CN107012224A - A kind of method of quick screening light hangnail Barb fast-growths individual and kit and application - Google Patents
A kind of method of quick screening light hangnail Barb fast-growths individual and kit and application Download PDFInfo
- Publication number
- CN107012224A CN107012224A CN201710261331.4A CN201710261331A CN107012224A CN 107012224 A CN107012224 A CN 107012224A CN 201710261331 A CN201710261331 A CN 201710261331A CN 107012224 A CN107012224 A CN 107012224A
- Authority
- CN
- China
- Prior art keywords
- fast
- growth
- snp1
- snp2
- sites
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention discloses method and kit and the application of a kind of quick screening light hangnail Barb fast-growths individual.The 686th and the 522nd nucleotides of promoter of light hangnail Barb Melanocortin receptor is respectively designated as SNP1 and SNP2 by the present invention, and is detected；SNP1 are fast growth when being CT heterozygotes, are time fast growth when being C homozygotes, are inferior position colony when being T homozygotes；SNP2 are fast growth when being AG heterozygotes, are time fast growth when being G homozygotes, are inferior position colony when being A homozygotes；Due to the additive effect of minor gene, when SNP1 sites and SNP2 sites are heterozygote, the speed of growth is most fast, when in two sites only one of which be heterozygote another be to grow faster homozygote when, the speed of growth is taken second place, and other are by that analogy.According to this method, kit is obtained, and be used in the quick screening of light hangnail Barb fast-growths individual.
Description
Technical field
The invention belongs to aquatic products heredity and molecular breeding technology field, more particularly to a kind of quick screening light hangnail Barb is quick
Grow method and kit and the application of individual.
Background technology
Light hangnail Barb (Spinibarbus hollandi) belongs to Cypriniformes, Cyprinidae, Barbinae, hangnail Barb category.With individual
Greatly, the advantages of growing that fast, feeding habits are wide, lower oxygen concentration resistance, premunition are strong, easily cultivate.Be distributed in the Changjiang river, the Qiantang River, the Min River, Jiulongjiang River,
All water systems such as the Zhujiang River, Yuanjiang River, the island of Taiwan and Hainan Island.Due to light hangnail Barb inbreeding, hybridization wantonly causes light hangnail Barb's
Germ plasm resource is destroyed, and its species is degenerated, is caused the underproduction, easily susceptible etc. result, and the germplasm improvement for light hangnail Barb is
Instantly urgent problem to be solved.
SNP, full name (Single Nucleotide Polymorphisms, SNPs), refers in gene
The variation of single nucleotide acid in group, including conversion, transversion, missing and insertion, the genetic marker of formation, its quantity are a lot, polymorphic
Property it is abundant.In the genome of the mankind in every 1000 bases, a SNP there is.In fish, SNP may be influenced whether
Immune, the metabolism of fish, lower oxygen concentration resistance degree, growth traits etc., assistant breeding is carried out using SNP as molecular labeling, it will pole
The earth improves the speed and accuracy rate of screening.
Melanocortin receptor (Melanocortin-4Receptor, MC4R), is a kind of g protein coupled receptor, with
Internal energy balance, fat metabolism, balance etc. other aspect have wide influence.MC4R is due to being important growth traits
Gene is controlled, the gene polynorphisms also result in the polymorphism of biological growth index, have very big warp to MC4R research
Ji value, so extremely being paid close attention to the gene in animal husbandry and fishery in recent years.
At present, do not reported on light hangnail Barb MC4R SNP with the correlative study of light hangnail Barb growth characteristics also.
The content of the invention
The primary and foremost purpose of the present invention is to overcome the shortcoming and deficiency of prior art quickly to screen light hangnail Barb there is provided a kind of
The method of fast-growth individual.
Another object of the present invention is to provide a kind of kit of quick screening light hangnail Barb fast-growths individual.
It is still another object of the present invention to provide the method for described quick screening light hangnail Barb fast-growths individual and
The application of kit.
The purpose of the present invention is achieved through the following technical solutions：A kind of side of quick screening light hangnail Barb fast-growths individual
Method, comprises the following steps：
(1) the -686th and the -522nd nucleotides of promoter of light hangnail Barb Melanocortin receptor is ordered respectively
Entitled SNP1 and SNP2, and detected；
(2) screened according to following standard：
1. it is fast growth when SNP1 are CT heterozygotes；It is time fast growth during for C homozygotes；For T
It is inferior position colony during homozygote；
2. it is fast growth when SNP2 are AG heterozygotes；It is time fast growth during for G homozygotes；For A
It is inferior position colony during homozygote；
3. due to the additive effect of minor gene, when SNP1 sites and SNP2 sites are heterozygote, the speed of growth is most
It hurry up；When in two sites only one of which be heterozygote another be grow faster homozygote when, the speed of growth is taken second place；Other with
This analogizes, i.e., by the speed of growth, SNP1 sites and SNP2 sites be in heterozygote ＞ SNP1 sites and SNP2 sites one be
Heterozygote and another to grow very fast homozygote (C homozygotes or G homozygotes) ＞ SNP1 sites and SNP2 sites is growth
One is heterozygote and another is growth in very fast homozygote (C homozygotes and G homozygotes) ＞ SNP1 sites and SNP2 sites
One is the very fast homozygote of growth and another is the slower homozygote of growth in slower homozygote ＞ SNP1 sites and SNP2 sites
＞ SNP1 sites and SNP2 sites are the slower homozygote (T homozygotes and A homozygotes) of growth.
The Melanocortin receptor genome sequence of light hangnail Barb described in step (1) is following (SEQ ID NO.1)
It is shown；Or the sequence of one or several mutation or missing occurs for the sequence shown in following (SEQ ID NO.1)；Underscore
Part is code area, and runic Blocked portion is the SNPs sites found.
ATATCTTTAGATTTATTCACAAACTAAAGTGACTCTCTTTGCATGAATCGTTGGATTATTAATATAGCCAATTCATT
CAAAAATTGACTCATTCAGAAATTAAACAAGTGATTGTCGCAGTGAATCACTGAATCATTTATATATTTAAA
TATACTTTGAATTACTTGATTTTATAAACATACCATCAAAATGCTTTAAGAAATCATGCACTTCCTATAAAGGATTT
TATCTATTTGTTGAAAACAAGGCAACCCCATTCATACACTGACCTCCTTCTGATATTTGCTTACATTCACCC
ATCAGAACTGCCTCTGATTGGTGGAGAAAGCTGGGGGAGGAGCCTGGGCTCAGTGTGCCAGACAGTGGCTGTGGAGG
CAAGAGTATCTCACTCGCCCGCCTGCCAAGTGCTGGAAGCTCTGGAGACTGCCTCGCTCTGAACACTGTTTGCACTT
CAACAGTGTTGAAACAGAGTCAGCGTTTTCAGATTCGGTCAACTGACGCTGTCTCCTATCCTCTGATTCTCTGTCTG
CATGTTTCTGTCTCTATTTTTTTTACATTTTATTTATTTTTGTTTTGTGTAGGAGGCTCTTGCAGACCACTGGCGGA
CGTTTTTGCTGATTTGGAGGAAGAGTTATCACAGAGGTGAGGTGACGGATGCTCACACAGCACCTGCTTTGTTTGAT
CTACATGACGGATGATGTTCAATTTGAATTCACCTGACTGAAGTAGACACAGATCAAAACACTGACTACAGATATTA
AGGGAAATGAACACCTCACATCATCATGGACTGCATCATTCATACCGGAATCACAGCCAGGGAGCTTTACCGGTGGG AAAGCCTGCTCAGGGCGAGAGAAGATCAACCTCTGGATGCTATGAGCAGCTGCTCATCTCCACAGAGGTCTTCCTCA CACTCGGGCTCGTCAGTCTCCTGGAGAACATTCTGGTGATTGCGGCTATTGTCAAGACAAGAACTTCATCTCCCATG TACTTCTTTATCTGCAGTTTAGCCGTAGCAGACTTGTTGGTCAGTGTCTCCAATGCGTCAGAAACAGTAGTGATGGC GCTCATCACGGGTGGCAACCTGACCAATCGCGAGAGCATCATCAAGAACATGGACAACATTTTTGACTCGATGATCT GCAGCTCGCTGTTGGCCTCCATTTGGAGTTTGTTGGCCATTGCGGTGGACCGCTACATCACAATCTTCTACGCTTTG CGCTACCACAACATCATGACCCAACGGCGGGCGGGCACCATCATCACCTGCATTTGGACCTTCTGCACGGTCTCTGG TGTGCTCTTTATCGTGTACTCGGAGAGCACCACCGTTCTCATCTGCCTTATCAGCATGTTCTTCACCATGCTGGCGC TTATGGCCTCGCTCTATGTCCACATGTTTCTTCTAGCCCGACTGCACATGAAGCGCATTGCCGCCCTCCCCGGCAAC GGCCCTATCTGGCAGGCGGCAAATATGAAAGGGGCCATCACCATCACTATCCTGCTGGGTGTATTCGTGGTGTGCTG GGCTCCCTTTTTCTTGCACCTCATCCTCATGATCTCCTGCCCTCGGAACCCTTATTGCATCTGTTTCATGTCCCACT TCAACATGTATCTGATCCTCATTATGTGCAACTCGGCCATAGACCCTCTCATCTATGCCTTCAGGAGCCAAGAGATG AGGAAGACCTTCAAGGAGATCTGCTGCTGCTGCTGTGGATTGACCTCTCTGTGTGTATAGCCTTTTTACTGTTTCAC
GTCAAGGTGCTGATTGTGAGATGTTGGCTTGCAAGACAACACTAAGCAACTGTCACTGGATGCATGCTGAAAATGTA
GAAGATCTAATTACACTGCATAGCTTGTGTGATTATTCTGCGCACACATTTATTTGATACCCAGAGAAATATGATAC
TATGGATGTGCTGACCATGAAAAAATGCTAATGTTAATGACTCAAGGATTTATTGACATGCTGTTTTGGTGTTTATT
TATATTTACAAGTCTCATTCATTTTACCTGCTGAATAAGACATCAAAAAGTCAAAGTGCCAATATTTAAAAGCATTA
AATGACAGAAAATTCATGGCACTGTGTGTGTTGTGATTCAGTGACTCAAGCACATGCACAATATTTGGCAACTGTGA
ATATGTTCTCTTAGCAGGTTGGTACTTCAGTTATTCAGCTTGAGAACCATTGCTGCTTGATAAATGTTTCAGACTTA
TGAATTTATTTTTGTATTTTGTAAGTTATCGTTTTATTTATTTATTTGTAATGCCATTTCATTGTGCAAATAAAACC
ACATCAAAACCAGTAATTATGCCTCATATTTTCTTGTGGAATTGCTAAAACAATAGTAGATTTGATGGTCTGGTAGG
GATTTTGCTTTTGCGTCTTAGATTTTATTCCATTTTCCTTCCTTTCCATCTTCAGAGTCGTGGAACTCAAAAAGTAA
ATGTCTATATTATCTACTAAAAGACTGCCTACAAGCTCTTAGAAGCTATTTATTTAATCAGTCTGTTTTGAAGGTTA
CCACATTGCACTGAATAGACTCTCATCTAGTACGACTACAAAAGGAA。
The method of described quick screening light hangnail Barb fast-growths individual is in screening light hangnail Barb fast-growths individual
Application.
A kind of kit of quick screening light hangnail Barb fast-growths individual, is to be obtained according to above method design, contains
The primer sets of SNP1 nucleotides of detection light hangnail Barb Melanocortin receptor and detection light hangnail Barb melanocyte skin
The primer sets of SNP2 nucleotides of matter hormone receptor.
The kit of described quick screening light hangnail Barb fast-growths individual also include PCR enzymes, PCR buffer solutions and
At least one of PCR water.
Described primer sets are preferably provided at relatively conservative region, so as to avoid the light hangnail Barb of separate sources because base
Because polymorphism influences expanding effect.
The primer sets of SNP1 nucleotides of described detection light hangnail Barb Melanocortin receptor are to expand
The primer sets of sequence containing SNP1 nucleotides, are preferably as follows：
Primer SNP1F：5’-TCTTTATGAGTGAATTACTGAATC-3’；
Primer SNP1R：5'-AGGAAGTGCATGATTTCTTAAAG-3'.
The primer sets of SNP2 nucleotides of described detection light hangnail Barb Melanocortin receptor are to expand
The primer sets of sequence containing SNP2 nucleotides, are preferably as follows：
Primer SNP2F：5'-GCAGTGAATCACTGAATCAT-3'；
Primer SNP2R：5'-CACCAATCAGAGGCAGTTC-3'.
Described PCR is preferably Taq enzyme with enzyme.
Described PCR is preferably deionized water or distilled water with water.
The kit of described quick screening light hangnail Barb fast-growths individual is in screening light hangnail Barb fast-growths individual
In application, specific steps are preferably as follows：
(A) primer sets and detection light of SNP1 nucleotides of detection light hangnail Barb Melanocortin receptor are used
The primer sets of SNP2 nucleotides of hangnail Barb Melanocortin receptor are expanded to light hangnail Barb genome, are obtained
To amplified production；
(B) amplified production is sequenced, obtained sequencing result is screened according to following standard：
1. it is fast growth when SNP1 are CT heterozygotes；It is time fast growth during for C homozygotes；For T
It is inferior position colony during homozygote；
2. it is fast growth when SNP2 are AG heterozygotes；It is time fast growth during for G homozygotes；For A
It is inferior position colony during homozygote；
3. due to the additive effect of minor gene, when SNP1 sites and SNP2 sites are heterozygote, the speed of growth is most
It hurry up；When in two sites only one of which be heterozygote another be grow faster homozygote when, the speed of growth is taken second place；Other with
This analogizes.
The present invention has the following advantages and effect relative to prior art：
The present invention is to find SNP1 of Melanocortin receptor of light hangnail Barb and the according to inventor
SNP2 nucleotide pair light hangnail Barb growth is with the made innovation and creation of influence.The present invention, which is conducive to quickly screening light, to fall
Pierce Barb fast-growths individual.
Brief description of the drawings
Fig. 1 is sequencer map when SNP1 nucleotides are homozygote C.
Fig. 2 is sequencer map when SNP1 nucleotides are homozygote T.
Fig. 3 is sequencer map when SNP1 nucleotides are heterozygote C/T.
Fig. 4 is sequencer map when SNP2 nucleotides are homozygote G.
Fig. 5 is sequencer map when SNP2 nucleotides are homozygote A.
Fig. 6 is sequencer map when SNP2 nucleotides are heterozygote G/A.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited
In this.
Embodiment 1
The light hangnail Barb that this experiment put in a suitable place to breed simultaneously using 334 1.5 ages, raised with pond is tested, and specific steps are such as
Under：
(1) to cut a little tail fin tagged on light hangnail Barb immediately by each tail light hangnail Barb.And the tail fin of collection is entered
Line label, is corresponded, and marked with Arabic numerals with each tail light hangnail Barb.
(2) tail fin 2mg is taken per tail light hangnail Barb, being then respectively adding the general one-step method DNA extract solutions of 50 μ l, (raw work is biological
Engineering (Shanghai) limited company), 80 DEG C of incubation 15min.Brief vibration takes lysate directly to enter performing PCR after mixing.
PCR system is as follows：
PCR reaction condition is as follows：94 DEG C of pre-degeneration 2min；94 DEG C of denaturation 20s, 51 DEG C of renaturation 20s, 72 DEG C of extension 25s,
30 circulations；72 DEG C of extension 5min.
(3) obtained PCR primer is drawn into 4 μ l to detect using 1% agarose electrophoresis, is normally displayed in proximity to 200bp's
Band.Qualified PCR primer direct Sequencing will be detected.
(4) sequencing result is analyzed as follows：
In sequencing result, unimodal is homozygote, and set peak is heterozygote, SNP1 SNP homozygote C such as Fig. 1, homozygote
T such as Fig. 2, heterozygote C/T such as Fig. 3.SNP2 SNP homozygotes G such as Fig. 4, homozygote A such as Fig. 5, heterozygote A/G such as Fig. 6.
Arrow represents SNP site.
SNP1 are fast growth when being CT heterozygotes；It is time fast growth during for C homozygotes；It is pure for T
It is inferior position colony during zygote；SNP2 are fast growth when being AG heterozygotes；It is time fast-growth group during for G homozygotes
Body；It is inferior position colony during for A homozygotes.Binding marker, filters out fast-growth individual.SNPs and body weight, total length, body are long, body
Width, the high statistical result of body such as table 1.CT heterozygotes are in body weight in SNP1 SNP, and total length, body is long, and body is wide, the high statistical number of body
According to two kinds of homozygotic individuals are above significantly higher than, homozygote C is significantly higher than homozygote T on body is wide.In SNP2 SNP, AG
Heterozygote is in body weight, and total length, body is long, and body is wide, and two kinds of homozygotic individuals are significantly higher than in the high statistics of body, and homozygote G exists
It is significantly higher than homozygote A (P on body is wide<0.05).
The growth indexes of table 1 are associated with SNP1 and SNP2 different genotypes
Note：Identical letter represents that difference is not notable, and different letters represent significant difference.
Above-described embodiment is preferably embodiment, but embodiments of the present invention are not by above-described embodiment of the invention
Limitation, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Guangzhou University
<120>A kind of method of quick screening light hangnail Barb fast-growths individual and kit and application
<130> 1
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 2580
<212> DNA
<213>Light hangnail Barb
<220>
<221> Y=C/T
<222> (83)..(83)
<220>
<221> R=A/G
<222> (247)..(247)
<400> 1
atatctttag atttattcac aaactaaagt gactctcttt gcatgaatcg ttggattatt 60
aatatagcca attcattcaa aayattgact cattcagaaa ttaaacaagt gattgtcgca 120
gtgaatcact gaatcattta tatatttaaa tatactttga attacttgat tttataaaca 180
taccatcaaa atgctttaag aaatcatgca cttcctataa aggattttat ctatttgttg 240
aaaacaragg caaccccatt catacactga cctccttctg atatttgctt acattcaccc 300
atcagaactg cctctgattg gtggagaaag ctgggggagg agcctgggct cagtgtgcca 360
gacagtggct gtggaggcaa gagtatctca ctcgcccgcc tgccaagtgc tggaagctct 420
ggagactgcc tcgctctgaa cactgtttgc acttcaacag tgttgaaaca gagtcagcgt 480
tttcagattc ggtcaactga cgctgtctcc tatcctctga ttctctgtct gcatgtttct 540
gtctctattt tttttacatt ttatttattt ttgttttgtg taggaggctc ttgcagacca 600
ctggcggacg tttttgctga tttggaggaa gagttatcac agaggtgagg tgacggatgc 660
tcacacagca cctgctttgt ttgatctaca tgacggatga tgttcaattt gaattcacct 720
gactgaagta gacacagatc aaaacactga ctacagatat taagggaaat gaacacctca 780
catcatcatg gactgcatca ttcataccgg aatcacagcc agggagcttt accggtggga 840
aagcctgctc agggcgagag aagatcaacc tctggatgct atgagcagct gctcatctcc 900
acagaggtct tcctcacact cgggctcgtc agtctcctgg agaacattct ggtgattgcg 960
gctattgtca agacaagaac ttcatctccc atgtacttct ttatctgcag tttagccgta 1020
gcagacttgt tggtcagtgt ctccaatgcg tcagaaacag tagtgatggc gctcatcacg 1080
ggtggcaacc tgaccaatcg cgagagcatc atcaagaaca tggacaacat ttttgactcg 1140
atgatctgca gctcgctgtt ggcctccatt tggagtttgt tggccattgc ggtggaccgc 1200
tacatcacaa tcttctacgc tttgcgctac cacaacatca tgacccaacg gcgggcgggc 1260
accatcatca cctgcatttg gaccttctgc acggtctctg gtgtgctctt tatcgtgtac 1320
tcggagagca ccaccgttct catctgcctt atcagcatgt tcttcaccat gctggcgctt 1380
atggcctcgc tctatgtcca catgtttctt ctagcccgac tgcacatgaa gcgcattgcc 1440
gccctccccg gcaacggccc tatctggcag gcggcaaata tgaaaggggc catcaccatc 1500
actatcctgc tgggtgtatt cgtggtgtgc tgggctccct ttttcttgca cctcatcctc 1560
atgatctcct gccctcggaa cccttattgc atctgtttca tgtcccactt caacatgtat 1620
ctgatcctca ttatgtgcaa ctcggccata gaccctctca tctatgcctt caggagccaa 1680
gagatgagga agaccttcaa ggagatctgc tgctgctgct gtggattgac ctctctgtgt 1740
gtatagcctt tttactgttt cacgtcaagg tgctgattgt gagatgttgg cttgcaagac 1800
aacactaagc aactgtcact ggatgcatgc tgaaaatgta gaagatctaa ttacactgca 1860
tagcttgtgt gattattctg cgcacacatt tatttgatac ccagagaaat atgatactat 1920
ggatgtgctg accatgaaaa aatgctaatg ttaatgactc aaggatttat tgacatgctg 1980
ttttggtgtt tatttatatt tacaagtctc attcatttta cctgctgaat aagacatcaa 2040
aaagtcaaag tgccaatatt taaaagcatt aaatgacaga aaattcatgg cactgtgtgt 2100
gttgtgattc agtgactcaa gcacatgcac aatatttggc aactgtgaat atgttctctt 2160
agcaggttgg tacttcagtt attcagcttg agaaccattg ctgcttgata aatgtttcag 2220
acttatgaat ttatttttgt attttgtaag ttatcgtttt atttatttat ttgtaatgcc 2280
atttcattgt gcaaataaaa ccacatcaaa accagtaatt atgcctcata ttttcttgtg 2340
gaattgctaa aacaatagta gatttgatgg tctggtaggg attttgcttt tgcgtcttag 2400
attttattcc attttccttc ctttccatct tcagagtcgt ggaactcaaa aagtaaatgt 2460
ctatattatc tactaaaaga ctgcctacaa gctcttagaa gctatttatt taatcagtct 2520
gttttgaagg ttaccacatt gcactgaata gactctcatc tagtacgact acaaaaggaa 2580
<210> 2
<211> 24
<212> DNA
<213> artificial sequence
<220>
<223>Primer SNP1F
<400> 2
tctttatgag tgaattactg aatc 24
<210> 3
<211> 23
<212> DNA
<213> artificial sequence
<220>
<223>Primer SNP1R
<400> 3
aggaagtgca tgatttctta aag 23
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223>Primer SNP2F
<400> 4
gcagtgaatc actgaatcat 20
<210> 5
<211> 19
<212> DNA
<213> artificial sequence
<220>
<223>Primer SNP2R
<400> 5
caccaatcag aggcagttc 19
Claims (9)
1. a kind of method of quick screening light hangnail Barb fast-growths individual, it is characterised in that comprise the following steps：
(1) the -686th and the -522nd nucleotides of promoter of light hangnail Barb Melanocortin receptor is respectively designated as
SNP1 and SNP2, and detected；
(2) screened according to following standard：
1. it is fast growth when SNP1 are CT heterozygotes；It is time fast growth during for C homozygotes；For T homozygosis
The period of the day from 11 p.m. to 1 a.m is inferior position colony；
2. it is fast growth when SNP2 are AG heterozygotes；It is time fast growth during for G homozygotes；For A homozygosis
The period of the day from 11 p.m. to 1 a.m is inferior position colony；
3. due to the additive effect of minor gene, by the speed of growth, SNP1 sites and SNP2 sites are heterozygote ＞ SNP1
Point is heterozygote with one in SNP2 sites and another is that the very fast homozygote ＞ SNP1 sites of growth and SNP2 sites are made a living
One is heterozygote and another is the slower homozygote ＞ SNP1 of growth in long very fast homozygote ＞ SNP1 sites and SNP2 sites
One is the very fast homozygote of growth and another is the slower homozygote ＞ SNP1 sites of growth and SNP2 in site and SNP2 sites
Site is the slower homozygote of growth.
2. the method for quick screening light hangnail Barb fast-growths individual according to claim 1, it is characterised in that：
The Melanocortin receptor genome sequence of light hangnail Barb described in step (1) is as shown in SEQ ID NO.1；Or
The sequence of one or several mutation or missing occurs for the sequence as shown in SEQ ID NO.1.
3. the method for the quick screening light hangnail Barb fast-growths individual described in claim 1 or 2 is quick in screening light hangnail Barb
Application in growth individual.
4. a kind of kit of quick screening light hangnail Barb fast-growths individual, is set according to the method described in claim 1 or 2
Meter is obtained, it is characterised in that：The primer sets of SNP1 nucleotides of the Melanocortin receptor containing detection light hangnail Barb
With the primer sets of SNP2 nucleotides of detection light hangnail Barb Melanocortin receptor.
5. the kit of quick screening light hangnail Barb fast-growths individual according to claim 4, it is characterised in that：Also wrap
Include at least one of PCR enzymes, PCR buffer solutions and PCR water.
6. the kit of the quick screening light hangnail Barb fast-growths individual according to claim 4 or 5, it is characterised in that：
The primer sets of SNP1 nucleotides of described detection light hangnail Barb Melanocortin receptor are as follows：Primer
SNP1F：5’-TCTTTATGAGTGAATTACTGAATC-3’；
Primer SNP1R：5'-AGGAAGTGCATGATTTCTTAAAG-3'.
7. the kit of the quick screening light hangnail Barb fast-growths individual according to claim 4 or 5, it is characterised in that：
The primer sets of SNP2 nucleotides of described detection light hangnail Barb Melanocortin receptor are as follows：
Primer SNP2F：5'-GCAGTGAATCACTGAATCAT-3'；
Primer SNP2R：5'-CACCAATCAGAGGCAGTTC-3'.
8. the kit of quick screening light hangnail Barb fast-growths individual according to claim 5, it is characterised in that：It is described
PCR with enzyme be Taq enzyme；
Described PCR is deionized water or distilled water with water.
9. the kit of the quick screening light hangnail Barb fast-growths individual described in any one of claim 4~8 falls in screening light
The application pierced in Barb fast-growths individual, it is characterised in that comprise the following steps：
(A) primer sets and detection light hangnail of SNP1 nucleotides of detection light hangnail Barb Melanocortin receptor are used
The primer sets of SNP2 nucleotides of Barb Melanocortin receptor are expanded to light hangnail Barb genome, are expanded
Increase production thing；
(B) amplified production is sequenced, obtained sequencing result is screened according to following standard：
1. it is fast growth when SNP1 are CT heterozygotes；It is time fast growth during for C homozygotes；For T homozygosis
The period of the day from 11 p.m. to 1 a.m is inferior position colony；
2. it is fast growth when SNP2 are AG heterozygotes；It is time fast growth during for G homozygotes；For A homozygosis
The period of the day from 11 p.m. to 1 a.m is inferior position colony；
3. due to the additive effect of minor gene, by the speed of growth, SNP1 sites and SNP2 sites are heterozygote ＞ SNP1
Point is heterozygote with one in SNP2 sites and another is that the very fast homozygote ＞ SNP1 sites of growth and SNP2 sites are made a living
One is heterozygote and another is the slower homozygote ＞ SNP1 of growth in long very fast homozygote ＞ SNP1 sites and SNP2 sites
One is the very fast homozygote of growth and another is the slower homozygote ＞ SNP1 sites of growth and SNP2 in site and SNP2 sites
Site is the slower homozygote of growth.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710261331.4A CN107012224B (en) | 2017-04-20 | 2017-04-20 | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710261331.4A CN107012224B (en) | 2017-04-20 | 2017-04-20 | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012224A true CN107012224A (en) | 2017-08-04 |
| CN107012224B CN107012224B (en) | 2020-07-31 |
Family
ID=59448531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710261331.4A Active CN107012224B (en) | 2017-04-20 | 2017-04-20 | Method and kit for rapidly screening individuals growing rapidly in Sinocyclocheilus grahami and application of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012224B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795662A (en) * | 2021-01-08 | 2021-05-14 | 广州大学 | Identification method of barbel grahami and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110054246A1 (en) * | 2009-08-28 | 2011-03-03 | Clutter Archie C | Whole genome scan to discover quantitative trai loci (qtl) affecting growth, body composition, and reproduction in maternal pig lines |
| CN103966209A (en) * | 2014-05-02 | 2014-08-06 | 华中农业大学 | SNP molecular marker related to intramuscular fat content characters of pigs and application of SNP molecular marker |
| CN105002171A (en) * | 2015-07-30 | 2015-10-28 | 江苏省淡水水产研究所 | SNP mark related to weight of eriocheir sinensis and application of SNP mark |
| KR20160127882A (en) * | 2015-04-27 | 2016-11-07 | 대한민국(농촌진흥청장) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same |
| CN106282365A (en) * | 2016-09-09 | 2017-01-04 | 广州大学 | A kind of test kit quickly light agnail different groups classified |
| CN106399530A (en) * | 2016-10-17 | 2017-02-15 | 华南师范大学 | Spinibarbus dneticulatus microsatellite family identification method |
-
2017
- 2017-04-20 CN CN201710261331.4A patent/CN107012224B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110054246A1 (en) * | 2009-08-28 | 2011-03-03 | Clutter Archie C | Whole genome scan to discover quantitative trai loci (qtl) affecting growth, body composition, and reproduction in maternal pig lines |
| CN103966209A (en) * | 2014-05-02 | 2014-08-06 | 华中农业大学 | SNP molecular marker related to intramuscular fat content characters of pigs and application of SNP molecular marker |
| KR20160127882A (en) * | 2015-04-27 | 2016-11-07 | 대한민국(농촌진흥청장) | Preparing method of synthetic pig by a cross between Duroc and Korean native pig, and synthetic pig using the same |
| CN105002171A (en) * | 2015-07-30 | 2015-10-28 | 江苏省淡水水产研究所 | SNP mark related to weight of eriocheir sinensis and application of SNP mark |
| CN106282365A (en) * | 2016-09-09 | 2017-01-04 | 广州大学 | A kind of test kit quickly light agnail different groups classified |
| CN106399530A (en) * | 2016-10-17 | 2017-02-15 | 华南师范大学 | Spinibarbus dneticulatus microsatellite family identification method |
Non-Patent Citations (4)
| Title |
|---|
| K. MEIDTNER ET AL.: ""Association of the melanocortin 4 receptor with feed intake and daily gain in F2 Mangalitsa X Pietrain pigs"", 《ANIMAL GENETICS》 * |
| YANG YANG ET AL.: ""Characterization of the melanocortin-4 receptor gene from Spinibarbus hollandi and the association between its polymorphisms and S. hollandi growth traits"", 《FISH SCI》 * |
| 刘福平等: ""罗非鱼MC4R 基因克隆及与其生长相关的SNPs位点"", 《中国水产科学》 * |
| 杨杨等: ""光倒刺鲃黑色素皮质素受体-4(MC4R)的克隆以及与生长性状的关联分析"", 《2017年中国水产学会学术年会论文摘要集》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795662A (en) * | 2021-01-08 | 2021-05-14 | 广州大学 | Identification method of barbel grahami and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012224B (en) | 2020-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | High genetic diversity and substantial population differentiation in grass carp (Ctenopharyngodon idella) revealed by microsatellite analysis | |
| Liu et al. | A preliminary genetic linkage map of the Pacific abalone Haliotis discus hannai Ino | |
| CN109971865B (en) | SNP marker significantly related to weight traits of litopenaeus vannamei and application | |
| Sánchez-Ramos et al. | Assessment of tools for marker-assisted selection in a marine commercial species: significant association between MSTN-1 gene polymorphism and growth traits | |
| CN110129455B (en) | Application of growth-related molecular marker in genetic breeding of litopenaeus vannamei | |
| Liao et al. | Construction of a genetic linkage map and mapping of a female-specific DNA marker in half-smooth tongue sole (Cynoglossus semilaevis) | |
| CN104099415B (en) | A kind of detection primer of the SNP marker associated with pteria martensii closed shell flesh heavy phase and application thereof | |
| CN108410994A (en) | It is a kind of influence sheep Fecundity Trait SNP marker and its application | |
| CN109055580B (en) | Molecular marker related to growth in C-type scavenger receptor of litopenaeus vannamei and application | |
| CN106868156B (en) | The InDel molecular labeling isolated with cucumber ZYMV resistant gene | |
| CN105624155B (en) | A kind of molecular labeling for influenceing pig feed conversion rate characteristic and application | |
| Pritchard et al. | Regulatory architecture of gene expression variation in the threespine stickleback Gasterosteus aculeatus | |
| Gurney-Smith et al. | Species composition and genetic diversity of farmed mussels in British Columbia, Canada | |
| Yu et al. | Genetic variability and relationships among six grass carp Ctenopharyngodon idella populations in China estimated using EST-SNP Markers | |
| CN104328119B (en) | The related microsatellite molecular marker of megalobrama amblycephala growth traits and application | |
| CN110331217B (en) | Microsatellite marker paternity test primer suitable for Nile tilapia, Oreochromis aureus and hybrid thereof, method and application | |
| CN106167826B (en) | A kind of relevant SNP site of yellow catfish growing characteristic and its detection and application | |
| CN114150070B (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
| KR101845027B1 (en) | Mircrosatellite marker group for the abalone species distinction, analysis of genetic diversity and parentage profile, and method of analyzing using the same | |
| CN107012224A (en) | A kind of method of quick screening light hangnail Barb fast-growths individual and kit and application | |
| Syaifudin | Species-specific DNA markers for improving the genetic management of tilapia | |
| CN110317887A (en) | Misgurnus auguillicaudatus microsateilite markers site, primer and its application | |
| CN106148541B (en) | SNP primer and screening technique for the screening of Fugu rubripes seed | |
| Gu et al. | Microsatellite marker analysis reveals the distinction between the north and south groups of hard clam (Meretrix meretrix) in China | |
| CN104774964B (en) | A kind of molecular marker assisted selection improves the breeding method of Gairino maschato fat deposition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |