lead to the germ plasm resource of the sinocyclocheilus grahami to be damaged, the species of the sinocyclocheilus grahami is degenerated, the yield is reduced, the sinocyclocheilus grahami is susceptible to diseases and the like, and the germ plasm improvement of the sinocyclocheilus grahami is a problem to be solved urgently.
Single Nucleotide Polymorphisms (SNPs) refer to genetic markers formed by variation of a Single Nucleotide on a genome, including transitions, transversions, deletions and insertions, and are abundant in number and polymorphism. In the human genome, one SNP is present in every 1000 bases. In fish, SNP may affect immunity, metabolism, hypoxia tolerance, growth traits and the like of fish, and the speed and accuracy of screening can be greatly improved by using SNP as a molecular marker for assisted breeding.
Melanocortin Receptor (Melanocortin-4Receptor, MC4R), a G protein-coupled Receptor, has a wide range of effects on energy balance, fat metabolism, balance, and other aspects of the body. MC4R is an important growth trait control gene, and since polymorphism of the gene also causes polymorphism of biological growth indicators, it is of great economic value for research on MC4R, and therefore, in recent years, much attention has been paid to the gene in animal husbandry and fishery.
At present, no research report about the MC4R SNP of the spinibarbus grahami and the growth characteristics of the spinibarbus grahami exists.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a method for rapidly screening individuals with fast growth of the spinibarbus hollandii.
Another object of the present invention is to provide a kit for rapidly screening individuals with fast growing spinulobarbus grahami.
The invention further aims to provide the method for rapidly screening the individuals with the rapid growth of the Sinocyclocheilus grahami and the application of the kit.
The purpose of the invention is realized by the following technical scheme: a method for rapidly screening individuals with fast growth of Sinocyclocheilus grahami comprises the following steps:
(1) the nucleotides at the-686 position and the-522 position of the promoter of the melanocortin receptor of the barbel barb are named as SNP1 and SNP2 respectively, and detection is carried out;
(2) screening was performed according to the following criteria:
① the fast growing population when the position 1 of SNP is CT heterozygote, the second fast growing population when the position is C homozygote, and the inferior population when the position is T homozygote;
② the fast growing population when the 2 th SNP is AG heterozygote, the second fast growing population when G homozygote, and the inferior population when A homozygote;
③ due to additive effect of micro-effective gene, the growth speed is fastest when SNP1 site and SNP2 site are both heterozygotes, when only one of the two sites is heterozygote and the other is homozygote which grows faster, the growth speed is second, and the rest is analogized, that is, according to the growth speed, SNP1 site and SNP2 site are both heterozygote > SNP1 site and SNP2 site are one heterozygote and the other is homozygote which grows faster (C homozygote or G homozygote) > SNP1 site and SNP2 site are both homozygotes which grow faster (C homozygote and G homozygote) > 1 site and SNP2 site are one heterozygote and the other is homozygote which grows slower than SNP1 site and SNP2 site are both homozygote which grows faster and the other is homozygote which grows slower > 1 site and SNP2 site are both homozygotes which grow slower (T homozygote and A homozygote).
The melanocortin receptor genome sequence of the barbel barb obtained in the step (1) is shown as the following (SEQ ID No. 1); or a sequence with one or more mutations or deletions of the sequence shown in the following (SEQ ID NO. 1); the coding region is underlined and the SNPs sites found are in bold boxes.
