CN110257418A

CN110257418A - A kind of method of fixed rice heterosis

Info

Publication number: CN110257418A
Application number: CN201910383611.1A
Authority: CN
Inventors: 赵炳然; 吕启明; 毛毕刚
Original assignee: Hunan Hybrid Rice Research Center
Current assignee: Hunan Hybrid Rice Research Center
Priority date: 2019-05-09
Filing date: 2019-05-09
Publication date: 2019-09-20
Anticipated expiration: 2039-05-09
Also published as: CN110257418B

Abstract

The invention discloses a kind of methods of fixed rice heterosis, and OsMADS13 promoter is connect with Rice BB M1 gene coded sequence, is building up in expression vector and obtains carrier A；Construct the carrier B that the bis- target spot CRISPR/Cas9 of EAC1-like are knocked out；Carrier A and carrier B are obtained into T0 into hybrid rice seeds for plant by agrobacterium-mediated transformation cotransformation；T0 is selfed to obtain selfed seed for plant.The present invention utilizes rice nucellus organizing specific expression promoter, and by rice, at embryo key gene, the specifically expressing in hybrid rice nucellar tissue, induction nucellar tissue body cell form adventitious embryo；Will in rice egg cell specifically expressing, the gene knockout played a significant role to egg cell growth and development；It is selfed hybrid rice, forms the seed for being capable of fixing rice heterosis.This method can eliminate propagating risk in hybrid seed production.

Description

A kind of method of fixed rice heterosis

Technical field

The present invention relates to agricultural biological technical field more particularly to a kind of methods of fixed rice heterosis.

Background technique

Hybrid vigour refers to the F1 generation of two parents generation the phenomenon that being better than parent in one or more characters.It is miscellaneous Kind advantage is widely present in plant.In rice, since hybrid rice is widely applied, cultivated area is sure to occupy me throughout the year 50% or more of state's rice gross area, added up promote more than 8,000,000,000 mu, volume increase paddy be more than 600,000,000,000 kilograms, for China with World food has made safely significant contribution.However, there is also a big problems in production for hybrid rice at present: hybridization water The hybrid vigour of rice is not capable of fixing, and trait segregation can occur for self progeny, it is necessary to specially produce hybrid rice seeds every year, significantly Increase hybrid rice production cost.Currently, the hybrid rice in production includes: Three-line Hybrid rice, seed production according to Rely cell nucleo-cytoplasmic interreaction male sterile line；Double-hybrid rice strains, seed production rely on the temperature sensitive genie male sterile line of light. Three-line Hybrid rice fertility is restricted by Rescued virus, and restorer is seldom, keeps system less, choose excellent combined probability compared with It is low；Two line method infertility line fertility is bullied the influence of warm height, and abnormal low temperature is met in the production of hybrid seeds or breeding meets abnormal high temperature and can all cause to lose It loses.If it is possible to which the wild hybrid pig of hybrid rice is got off, hybrid rice will welcome new great development.Early in 1987, Yuan Longping just proposed the strategy of hybrid rice breeding method point three developing stage: from three line method to two line method again to The one of hybrid vigor fixing is method, is developed towards program by numerous to direction simple and that efficiency is higher and higher.Recently, Yuan Longping according to More than 50 years development courses of hybrid rice, review the past, look forward to the future, and propose that hybrid rice development front and back can be divided into five From generation to generation, wherein developing the 5th generation hybrid rice in acme as hybrid rice is also the hybridization water for being capable of fixing hybrid vigour Rice.

Rice heterosis fixation is significant, and is all that diploid oogamete mode reality is formulated by MiMe system at present It is existing.MiMe system can convert rice reproduction cell meiosis to mitosis, the female and male gametophyte of acquisition be entirely and The identical diploid of parent genotype, relate generally to three and mutation while meiosis related gene: PAIR1 gene is prominent Become the non-sister chromatid cross exchanged recombination during being able to suppress the pairing of subtrahend first division phase homologue； REC8 gene mutation promotes sister chromatid just to separate in subtrahend first split later；OSD1 gene mutation, which results in skipped, to be subtracted Number second division.Since the embryo of rice in MiMe system and endosperm formation still rely on fertilization process, and after MiMe selfing, The chromosome of every generation can all double, therefore realize wild hybrid pig, it is necessary to monoploid be induced to generate.The system is related to It is mutated, operates more complicated while three genes；After selfing, it is difficult to ensure that diploid gamete does not double again, and It will affect the setting percentage of rice.

Therefore, exploring the fixed approach of other rice heterosis is very important.Existing research is found, extensive in rice There are adventitious embryony phenomenons, it is formed by nucellar tissue body cell direct development, and genotype is identical with parent, only It is due to can also develop into embryo after occurrence frequency is not high and fertilizing oocytes, thus is usually to be deposited in the form of double embryos or polyembryony seedling It cannot be used for wild hybrid pig in production.

To sum up, hybrid rice production at present must rely on sterile line, and Three-line Hybrid rice fertility is restricted by Rescued virus, Restorer is seldom, keeps system less, it is lower to choose excellent combined probability；Two line method infertility line fertility is bullied the shadow of warm height It rings, abnormal low temperature is met in the production of hybrid seeds or breeding meets abnormal high temperature and can all lead to the failure.It is badly in need of seeking a kind of hybrid that can fix rice Advantage, so that hybrid rice combo efficiency is greatly improved, the method for eliminating propagating risk in hybrid seed production.

Summary of the invention

The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art, a kind of fixed rice heterosis is provided Method.This method can fix the hybrid vigour of rice, to greatly improve hybrid rice combo efficiency, eliminate hybrid rice Numerous risk in hybrid seed production.

To achieve the goals above, the present invention provides a kind of methods of fixed rice heterosis, comprising the following steps:

S1, OsMADS13 promoter is connect with Rice BB M1 gene coded sequence, is building up in expression vector and is carried Body A；The sequence of the OsMADS13 promoter is as shown in SEQ ID NO.1；The Rice BB M1 gene coded sequence such as SEQ Shown in ID NO.4；Construct the carrier B that the bis- target spot CRISPR/Cas9 of EAC1-like are knocked out；

S2, the carrier A and the carrier B are obtained into T0 into hybrid rice seeds by agrobacterium-mediated transformation cotransformation For plant；

The T0 of S3, screening EAC1-like Gene Double equipotential homozygous knockout success ectopic expression BBM1 gene simultaneously for plant, It is selfed to obtain selfed seed.

The method of above-mentioned fixation rice heterosis, further, the preparation method of carrier A described in the S1 step Specifically:

S1-A1, promoter sequence design primer seq1F and seq1R according to OsMADS13 gene, with rice genome DNA is template, carries out PCR amplification and obtains amplified production 1；

S1-A2, according to BBM1 coding sequence design primer seq3F and seq3R, be with Rice Callus cDNA Template carries out PCR amplification and obtains amplified production 2；

S1-A3, the amplified production 1 and the amplified production 2 are mixed as template, using the primer seq1F and The primer seq3R carries out PCR amplification, the amplified production 3 after obtaining amplified production 1 and the integration of amplified production 2；

S1-A4, it the amplified production 3 is connected in expression vector obtains carrier A.

The method of above-mentioned fixation rice heterosis, further, the sequence of the primer seq1F such as SEQ ID Shown in NO.2；The sequence of primer seq1R as shown in SEQ ID NO.3

The method of above-mentioned fixation rice heterosis, further, the sequence of the primer seq3F such as SEQ ID Shown in NO.5；The sequence of the primer seq3R is as shown in SEQ ID NO.6.

The method of above-mentioned fixation rice heterosis, further, the preparation method of carrier B described in the S1 step Specifically:

S1-B1, according to EAC1-like coding sequence design target sequence；

S1-B2, building contain the CRISPR/Cas9 recombinant vector B of the target sequence segment.

The method of above-mentioned fixation rice heterosis, further, target sequence described in the S1-B1 includes seq5 And the DNA sequence dna of seq6, the seq5, as shown in SEQ ID NO.8, the DNA sequence dna of the seq6 is as shown in SEQ ID NO.9.

The method of above-mentioned fixation rice heterosis further screens in the S3 while knocking out EAC1-like base Because with success ectopic expression BBM1 gene T0 for transgenic plant method the following steps are included:

To seq8F and seq8R, the sequence of the Seq8F is described as shown in SEQ ID NO.10 for S3-1, design primer The sequence of Seq8R is as shown in SEQ ID NO.11；T0 is expanded for genetically modified plants, screens Successful amplification carrier A's Positive transgenic plant；

To seq9F and seq9R, the sequence of the Seq9F is described as shown in SEQ ID NO.12 for S3-2, design primer The sequence of Seq9R is as shown in SEQ ID NO.13；PCR expansion is carried out to the positive transgenic plant of Successful amplification carrier A Increase, screens EAC1-like Gene Double equipotential homozygous mutation strain.

Compared with the prior art, the advantages of the present invention are as follows:

(1) it the present invention provides a kind of method of fixed rice heterosis, is opened using rice nucellus organizing specific expression Mover, by rice, at embryo key gene, the specifically expressing in hybrid rice nucellar tissue, induction nucellar tissue body cell are formed not Determine embryo；The gene knockout that egg cell growth and development plays a significant role will be made to hybridize water specifically expressing in rice egg cell Rice egg cell loses the ability to form embryo；It is selfed hybrid rice, sperm forms endosperm in conjunction with polar core, passes through adventitious embryo and embryo Newborn symplastic growth forms the seed for being capable of fixing rice heterosis.This method can fix the hybrid vigour of rice, thus Hybrid rice combo efficiency is greatly improved, propagating risk in hybrid seed production is eliminated.

(2) the present invention provides a kind of methods of fixed rice heterosis, and wherein BBM1 gene is that egg cell forms embryo Switch, when its ectopic expression in egg cell, even if discovery nonfertilization, egg cell can also spontaneously form embryo.The water such as BBM1 Rice at embryo key gene, can not only inducing egg cell directly embryoid formation, important work is also played in terms of inducing somatic is at embryo With can also generate somatic embryo on rice leaf tissue when BBM1 gene is in rice plant constitutive expression.Utilize rice pearl The promoter of heart tissue's specific expression gene drives into embryo key gene, makes it in hybrid rice nucellar tissue specifically expressing, lures It leads nucellar tissue body cell and generates adventitious embryo.OsMADS13 gene specifically expressing in rice ovule.Specifically, OsMADS13 Gene is expressed in the nucellar tissue and integument of ovule, and the two positions are also the position of indefinite embryogenesis, therefore utilizes class Like the promoter of OsMADS13 gene, BBM1 gene can not only be promoted to express in nucellar tissue, moreover it is possible to avoid BBM1 gene Effect is not known caused by the other tissue expressions of rice.EAC1-like gene specifically expressing in rice egg cell, and It plays an important role during rice fertilizing oocytes, therefore egg cell can be made to lose function by knocking out this gene Energy.It is selfed by hybrid rice, spermatoblast forms endosperm after merging with two polar cores, adventitious embryo and endosperm collaboration development are formed Genotype and maternal identical seed, to realize that rice heterosis is fixed.

Specific embodiment

Below in conjunction with specific preferred embodiment, the invention will be further described, but not thereby limiting the invention Protection scope.

Embodiment

Material employed in following embodiment and instrument are commercially available.

Embodiment 1:

A method of passing through the fixed rice heterosis of adventitious embryo, comprising the following steps:

(1) it constructs the carrier (carrier A) of rice nucellus specifically expressing BBM1 gene: OsMADS13 promoter is connected into upper water Rice BBM1 gene coded sequence, is building up in plant binary expression vector pCAMBIA1300.Specific construction method are as follows:

1.1, according to the promoter sequence design primer pair of OsMADS13 gene.

The DNA sequence dna of the promoter seq2 of OsMADS13 gene is as shown in SEQ ID NO.1, particular sequence are as follows:

gatgtctaaatagctataaatgggtaagcaagatagcaaagaaggccagtggcctttgcagctaagct agctagctagcccttcttcctctctttcctgctttccctttgccttctcctattaatcctctgcacctcacacagc agcagaaaacccaccaactggagctctcctttcctactccaagaaacgaaggtagagaaagaaagatcagatcagc ttcaggaccaattttagctaggttatatatctctttgcgtgctaatgtgttttagttatctgggtgtgtgtagagt tctttgttaaggcactgattcagctgcagtttagattcaagtttgtatgttctctctttgaggaaaagaaaccctt ttcctgtgcttcgagttcttgcaaagagaaactgtgatgcttggcttccagtttgatgcttctttgttcagattgg aaattcttcctagcttctttctctatttatgtagcaaggattctttccggcccagtgatcctggtttcttttggaa ggtttcagttttttcgttctttcttgaaatttctcttcttgccttaggcagatctttgatcttgtgaggagacagg agaaaaggaagaagctagtttcctgcggccgacctcttgcttctcactttgtgatgagttttctttggtcaattct tagctagatatgttaagatagttagttaagcaaatcgaaattgctagcttttccatgctttcttaaacatgattct tcagatttggttggttcttttttttcctttttgtggagacgtgctgttcttgcatcttatccttcttgattcatct acccatctggttctttgagctttctttttcgcttcttcccttcattatttcgagcaatctctgcacatctgaaagt tttgtttcttgagactacttttgctagatcttgtttactcgatcactctatacttgcatctaggctcctttctaaa taggcgatgattgagctttgcttatgtcaaatgatgggatagatattgtcccagtctccaaatttgatccatatcc gccaagtctttcatcatctttttctttcttttttatgagcaaaaatcatctttttctttcaaagttcagctttttt ctcttgttttacccctctttagctatagctggtttcttattccttttggatttacatgtataaaacatgcttgaat ttgttagatcgatcactttatacacatactatgtgaatcacgatctcagatctctcagtatagttgaattcattaa tttcttagatcgatcagcgtgtgatgtagtactgtaaatcactactagatctttcatcagtctcttttctgcatct atcaatttctcatgcaagttttagttgtttctttaatccggtctctctctcttttttaatcagctgagagtttgtg ctgttctttaatcattaccagatctttcatcagtactctctcttctgcatctatcaaacttctcatgcaatgtttt tgctgttctttgatctgatctctggtctccttttttgttgatcagttgagagcaagaagac。

Upstream primer seq1F (SEQ ID NO.2):ggtaccgatgtctaaatagctataaatggg。

Downstream primer seq1R (SEQ ID NO.3):tgatggaggccatgtcttcttgctctcaactgatc。

1.2, using rice R900 genomic DNA as template, the primer designed with step 1.1 is carried out PCR amplification and is expanded Product 1.

Fastpfu high fidelity enzyme 20ul PCR reaction system:

5 × buffer: 4 μ l；

Template DNA: 2 μ l；

DNTP (2.5mmol): 1 μ l；

Upstream and downstream primer (5mmol): each 1 μ l；

Fastpfu high fidelity enzyme: 0.5 μ l；

Moisturizing is to 20 μ l.

Fidelity enzyme PCR reaction condition:

94 DEG C 4 minutes；94 DEG C 20 seconds, 57 DEG C 20 seconds, 72 DEG C 40 seconds, totally 30 circulation；72 DEG C 5 minutes.

1.3, according to BBM1 coding sequence design primer pair.

The DNA sequence dna of BBM1 coding sequence seq4 as shown in SEQ ID NO.4, specifically:

atggcctccatcaccaactggctcggcttctcctcctcctccttctccggcgccggcgccgaccccgt cctgccccacccgccgctgcaagagtgggggagcgcttatgagggcggcggcacggtggcggccgccggcggggag gagacggcggcgccgaagctggaggacttcctcggcatgcaggtgcagcaggagacggccgccgcggcggcggggc acggccgtggaggcagctcgtcggtcgttgggctgtccatgatcaagaactggctacgcagccagccgccgcccgc ggtggttgggggagaagacgctatgatggcgctcgcggtgtcgacgtcggcgtcgccgccggtggacgcgacggtg ccggcctgcatttcgccggatgggatggggtcgaaggcggccgacggcggcggcgcggccgaggcggcggcggcgg cggcggcgcagaggatgaaggcggccatggacacgttcgggcagcggacgtccatctaccggggtgtcaccaagca caggtggacaggaaggtatgaagcccatctttgggataacagctgcagaagagaaggtcagactcgcaaaggcaga caagtcaatgcaggaggatatgataaggaagaaaaagctgctagggcttatgatttggctgcccttaaatactggg gcactacaacgacgacgaattttccggtaagcaactacgaaaaagagttggatgaaatgaagcacatgaataggca ggaatttgttgcatcccttagaagaaaaagcagtggattttcacgtggtgcttccatatatcgtggtgttacaaga caccatcagcatggaaggtggcaagcaaggataggacgggtggcaggaaacaaggatctgtatttgggcacatttg gcacccaagaggaagctgcagaggcatatgatatcgctgcaatcaaattccgtggtctcaatgctgtgacaaactt tgacatgagccggtacgatgtcaagagcatcattgaaagcagcaatctcccaattggtactggaaccacccggcga ttgaaggactcctctgatcacactgataatgtcatggacatcaatgtcaataccgaacccaataatgtggtatcat cccacttcaccaatggggttggcaactatggttcgcagcattatggttacaatggatggtcgccaattagcatgca gccgatcccctcgcagtacgccaacggccagcccagggcatggttgaaacaagagcaggacagctctgtggttaca gcggcgcagaacctgcacaatctacatcattttagttccttgggctacacccacaacttcttccagcaatctgatg ttccagacgtcacaggtttcgttgatgcgccttcgaggtccagtgactcatactccttcaggtacaatggaacaaa tggctttcatggtctcccgggtggaatcagctatgctatgccggttgcgacagcggtggaccaaggtcagggcatc catggctatggagaagatggtgtggcaggcattgacaccacacatgacctgtatggcagccgtaatgtgtactacc tttccgagggttcgcttcttgccgatgtcgaaaaagaaggcgactatggccaatctgtggggggcaacagctgggt tttgccgacaccgtag。

Upstream primer seq3F (SEQ ID NO.5):atggcctccatcaccaactggctc；

Downstream primer seq3R (SEQ ID NO.6):tctagactacggtgtcggcaaaacccagc。

1.4, it is primer with 1.3 designs using the callus cDNA of rice R900 as template, carries out PCR amplification and obtain Amplified production 2.

Fastpfu high fidelity enzyme 20ul PCR reaction system:

5 × buffer: 4 μ l；

Template cDNA:2 μ l；

DNTP (2.5mmol): 1 μ l；

Upstream and downstream primer (5mmol): each 1 μ l；

Fastpfu high fidelity enzyme: 0.5 μ l；

Moisturizing is to 20 μ l.

Fastpfu high fidelity enzyme PCR reaction condition:

94 DEG C 4 minutes；94 DEG C 20 seconds, 57 DEG C 20 seconds, 72 DEG C 1 minute, totally 30 circulation；72 DEG C 5 minutes.

1.5, amplified production 1 and amplified production 2 are mixed as template, is carried out using primer seq1F and primer seq3R PCR amplification, the amplified production 3 after obtaining amplified production 1 and the integration of amplified production 2 (are set in primer seq1R and primer seq3F It has counted reverse complementary sequence (underlined sequences), therefore amplified production 1 and amplified production 2 mix when being used as pcr template, Neng Goutong It crosses reverse complementary sequence and is combined into a long sequence i.e. amplified production 3).

1.6, amplified production 3 is connected to cloning vector peasy-TBlunt (Quan Shijin biotechnology by homologous recombination Co., Ltd) in obtain amplified production 3/peasy-TBlunt recombinant vector.

1.7, using restriction enzyme Kpn1 and Xbal1 to amplified production 3/peasy-TBlunt recombinant vector double digestion (underlined sequences are respectively Kpn1 and Xbal1 digestion recognition site in primer seq1F and primer seq3R), by the expansion after digestion Volume increase 3 segment of object is connected in plant binary expression vector pCAMBIA1300, completes the building of carrier A.

(2) knockout carrier (carrier B) of rice egg cell specific expression gene EAC1-like is constructed: in EAC1-like base Because in coding region sequence, design is appropriate for double fragment sequence seq5 and seq6 of CRISPR/Cas9 knockout, to EAC1-like Double target spots are carried out to knock out.

EAC1-like gene coded sequence seq7 is as shown in SEQ ID NO.7, particular sequence are as follows:

atggcgtgctcgggcagtttcctaccgataatgctcctgccgctgctcctcgccggcgccgcggtggc gggcggcgccccgccggggcttgggctggcgcagcggctggccgacggcgtggggcagcagcagcagcagtgctgg gaggttctgatggagatcaagtcgtgcacgggggagatcctcctcttcttcatcaacggcgaggcgtacctggggc ccggctgctgccgcgccatccgcgtcatcgagcagagctgctgggccaccgacgccatgctgtccgtcatcgggtt caccccggaggagggggacatgctcaagggctactgcgacgccggcgacgagcacaagccgtcgccgccccccgcc tcgccggccgtcggctacgtcgccgtcggagagaacgccgccgtaccggccggacggaagagcctggcgctgcagc accgttag。

Specific steps are as follows:

2.1, seq5 and seq6 is assembled into pYLgRNA-U3 and pYLgRNA-U6a two by Bsa1 digestion respectively first Seq5/pYLgRNA-U3 recombinant vector and seq6/pYLgRNA-U6a recombinant vector are obtained in gRNA carrier.

Seq5 (SEQ ID NO.8): ctcctgccgctgctcctcgccgg；

Seq6 (SEQ ID NO.9): gctgctcctcgccggcgccgcgg。

2.2, seq5 and seq6 carrier pYLCRISPR/Cas9-H expression is assembled into simultaneously according to Standard Operating Procedure to carry On body, double target spot knockout carrier B building of EAC1-like gene is completed.

(3) carrier A and carrier B are gone in Agrobacterium respectively by electroporated method.Using be successfully transferred to carrier A and The Agrobacterium of carrier B infects the callus group of (former name, the super excellent No. thousand) mature seed of hybrid rice Hunan two excellent 900 generation simultaneously It knits, positive transformants plant is obtained by hygromycin selection.

Specific step of converting are as follows:

3.1, the healthy seed for selecting hybrid rice Hunan two excellent 900 respectively peels off glume, is placed in 37 DEG C of incubators and stays overnight.Kind Son is put into the triangular flask of sterilizing after taking out, the ethyl alcohol surface sterilizing 5min for being first 75% with volume fraction, with aseptic water washing 1 Secondary, 0.1%HgCl sterilizes 12min, with aseptic water washing 5 times, places into sodium hypochlorite stoste disinfection 40min, aseptic water washing 5 It is secondary, it is dried on the filter paper of sterilizing.

3.2, seed is inoculated into induced medium (NB), the half of embryo is allowed to contact culture medium.20, every ware, is placed in 25 DEG C~26 DEG C at dark culture, with evoked callus.

3.3, after 20 days, the callus of surface dry, compact structure is selected, the bud head removed in grain and callus is gone to On subculture medium J3, at this time nutrition has been absorbed and has softened in grain, and squamous subculture 1~2 time, every time 20 days.

3.4, drawing LB plate, (by taking Agrobacterium EHA105 as an example, culture medium is LB+Kan 50mg/L+CHL 34mg/L+RIF Agrobacterium EHA105 50mg/L) is activated, picking single colonie draws LB plate (EHA105 LB+Kan50mg/L+CHL34mg/L two days later + RIF 50mg/L) full ware, 28 DEG C culture 48 hours it is spare.

3.5, Agrobacterium is washed in the co-cultivation base (NBM+As0.1mM) of 50ml liquid, adjusts OD600=0.5.

3.6, the callus of surface dry, compact structure is never selected in subculture or subculture 1~2 time callus, Whiten in air-drying on sterile filter paper to surface.Callus is transferred in the bacterium solution of step 3.5 and impregnates 30min, every 5min rocks once.

3.7, callus is removed, bacterium water rinse 5 times it is not muddy to liquid, with sterilizing filter paper suck dry moisture, in sterilizing Filter paper on air-dry to callus surface and whiten.It is then transferred into and co-cultures on base (NBM+As0.1mM), useful liquid is total to thereon The filter paper that culture medium soaks pays attention to that too many callus cannot be put in a culture dish, guarantee callus sufficiently with it is sterile Filter paper contacts, dark culture 3 days at 25~26 DEG C.

3.8, after 3 days, callus is transferred in sterilized triangular flask, it is not muddy to liquid with aseptic water washing 5 times, 30min is impregnated with the sterile water added with 500mg/L cytomycins and 400mg/L carbenicillin again, is rocked once every 5min.

3.9, callus is taken out, with aseptic filter paper suck dry moisture, in being air-dried on the filter paper of sterilizing to callus table Face is whitened, and screening and culturing medium J3S is transferred to.Screening is twice.

3.10, terminate to grow the callus global transfer of kanamycin-resistant callus tissue twice in screening and culturing medium after screening to pre- point Change on culture medium (Y+500mg/L born of the same parents+400mg/L carbenicillins), sets in the light incubator, condition of culture are as follows: 25~ 26 DEG C, 14h illumination cultivation, 1000~1500lx of light intensity.

3.11, there is callus greening successively within 3~7 days；The callus of greening in pre- differential medium is transferred to point Change on culture medium (DL+500mg/L cytomycin+400mg/L carbenicillins), is placed in 25~26 DEG C, 14h illumination cultivation, light Strong 1000~1500lx illumination cultivation, every 20 days one subcultures of replacement.

3.12, it as the green height of seedling about 5~8cm differentiated, is transferred on root media (R), promotes the growth of root, set In 25~26 DEG C, 14h illumination cultivation, light intensity 1000~1500lx illumination cultivation.

3.13, it after 3~4 weeks, opens bottle cap and distilled water is added, indoor hardening 3-5 days will be attached on seedling with tap water Culture medium is rinsed well, is transplanted in the side plate equipped with soil, is survived and move into bucket or experimental field again to seedling, and culture is extremely It is mature.

(4) T0 of the double equipotential homozygous knockouts of screening while success ectopic expression BBM1 gene is for transgenic plant.

4.1, design primer is to seq8F and seq8R:

Upstream primer Seq8F (SEQ ID NO.10): acatactatgtgaatcacga.

Downstream primer Seq8R (SEQ ID NO.11): acagcccaacgaccgacgag.

T0 is expanded for genetically modified plants by primer pair seq8F and seq8R, primer pair seq8F and seq8R difference On Osmads13 promoter sequence and on the code area of BBM1 gene, only planted in the transgenosis for being successfully transferred to carrier A The band that size is 598bp can be just amplified in strain.

4.2, design primer is to seq9F and seq9R:

Upstream primer Seq9F (SEQ ID NO.12): gcacatctacacgatacccaagc.

Downstream primer Seq9R (SEQ ID NO.13): acctggacgtgatcacacgtggc.

Primer pair seq9F and seq9R to the EAC1-like gene in the transgenic plant for being successfully transferred to carrier A into Row PCR amplification, and PCR product sequencing is carried out with seq9F, EAC1-like Gene Double equipotential homozygous mutation strain is screened with this.

(5) T0 screened realizes that rice heterosis is fixed for plant bagging self-fertility.

By BBM1 success ectopic expression while the transgenic hybrid rice bagging of EAC1-like Gene Double equipotential homozygous mutation Selfing harvests self-fertility seed.Self-fertility seed is planted, by observing whether plant phenotype occurs separation come just Step judges whether wild hybrid pig succeeds；Sequence is resurveyed by carrying out full-length genome to each plant, identifies and exists in Hunan two excellent 900 Heterozygous sites whether separate, with the frequency of this accurate judgement wild hybrid pig.

In the present embodiment, the selfing of Hunan two excellent 900 obtains 250 selfed seeds altogether, these seeds are planted in field, finds There are certain segregation phenomenons for phenotype.Full-length genome further has been carried out to 25 plants therein and has resurveyed sequence, and discovery there are 6 plants of plant complete The heterozygous sites in Hunan two excellent 900 are maintained, and in other 19 plants, these heterozygous sites are all partially separated.The knot Fruit explanation, can successfully realize the fixation of rice heterosis through the invention, and advantage fixed frequency is 24%.

The above described is only a preferred embodiment of the present invention, being not intended to limit the present invention in any form.Though So the present invention is disclosed as above with preferred embodiment, and however, it is not intended to limit the invention.It is any to be familiar with those skilled in the art Member, in the case where not departing from Spirit Essence of the invention and technical solution, all using in the methods and techniques of the disclosure above Appearance makes many possible changes and modifications or equivalent example modified to equivalent change to technical solution of the present invention.Therefore, Anything that does not depart from the technical scheme of the invention are made to the above embodiment any simple according to the technical essence of the invention Modification, equivalent replacement, equivalence changes and modification, all of which are still within the scope of protection of the technical scheme of the invention.

Sequence table

<110>Hunan Province hybrid rice research center

<120>a kind of method of fixed rice heterosis

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1573

<212> DNA

<213>rice (Rice)

<220>

<221> misc_feature

<222> (1)..(1573)

<223>it is designed according to requirement of experiment, as the promoter of OsMADS13 gene.

<400> 1

gatgtctaaa tagctataaa tgggtaagca agatagcaaa gaaggccagt ggcctttgca 60

gctaagctag ctagctagcc cttcttcctc tctttcctgc tttccctttg ccttctccta 120

ttaatcctct gcacctcaca cagcagcaga aaacccacca actggagctc tcctttccta 180

ctccaagaaa cgaaggtaga gaaagaaaga tcagatcagc ttcaggacca attttagcta 240

ggttatatat ctctttgcgt gctaatgtgt tttagttatc tgggtgtgtg tagagttctt 300

tgttaaggca ctgattcagc tgcagtttag attcaagttt gtatgttctc tctttgagga 360

aaagaaaccc ttttcctgtg cttcgagttc ttgcaaagag aaactgtgat gcttggcttc 420

cagtttgatg cttctttgtt cagattggaa attcttccta gcttctttct ctatttatgt 480

agcaaggatt ctttccggcc cagtgatcct ggtttctttt ggaaggtttc agttttttcg 540

ttctttcttg aaatttctct tcttgcctta ggcagatctt tgatcttgtg aggagacagg 600

agaaaaggaa gaagctagtt tcctgcggcc gacctcttgc ttctcacttt gtgatgagtt 660

ttctttggtc aattcttagc tagatatgtt aagatagtta gttaagcaaa tcgaaattgc 720

tagcttttcc atgctttctt aaacatgatt cttcagattt ggttggttct tttttttcct 780

ttttgtggag acgtgctgtt cttgcatctt atccttcttg attcatctac ccatctggtt 840

ctttgagctt tctttttcgc ttcttccctt cattatttcg agcaatctct gcacatctga 900

aagttttgtt tcttgagact acttttgcta gatcttgttt actcgatcac tctatacttg 960

catctaggct cctttctaaa taggcgatga ttgagctttg cttatgtcaa atgatgggat 1020

agatattgtc ccagtctcca aatttgatcc atatccgcca agtctttcat catctttttc 1080

tttctttttt atgagcaaaa atcatctttt tctttcaaag ttcagctttt ttctcttgtt 1140

ttacccctct ttagctatag ctggtttctt attccttttg gatttacatg tataaaacat 1200

gcttgaattt gttagatcga tcactttata cacatactat gtgaatcacg atctcagatc 1260

tctcagtata gttgaattca ttaatttctt agatcgatca gcgtgtgatg tagtactgta 1320

aatcactact agatctttca tcagtctctt ttctgcatct atcaatttct catgcaagtt 1380

ttagttgttt ctttaatccg gtctctctct cttttttaat cagctgagag tttgtgctgt 1440

tctttaatca ttaccagatc tttcatcagt actctctctt ctgcatctat caaacttctc 1500

atgcaatgtt tttgctgttc tttgatctga tctctggtct ccttttttgt tgatcagttg 1560

agagcaagaa gac 1573

<210> 2

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(30)

<223>it is designed according to requirement of experiment, as upstream primer seq1F.

<400> 2

ggtaccgatg tctaaatagc tataaatggg 30

<210> 3

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(35)

<223>it is designed according to requirement of experiment, as downstream primer seq1R.

<400> 3

tgatggaggc catgtcttct tgctctcaac tgatc 35

<210> 4

<211> 1680

<212> DNA

<213>rice (rice)

<220>

<221> misc_feature

<222> (1)..(1680)

<223>it is designed according to requirement of experiment, as BBM1 coding sequence.

<400> 4

atggcctcca tcaccaactg gctcggcttc tcctcctcct ccttctccgg cgccggcgcc 60

gaccccgtcc tgccccaccc gccgctgcaa gagtggggga gcgcttatga gggcggcggc 120

acggtggcgg ccgccggcgg ggaggagacg gcggcgccga agctggagga cttcctcggc 180

atgcaggtgc agcaggagac ggccgccgcg gcggcggggc acggccgtgg aggcagctcg 240

tcggtcgttg ggctgtccat gatcaagaac tggctacgca gccagccgcc gcccgcggtg 300

gttgggggag aagacgctat gatggcgctc gcggtgtcga cgtcggcgtc gccgccggtg 360

gacgcgacgg tgccggcctg catttcgccg gatgggatgg ggtcgaaggc ggccgacggc 420

ggcggcgcgg ccgaggcggc ggcggcggcg gcggcgcaga ggatgaaggc ggccatggac 480

acgttcgggc agcggacgtc catctaccgg ggtgtcacca agcacaggtg gacaggaagg 540

tatgaagccc atctttggga taacagctgc agaagagaag gtcagactcg caaaggcaga 600

caagtcaatg caggaggata tgataaggaa gaaaaagctg ctagggctta tgatttggct 660

gcccttaaat actggggcac tacaacgacg acgaattttc cggtaagcaa ctacgaaaaa 720

gagttggatg aaatgaagca catgaatagg caggaatttg ttgcatccct tagaagaaaa 780

agcagtggat tttcacgtgg tgcttccata tatcgtggtg ttacaagaca ccatcagcat 840

ggaaggtggc aagcaaggat aggacgggtg gcaggaaaca aggatctgta tttgggcaca 900

tttggcaccc aagaggaagc tgcagaggca tatgatatcg ctgcaatcaa attccgtggt 960

ctcaatgctg tgacaaactt tgacatgagc cggtacgatg tcaagagcat cattgaaagc 1020

agcaatctcc caattggtac tggaaccacc cggcgattga aggactcctc tgatcacact 1080

gataatgtca tggacatcaa tgtcaatacc gaacccaata atgtggtatc atcccacttc 1140

accaatgggg ttggcaacta tggttcgcag cattatggtt acaatggatg gtcgccaatt 1200

agcatgcagc cgatcccctc gcagtacgcc aacggccagc ccagggcatg gttgaaacaa 1260

gagcaggaca gctctgtggt tacagcggcg cagaacctgc acaatctaca tcattttagt 1320

tccttgggct acacccacaa cttcttccag caatctgatg ttccagacgt cacaggtttc 1380

gttgatgcgc cttcgaggtc cagtgactca tactccttca ggtacaatgg aacaaatggc 1440

tttcatggtc tcccgggtgg aatcagctat gctatgccgg ttgcgacagc ggtggaccaa 1500

ggtcagggca tccatggcta tggagaagat ggtgtggcag gcattgacac cacacatgac 1560

ctgtatggca gccgtaatgt gtactacctt tccgagggtt cgcttcttgc cgatgtcgaa 1620

aaagaaggcg actatggcca atctgtgggg ggcaacagct gggttttgcc gacaccgtag 1680

<210> 5

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(24)

<223>it is designed according to requirement of experiment, as upstream primer seq3F.

<400> 5

atggcctcca tcaccaactg gctc 24

<210> 6

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(29)

<223>it is designed according to requirement of experiment, as downstream primer seq3R.

<400> 6

tctagactac ggtgtcggca aaacccagc 29

<210> 7

<211> 456

<212> DNA

<213>rice (rice)

<220>

<221> misc_feature

<222> (1)..(456)

<223>it is designed according to requirement of experiment, as EAC1-like gene coded sequence.

<400> 7

atggcgtgct cgggcagttt cctaccgata atgctcctgc cgctgctcct cgccggcgcc 60

gcggtggcgg gcggcgcccc gccggggctt gggctggcgc agcggctggc cgacggcgtg 120

gggcagcagc agcagcagtg ctgggaggtt ctgatggaga tcaagtcgtg cacgggggag 180

atcctcctct tcttcatcaa cggcgaggcg tacctggggc ccggctgctg ccgcgccatc 240

cgcgtcatcg agcagagctg ctgggccacc gacgccatgc tgtccgtcat cgggttcacc 300

ccggaggagg gggacatgct caagggctac tgcgacgccg gcgacgagca caagccgtcg 360

ccgccccccg cctcgccggc cgtcggctac gtcgccgtcg gagagaacgc cgccgtaccg 420

gccggacgga agagcctggc gctgcagcac cgttag 456

<210> 8

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(23)

<223>it is designed according to requirement of experiment, as target spot seq5.

<400> 8

ctcctgccgc tgctcctcgc cgg 23

<210> 9

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(23)

<223>it is designed according to requirement of experiment, as target spot seq6.

<400> 9

gctgctcctc gccggcgccg cgg 23

<210> 10

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223>it is designed according to requirement of experiment, as upstream primer Seq8F.

<400> 10

acatactatg tgaatcacga 20

<210> 11

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223>it is designed according to requirement of experiment, as downstream primer Seq8R.

<400> 11

acagcccaac gaccgacgag 20

<210> 12

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(23)

<223>it is designed according to requirement of experiment, as upstream primer Seq9F.

<400> 12

gcacatctac acgataccca agc 23

<210> 13

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(23)

<223>it is designed according to requirement of experiment, as downstream primer Seq9R.

<400> 13

acctggacgt gatcacacgt ggc 23

Claims

1. a kind of method of fixed rice heterosis, which comprises the following steps:

S1, OsMADS13 promoter is connect with Rice BB M1 gene coded sequence, is building up in expression vector and obtains carrier A； The sequence of the OsMADS13 promoter is as shown in SEQ ID NO.1；The Rice BB M1 gene coded sequence such as SEQ ID Shown in NO.4；Construct the carrier B that the bis- target spot CRISPR/Cas9 of EAC1-like are knocked out；

S2, the carrier A and the carrier B are obtained into T0 generation plant into hybrid rice seeds by agrobacterium-mediated transformation cotransformation Strain；

The T0 of S3, screening EAC1-like Gene Double equipotential homozygous knockout while success ectopic expression BBM1 gene are carried out for plant Selfing obtains selfed seed.

2. the method for fixed rice heterosis according to claim 1, which is characterized in that carried described in the S1 step The preparation method of body A specifically:

S1-A1, promoter sequence design primer seq1F and seq1R according to OsMADS13 gene are with oryza sativa genomic dna Template carries out PCR amplification and obtains amplified production 1；

S1-A2, according to BBM1 coding sequence design primer seq3F and seq3R, using Rice Callus cDNA as mould Plate carries out PCR amplification and obtains amplified production 2；

S1-A3, the amplified production 1 and the amplified production 2 are mixed as template, utilizes the primer seq1F and described Primer seq3R carries out PCR amplification, the amplified production 3 after obtaining amplified production 1 and the integration of amplified production 2；

3. the method for fixed rice heterosis according to claim 2, which is characterized in that the sequence of the primer seq1F Column are as shown in SEQ ID NO.2；The sequence of the primer seq1R is as shown in SEQ ID NO.3.

4. the method for fixed rice heterosis according to claim 2, which is characterized in that the sequence of the primer seq3F Column are as shown in SEQ ID NO.5；The sequence of the primer seq3R is as shown in SEQ ID NO.6.

5. the method for fixed rice heterosis according to claim 1, which is characterized in that carried described in the S1 step The preparation method of body B specifically:

S1-B1, according to EAC1-like coding sequence design target sequence；

6. the method for fixed rice heterosis according to claim 4, which is characterized in that target described in the S1-B1 Marking sequence includes seq5 and seq6, and the DNA sequence dna of the seq5 is as shown in SEQ ID NO.8, and the DNA sequence dna of the seq6 is such as Shown in SEQ ID NO.9.

7. the method for fixed rice heterosis according to claim 1, which is characterized in that screen while striking in the S3 Except EAC1-like gene and success ectopic expression BBM1 gene T0 for transgenic plant method the following steps are included:

S3-1, design primer are to seq8F and seq8R, and the sequence of the Seq8F is as shown in SEQ ID NO.10, the Seq8R Sequence as shown in SEQ ID NO.11；T0 is expanded for genetically modified plants, the positive for screening Successful amplification carrier A turns Gene plant；

S3-2, design primer to seq9F and seq9R, the sequence of the Seq9F as shown in SEQ ID NO.12, the Seq9R's Sequence is as shown in SEQ ID NO.13；PCR amplification, screening are carried out to the positive transgenic plant of Successful amplification carrier A EAC1-like Gene Double equipotential homozygous mutation strain.