ATATCTTTAGATTTATTCACAAACTAAAGTGACTCTCTTTGCATGAATCGTTGGATTATTAATATAGCCAATTCATTCAAAA
ATTGACTCATTCAGAAATTAAACAAGTGATTGTCGCAGTGAATCACTGAATCATTTATATATTTAAATATACTTTGAATTACTTGATTTTATAAACATACCATCAAAATGCTTTAAGAAATCATGCACTTCCTATAAAGGATTTTATCTATTTGTTGAAAACA
AGGCAACCCCATTCATACACTGACCTCCTTCTGATATTTGCTTACATTCACCCATCAGAACTGCCTCTGATTGGTGGAGAAAGCTGGGGGAGGAGCCTGGGCTCAGTGTGCCAGACAGTGGCTGTGGAGGCAAGAGTATCTCACTCGCCCGCCTGCCAAGTGCTGGAAGCTCTGGAGACTGCCTCGCTCTGAACACTGTTTGCACTTCAACAGTGTTGAAACAGAGTCAGCGTTTTCAGATTCGGTCAACTGACGCTGTCTCCTATCCTCTGATTCTCTGTCTGCATGTTTCTGTCTCTATTTTTTTTACATTTTATTTATTTTTGTTTTGTGTAGGAGGCTCTTGCAGACCACTGGCGGACGTTTTTGCTGATTTGGAGGAAGAGTTATCACAGAGGTGAGGTGACGGATGCTCACACAGCACCTGCTTTGTTTGATCTACATGACGGATGATGTTCAATTTGAATTCACCTGACTGAAGTAGACACAGATCAAAACACTGACTACAGATATTAAGGGAAATGAACACCTCACATCATCATGGACTGCATCATTCATACCGGAATCACAGCC AGGGAGCTTTACCGGTGGGAAAGCCTGCTCAGGGCGAGAGAAGATCAACCTCTGGATGCTATGAGCAGCTGCTCAT CTCCACAGAGGTCTTCCTCACACTCGGGCTCGTCAGTCTCCTGGAGAACATTCTGGTGATTGCGGCTATTGTCAAG ACAAGAACTTCATCTCCCATGTACTTCTTTATCTGCAGTTTAGCCGTAGCAGACTTGTTGGTCAGTGTCTCCAATG CGTCAGAAACAGTAGTGATGGCGCTCATCACGGGTGGCAACCTGACCAATCGCGAGAGCATCATCAAGAACATGGA CAACATTTTTGACTCGATGATCTGCAGCTCGCTGTTGGCCTCCATTTGGAGTTTGTTGGCCATTGCGGTGGACCGC TACATCACAATCTTCTACGCTTTGCGCTACCACAACATCATGACCCAACGGCGGGCGGGCACCATCATCACCTGCA TTTGGACCTTCTGCACGGTCTCTGGTGTGCTCTTTATCGTGTACTCGGAGAGCACCACCGTTCTCATCTGCCTTAT CAGCATGTTCTTCACCATGCTGGCGCTTATGGCCTCGCTCTATGTCCACATGTTTCTTCTAGCCCGACTGCACATG AAGCGCATTGCCGCCCTCCCCGGCAACGGCCCTATCTGGCAGGCGGCAAATATGAAAGGGGCCATCACCATCACTA TCCTGCTGGGTGTATTCGTGGTGTGCTGGGCTCCCTTTTTCTTGCACCTCATCCTCATGATCTCCTGCCCTCGGAA CCCTTATTGCATCTGTTTCATGTCCCACTTCAACATGTATCTGATCCTCATTATGTGCAACTCGGCCATAGACCCT CTCATCTATGCCTTCAGGAGCCAAGAGATGAGGAAGACCTTCAAGGAGATCTGCTGCTGCTGCTGTGGATTGACCT CTCTGTGTGTATAGCCTTTTTACTGTTTCACGTCAAGGTGCTGATTGTGAGATGTTGGCTTGCAAGACAACACTAAGCAACTGTCACTGGATGCATGCTGAAAATGTAGAAGATCTAATTACACTGCATAGCTTGTGTGATTATTCTGCGCACACATTTATTTGATACCCAGAGAAATATGATACTATGGATGTGCTGACCATGAAAAAATGCTAATGTTAATGACTCAAGGATTTATTGACATGCTGTTTTGGTGTTTATTTATATTTACAAGTCTCATTCATTTTACCTGCTGAATAAGACATCAAAAAGTCAAAGTGCCAATATTTAAAAGCATTAAATGACAGAAAATTCATGGCACTGTGTGTGTTGTGATTCAGTGACTCAAGCACATGCACAATATTTGGCAACTGTGAATATGTTCTCTTAGCAGGTTGGTACTTCAGTTATTCAGCTTGAGAACCATTGCTGCTTGATAAATGTTTCAGACTTATGAATTTATTTTTGTATTTTGTAAGTTATCGTTTTATTTATTTATTTGTAATGCCATTTCATTGTGCAAATAAAACCACATCAAAACCAGTAATTATGCCTCATATTTTCTTGTGGAATTGCTAAAACAATAGTAGATTTGATGGTCTGGTAGGGATTTTGCTTTTGCGTCTTAGATTTTATTCCATTTTCCTTCCTTTCCATCTTCAGAGTCGTGGAACTCAAAAAGTAAATGTCTATATTATCTACTAAAAGACTGCCTACAAGCTCTTAGAAGCTATTTATTTAATCAGTCTGTTTTGAAGGTTACCACATTGCACTGAATAGACTCTCATCTAGTACGACTACAAAAGGAA。
The method for rapidly screening the individuals growing rapidly in the Sinocyclocheilus grahami is applied to screening of the individuals growing rapidly in the Sinocyclocheilus grahami.
A kit for rapidly screening individuals with the rapid growth of the barbecuius spinosus is designed according to the method, and comprises a primer group for detecting 1 th nucleotide of the SNP of the melanocortin receptor of the barbecuius spinosus and a primer group for detecting 2 th nucleotide of the SNP of the melanocortin receptor of the barbecuis spinosus.
The kit for rapidly screening the individual rapidly growing from the Sinocyclocheilus grahami further comprises at least one of an enzyme for PCR, a buffer solution for PCR and water for PCR.
The primer group is preferably arranged in a relatively conservative area, so that the influence of gene polymorphism on amplification effects of the barbel from different sources is avoided.
The primer set for detecting the 1 th nucleotide of the SNP of the melanocortin receptor of the barbel barb is a primer set capable of amplifying a sequence containing 1 th nucleotide of the SNP, and preferably comprises the following steps:
primer SNP 1F: 5'-TCTTTATGAGTGAATTACTGAATC-3', respectively;
primer SNP 1R: 5'-AGGAAGTGCATGATTTCTTAAAG-3' are provided.
The primer set for detecting the 2 th nucleotide of the SNP of the melanocortin receptor of the barbel barb is a primer set capable of amplifying a sequence containing 2 th nucleotide of the SNP, and preferably comprises the following steps:
primer SNP 2F: 5'-GCAGTGAATCACTGAATCAT-3', respectively;
primer SNP 2R: 5'-CACCAATCAGAGGCAGTTC-3' are provided.
The enzyme for PCR is preferably Taq enzyme.
The PCR water is preferably deionized water or distilled water.
Quick screening light barb ba cheilus gracilis grows the application of individual's kit in screening light barb ba cheilus gracilis grows the individual fast, concrete step is preferred as follows:
(A) amplifying the genome of the spinibarbus gracilis by using a primer group for detecting 1 th nucleotide of the SNP of the spinibarbus gracilis melanocortin receptor and a primer group for detecting 2 th nucleotide of the SNP of the spinibarbus gracilis melanocortin receptor to obtain an amplification product;
(B) sequencing the amplified product, and screening the obtained sequencing result according to the following standards:
① the fast growing population when the position 1 of SNP is CT heterozygote, the second fast growing population when the position is C homozygote, and the inferior population when the position is T homozygote;
② the fast growing population when the 2 th SNP is AG heterozygote, the second fast growing population when G homozygote, and the inferior population when A homozygote;
③ due to the additive effect of the micro-effect gene, the growth speed is fastest when the SNP1 site and the SNP2 site are both heterozygotes, the growth speed is second when only one of the two sites is heterozygote and the other is homozygote which grows faster, and the like.
Compared with the prior art, the invention has the following advantages and effects:
the invention is based on the invention that the inventor finds that the nucleotide at 1 th position and 2 th position of the melanocortin receptor of the barbel spinuloides has influence on the growth of the barbel spinuloides. The method is beneficial to rapidly screening the fast growing individuals of the Sinocyclocheilus grahami.
Drawings
FIG. 1 is a sequence diagram of SNP1, nucleotide homozygote C.
FIG. 2 is a sequence diagram of the SNP1 in the form of a homozygote T.
FIG. 3 is a sequence diagram of the SNP at nucleotide 1 which is a heterozygote C/T.
FIG. 4 is a sequence diagram of the SNP2 in the form of a homozygote G.
FIG. 5 is a sequence diagram of SNP2, in which nucleotide is homozygote A.
FIG. 6 is a sequence diagram of the SNP at nucleotide 2 which is a heterozygote G/A.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
Example 1
The experiment adopts 334 light spiny barbel barbus of 1.5 years old which are simultaneously stocked and bred in the same pool to carry out the experiment, and the specific steps are as follows:
(1) each barbel tail was clipped a little tail fin and then labeled on the barbel tail. And marking the collected tail fins, corresponding to each tail light spingar one by one, and marking the tail fins with Arabic numerals.
(2) Each tail of the Sinocyclocheilus grahami was incubated at 80 ℃ for 15min with 2mg of tail fin, 50. mu.l of the DNA extract obtained by the universal single-step method (Biotechnology engineering, Shanghai, Ltd.) added thereto. After brief shaking and mixing, the lysate is taken to directly carry out PCR.
The PCR system was as follows:
the reaction conditions for PCR were as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 20s, renaturation at 51 ℃ for 20s, and extension at 72 ℃ for 25s for 30 cycles; extension at 72 ℃ for 5 min.
(3) The resulting PCR product was aspirated into 4. mu.l and detected by 1% agarose electrophoresis, and was normally displayed as a band of approximately 200 bp. And directly sequencing the PCR product which is qualified for detection.
(4) The sequencing results were analyzed as follows:
in the sequencing result, a single peak is homozygote, a mantle peak is heterozygote, the homozygote C of SNP1 is shown in figure 1, the homozygote T is shown in figure 2, and the heterozygote C/T is shown in figure 3. SNP homozygote G at SNP position 2 is shown in FIG. 4, homozygote A is shown in FIG. 5, and heterozygote A/G is shown in FIG. 6. Arrows indicate SNP sites.
The rapid growth population when the position 1 of the SNP is a CT heterozygote; the C homozygote is the second rapid growth population; the T homozygote is a disadvantaged population; the rapid growth population when the AG heterozygote is at SNP 2; g homozygote is the second rapid growth population; a homozygote is a disadvantaged population. Combining with the label, and screening out the fast growing individuals. The statistical results of SNPs and body weight, full length, body width and body height are shown in Table 1. The CT heterozygote in SNP1 is significantly higher than two homozygote individuals in the statistics of weight, full length, body width and body height, and the homozygote C is significantly higher than the homozygote T in body width. In SNP2, the AG heterozygote was significantly higher than two homozygote individuals in the statistics of body weight, full length, body width, and body height, and homozygote G was significantly higher than homozygote a in body width (P < 0.05).
TABLE 1 Association of growth indicators with different genotypes for SNP1 and SNP2
Note: the same letter indicates that the difference is not significant, and different letters indicate that the difference is significant.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> Guangzhou university
<120> method and kit for rapidly screening fast growing individuals of Sinocyclocheilus grahami and application
<130>1
<160>5
<170>PatentIn version 3.5
<210>1
<211>2580
<212>DNA
<213> barbel grahami
<220>
<221>Y=C/T
<222>(83)..(83)
<220>
<221>R=A/G
<222>(247)..(247)
<400>1
atatctttag atttattcac aaactaaagt gactctcttt gcatgaatcg ttggattatt 60
aatatagcca attcattcaa aayattgact cattcagaaa ttaaacaagt gattgtcgca 120
gtgaatcact gaatcattta tatatttaaa tatactttga attacttgat tttataaaca 180
taccatcaaa atgctttaag aaatcatgca cttcctataa aggattttat ctatttgttg 240
aaaacaragg caaccccatt catacactga cctccttctg atatttgctt acattcaccc 300
atcagaactg cctctgattg gtggagaaag ctgggggagg agcctgggct cagtgtgcca 360
gacagtggct gtggaggcaa gagtatctca ctcgcccgcc tgccaagtgc tggaagctct 420
ggagactgcc tcgctctgaa cactgtttgc acttcaacag tgttgaaaca gagtcagcgt 480
tttcagattc ggtcaactga cgctgtctcc tatcctctga ttctctgtct gcatgtttct 540
gtctctattt tttttacatt ttatttattt ttgttttgtg taggaggctc ttgcagacca 600
ctggcggacg tttttgctga tttggaggaa gagttatcac agaggtgagg tgacggatgc 660
tcacacagca cctgctttgt ttgatctaca tgacggatga tgttcaattt gaattcacct 720
gactgaagta gacacagatc aaaacactga ctacagatat taagggaaat gaacacctca 780
catcatcatg gactgcatca ttcataccgg aatcacagcc agggagcttt accggtggga 840
aagcctgctc agggcgagag aagatcaacc tctggatgct atgagcagct gctcatctcc 900
acagaggtct tcctcacact cgggctcgtc agtctcctgg agaacattct ggtgattgcg 960
gctattgtca agacaagaac ttcatctccc atgtacttct ttatctgcag tttagccgta 1020
gcagacttgt tggtcagtgt ctccaatgcg tcagaaacag tagtgatggc gctcatcacg 1080
ggtggcaacc tgaccaatcg cgagagcatc atcaagaaca tggacaacat ttttgactcg 1140
atgatctgca gctcgctgtt ggcctccatt tggagtttgt tggccattgc ggtggaccgc 1200
tacatcacaa tcttctacgc tttgcgctac cacaacatca tgacccaacg gcgggcgggc 1260
accatcatca cctgcatttg gaccttctgc acggtctctg gtgtgctctt tatcgtgtac 1320
tcggagagca ccaccgttct catctgcctt atcagcatgt tcttcaccat gctggcgctt 1380
atggcctcgc tctatgtcca catgtttctt ctagcccgac tgcacatgaa gcgcattgcc 1440
gccctccccg gcaacggccc tatctggcag gcggcaaata tgaaaggggc catcaccatc 1500
actatcctgc tgggtgtatt cgtggtgtgc tgggctccct ttttcttgca cctcatcctc 1560
atgatctcct gccctcggaa cccttattgc atctgtttca tgtcccactt caacatgtat 1620
ctgatcctca ttatgtgcaa ctcggccata gaccctctca tctatgcctt caggagccaa 1680
gagatgagga agaccttcaa ggagatctgc tgctgctgct gtggattgac ctctctgtgt 1740
gtatagcctt tttactgttt cacgtcaagg tgctgattgt gagatgttgg cttgcaagac 1800
aacactaagc aactgtcact ggatgcatgc tgaaaatgta gaagatctaa ttacactgca 1860
tagcttgtgt gattattctg cgcacacatt tatttgatac ccagagaaat atgatactat 1920
ggatgtgctg accatgaaaa aatgctaatg ttaatgactc aaggatttat tgacatgctg 1980
ttttggtgtt tatttatatt tacaagtctc attcatttta cctgctgaat aagacatcaa 2040
aaagtcaaag tgccaatatt taaaagcatt aaatgacaga aaattcatgg cactgtgtgt 2100
gttgtgattc agtgactcaa gcacatgcac aatatttggc aactgtgaat atgttctctt 2160
agcaggttgg tacttcagtt attcagcttg agaaccattg ctgcttgata aatgtttcag 2220
acttatgaat ttatttttgt attttgtaag ttatcgtttt atttatttat ttgtaatgcc 2280
atttcattgt gcaaataaaa ccacatcaaa accagtaatt atgcctcata ttttcttgtg 2340
gaattgctaa aacaatagta gatttgatgg tctggtaggg attttgcttt tgcgtcttag 2400
attttattcc attttccttc ctttccatct tcagagtcgt ggaactcaaa aagtaaatgt 2460
ctatattatc tactaaaaga ctgcctacaa gctcttagaa gctatttatt taatcagtct 2520
gttttgaagg ttaccacatt gcactgaata gactctcatc tagtacgact acaaaaggaa 2580
<210>2
<211>24
<212>DNA
<213>artificial sequence
<220>
<223> primer SNP1F
<400>2
tctttatgag tgaattactg aatc 24
<210>3
<211>23
<212>DNA
<213>artificial sequence
<220>
<223> primer SNP1R
<400>3
aggaagtgca tgatttctta aag 23
<210>4
<211>20
<212>DNA
<213>artificial sequence
<220>
<223> primer SNP2F
<400>4
gcagtgaatc actgaatcat 20
<210>5
<211>19
<212>DNA
<213>artificial sequence
<220>
<223> primer SNP2R
<400>5
caccaatcag aggcagttc 19
Claims (8)
1. A method for screening individuals with rapid growth of Sinocyclocheilus grahami is characterized by comprising the following steps:
(1) the nucleotides at the-686 position and the-522 position of the promoter of the melanocortin receptor of the barbel barb are named as SNP1 and SNP2 respectively, and detection is carried out;
(2) screening was performed according to the following criteria:
① the fast growing population when the position 1 of SNP is CT heterozygote, the second fast growing population when the position is C homozygote, and the inferior population when the position is T homozygote;
② the fast growing population when the 2 th SNP is AG heterozygote, the second fast growing population when G homozygote, and the inferior population when A homozygote;
③ due to the additive effect of the micro-effect gene, according to the growth speed, the SNP1 site and the SNP2 site are both heterozygotes > one of the SNP1 site and the SNP2 site is heterozygote, the other is a faster-growing homozygote > SNP1 site and the SNP2 site is both a faster-growing homozygote > SNP1 site and one of the SNP2 site is a faster-growing homozygote, and the other is a slower-growing homozygote > SNP1 site and the SNP2 site are both slower-growing homozygotes;
the melanocortin receptor genome sequence of the barbel barb obtained in the step (1) is shown in SEQ ID No. 1.
2. The method for screening a fast growing individual of barbel grahami according to claim 1, wherein the method is applied to screening of the fast growing individual of barbel grahami.
3. A kit for screening a fast-growing individual of a barbel grahami, which is designed according to the method of claim 1, wherein the kit comprises: the primer set containing 1 th nucleotide of SNP of melanocortin receptor of the sinocyclocheilus grahami and the primer set containing 2 th nucleotide of SNP of melanocortin receptor of the sinocyclocheilus grahami.
4. The kit for screening a rapidly growing individual from the Sinocyclocheilus grahami according to claim 3, wherein: further comprises at least one of an enzyme for PCR, a buffer for PCR and water for PCR.
5. The kit for screening a rapidly growing individual from Sinocyclocheilus grahami according to claim 3 or 4, wherein:
the primer group for detecting the 1 th nucleotide of the SNP of the melanocortin receptor of the barbel barb is as follows: primer SNP 1F: 5'-TCTTTATGAGTGAATTACTGAATC-3', respectively;
primer SNP 1R: 5'-AGGAAGTGCATGATTTCTTAAAG-3' are provided.
6. The kit for screening a rapidly growing individual from Sinocyclocheilus grahami according to claim 3 or 4, wherein:
the primer group for detecting the 2 th nucleotide of the SNP of the melanocortin receptor of the barbel barb is as follows:
primer SNP 2F: 5'-GCAGTGAATCACTGAATCAT-3', respectively;
primer SNP 2R: 5'-CACCAATCAGAGGCAGTTC-3' are provided.
7. The kit for screening a rapidly growing individual from the Sinocyclocheilus grahami according to claim 4, wherein: the enzyme for PCR is Taq enzyme;
the PCR water is deionized water or distilled water.
8. The use of the kit for screening the individual with the fast growing barbel grahami according to any one of claims 3 to 7 in screening the individual with the fast growing barbel grahami, which is characterized by comprising the following steps:
(A) amplifying the genome of the spinibarbus gracilis by using a primer group for detecting 1 th nucleotide of the SNP of the spinibarbus gracilis melanocortin receptor and a primer group for detecting 2 th nucleotide of the SNP of the spinibarbus gracilis melanocortin receptor to obtain an amplification product;
(B) sequencing the amplified product, and screening the obtained sequencing result according to the following standards:
① the fast growing population when the position 1 of SNP is CT heterozygote, the second fast growing population when the position is C homozygote, and the inferior population when the position is T homozygote;
② the fast growing population when the 2 th SNP is AG heterozygote, the second fast growing population when G homozygote, and the inferior population when A homozygote;
③ due to the additive effect of the micro-effect gene, according to the growth speed, the SNP1 site and the SNP2 site are both heterozygotes > one of the SNP1 site and the SNP2 site is heterozygote, the other is a faster-growing homozygote > SNP1 site and the SNP2 site is both a faster-growing homozygote > SNP1 site and one of the SNP2 site is a faster-growing homozygote, and the other is a slower-growing homozygote > SNP1 site and the SNP2 site are both slower-growing homozygotes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710261331.4A CN107012224B (en) | 2017-04-20 | 2017-04-20 | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710261331.4A CN107012224B (en) | 2017-04-20 | 2017-04-20 | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012224A CN107012224A (en) | 2017-08-04 |
| CN107012224B true CN107012224B (en) | 2020-07-31 |
Family
ID=59448531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710261331.4A Active CN107012224B (en) | 2017-04-20 | 2017-04-20 | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012224B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795662A (en) * | 2021-01-08 | 2021-05-14 | 广州大学 | Identification method of barbel grahami and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966209A (en) * | 2014-05-02 | 2014-08-06 | 华中农业大学 | SNP molecular marker related to intramuscular fat content characters of pigs and application of SNP molecular marker |
| CN105002171A (en) * | 2015-07-30 | 2015-10-28 | 江苏省淡水水产研究所 | SNP mark related to weight of eriocheir sinensis and application of SNP mark |
| KR20160127882A (en) * | 2015-04-27 | 2016-11-07 | 대한민국(농촌진흥청장) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same |
| CN106282365A (en) * | 2016-09-09 | 2017-01-04 | 广州大学 | A kind of test kit quickly light agnail different groups classified |
| CN106399530A (en) * | 2016-10-17 | 2017-02-15 | 华南师范大学 | Spinibarbus dneticulatus microsatellite family identification method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110054246A1 (en) * | 2009-08-28 | 2011-03-03 | Clutter Archie C | Whole genome scan to discover quantitative trai loci (qtl) affecting growth, body composition, and reproduction in maternal pig lines |
-
2017
- 2017-04-20 CN CN201710261331.4A patent/CN107012224B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966209A (en) * | 2014-05-02 | 2014-08-06 | 华中农业大学 | SNP molecular marker related to intramuscular fat content characters of pigs and application of SNP molecular marker |
| KR20160127882A (en) * | 2015-04-27 | 2016-11-07 | 대한민국(농촌진흥청장) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same |
| CN105002171A (en) * | 2015-07-30 | 2015-10-28 | 江苏省淡水水产研究所 | SNP mark related to weight of eriocheir sinensis and application of SNP mark |
| CN106282365A (en) * | 2016-09-09 | 2017-01-04 | 广州大学 | A kind of test kit quickly light agnail different groups classified |
| CN106399530A (en) * | 2016-10-17 | 2017-02-15 | 华南师范大学 | Spinibarbus dneticulatus microsatellite family identification method |
Non-Patent Citations (4)
| Title |
|---|
| "Association of the melanocortin 4 receptor with feed intake and daily gain in F2 Mangalitsa X Pietrain pigs";K. Meidtner et al.;《Animal Genetics》;20061231;第37卷;第245-247页 * |
| "Characterization of the melanocortin-4 receptor gene from Spinibarbus hollandi and the association between its polymorphisms and S. hollandi growth traits";Yang Yang et al.;《Fish Sci》;20170828;第1-10页 * |
| "光倒刺鲃黑色素皮质素受体-4(MC4R)的克隆以及与生长性状的关联分析";杨杨等;《2017年中国水产学会学术年会论文摘要集》;20171130;第1-2页 * |
| "罗非鱼MC4R 基因克隆及与其生长相关的SNPs位点";刘福平等;《中国水产科学》;20091130;第16卷(第6期);第816-823页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012224A (en) | 2017-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | A preliminary genetic linkage map of the Pacific abalone Haliotis discus hannai Ino | |
| CN110004235B (en) | SNP locus related to rapid growth of fugu obscurus and application | |
| CN109971865B (en) | SNP marker significantly related to weight traits of litopenaeus vannamei and application | |
| CN101142481A (en) | Method of detecting pork quality and carcass traits | |
| CN110527738B (en) | Major QTL (quantitative trait loci) site and SNP (single nucleotide polymorphism) molecular marker for oleic acid content of brassica napus seeds and application of major QTL site and SNP molecular marker | |
| CN114150070B (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
| CN104099415B (en) | A kind of detection primer of the SNP marker associated with pteria martensii closed shell flesh heavy phase and application thereof | |
| CN116497129B (en) | Gene molecular marker related to stichopus japonicus growth traits and application thereof | |
| CN110592251A (en) | Development and application of major QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) molecular marker for flowering phase characters of brassica napus | |
| CN109055580B (en) | Molecular marker related to growth in C-type scavenger receptor of litopenaeus vannamei and application | |
| WO2022258078A1 (en) | Primer set for identifying sex-linked dwarf gene and application thereof | |
| CN108559782B (en) | Paramisgurnus brevifolia microsatellite loci and primers and application thereof | |
| KR101845027B1 (en) | Mircrosatellite marker group for the abalone species distinction, analysis of genetic diversity and parentage profile, and method of analyzing using the same | |
| CN107012224B (en) | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit | |
| CN104328119A (en) | Microsatellite molecular marker related to growth character of megalobrama amblycephala and application of molecular marker | |
| Peng et al. | Genetic diversity of three consecutive generations of Litopenaeus vannamei. | |
| CN106367502A (en) | Gene SPP1 as molecular marker for ovine growth traits and application of molecular marker | |
| CN110257533B (en) | Microsatellite marker locus of bullfight and primer thereof | |
| CN110527739B (en) | Major QTL (quantitative trait locus) site of glucosinolate content of brassica napus seeds, SNP (Single nucleotide polymorphism) molecular marker and application thereof | |
| CN110317887B (en) | Paramisgurnus dabryanus polymorphic microsatellite marker locus, primer and application thereof | |
| CN108251456B (en) | Preparation method of atherosclerosis mouse model with NOD genetic background | |
| CN102559691B (en) | Silkworm sex chromosome linked gene PdpI and recessive lethal mutation gene thereof and application of silkworm sex chromosome linked gene PdpI and recessive lethal mutation gene in silkworm sex ratio control | |
| Isa et al. | Mutations in inhibin alpha gene and their association with litter size in Kalahari Red and Nigerian goats | |
| CN106554996B (en) | Megalobrama amblycephala transferrin receptor gene SNP molecular marker and application thereof | |
| CN109680043A (en) | A kind of MSTN gene molecule marker selection method of Shelled Turtle Trionyx Sinensis growth traits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |