CN110257384A - A kind of aptamer and its construction method and application - Google Patents
A kind of aptamer and its construction method and application Download PDFInfo
- Publication number
- CN110257384A CN110257384A CN201910598897.5A CN201910598897A CN110257384A CN 110257384 A CN110257384 A CN 110257384A CN 201910598897 A CN201910598897 A CN 201910598897A CN 110257384 A CN110257384 A CN 110257384A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- grass carp
- nucleotide sequence
- intestines
- lonely
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/13—Applications; Uses in screening processes in a process of directed evolution, e.g. SELEX, acquiring a new function
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of aptamer, including following nucleotide sequence: GGGTGTAGCTCGTTATGATTCGGACAAGACTTACCTTGCGCCTCTGGGAT.The molecular weight of aptamer provided by the invention is smaller, short preparation period, favorable reproducibility, synthesizes convenient for iii vitro chemical, and convenient for label, sequence is stable and easy to transport and save.The aptamer exhales the lonely I type virus of intestines specificity with higher and affinity, and non-immunogenicity to grass carp.
Description
Technical field
The invention belongs to aquatic pathogenic bacterium detection technique fields, and in particular, to a kind of aptamer and its building side
Method and application.
Background technique
Guangxi is the big province of aquaculture in China, main breed variety include grass carp, channel catfish, grouper, grass carp,
Prawn, oyster, pteria martensii and various food plants.According to statistics, ended for the end of the year 2017, the fishery economic gross output value in Guangxi is
More than 62,100,000,000 yuan, aquaculture total amount is more than 320.76 ten thousand tons.However, the continuous expansion of aquaculture scale and cultivation density
Continue to increase breeding environment caused to deteriorate, all kinds of aquatic products epidemic disease cause of diseases are frequently broken out.Nanning, rivers and ponds, Liuzhou in 2018
Etc. the grass carp of ground pond and cage culture break out doubtful grass carp hemorrhage disease, by polymerizeing to pathogenic microorganism in illness grass carp
Enzyme chain reaction detection technique (polymerase chain reation, PCR) analyzes and identifies, it was demonstrated that grass carp exhales the lonely I type disease of intestines
Malicious (Grass carp reovirus, GCRV I) is principal causative cause of disease.Grass carp hemorrhage disease is the most common disease in grass carp cultivation
Viral disease, infective pathogen are grass carp reovirus (Grass carp reovirus, GCRV), also known as hemorrhagic disease of grass carp disease
Malicious (GCHV), is subordinate to Reoviridae, Aquareovirus category.GCRV virus is passed as a kind of highly pathogenic fish
It catches an illness poison, is usually expressed as explosion type infection, i.e., can lead to fish mortality in a very short period of time.At present caused by GCRV virus
Grass carp viral hemorrhagic disease is widely present in China, seriously affects the development of the culture fishery in China.Therefore, novel height is researched and developed
The antiviral drugs of effect, meanwhile, the detection skill that convenient, at low cost, time-consuming is short, accuracy is high is operated for GCRV viral progression
Art is most important for the harm of prevention and control grass carp GCRV virus.
Aptamer is aglucon phyletic evolution technology (the Systematic Evolution of of utilization index enrichment
Ligands by Exponential Enrichment technology, SELEX), being obtained in vitro by multi-turns screen,
It is capable of the single-stranded oligonucleotide of specific recognition target substance.Aptamer is high with specificity, compatibility is high, stability is strong,
Many advantages, such as chemically reactive synthesis and chemical modification.The novel inspection that aptamer is novel as one kind at present, is widely noticed
Survey and treatment tool, before wide application is shown in fields such as physianthropy research, medical diagnosis on disease, virus infection Mechanism Studies
Scape.
Summary of the invention
The object of the present invention is to provide a kind of aptamer and its construction method and applications, to realize that grass carp exhales intestines orphan I
Highly sensitive, the specific detection of type virus.
According to an aspect of the present invention, a kind of aptamer is provided: the nucleotide sequence including SEQ ID NO.1.
Preferably, the nucleotide sequence including SEQ ID NO.2.
Preferably, at least one nucleotide on nucleotide sequence be phosphorylated, sulfhydrylation, methylation, amination or
Isotopologue.
Preferably, marker is combined on nucleotide sequence, marker is selected from fluorescent material, luminescent material, biotin
One of enzyme or more than one.
Preferably, fluorescent material in hydroxyl fluorescein, fluorescein isothiocynate or carboxyl tetramethylrhodamine one
Kind or more than one.
According to another aspect of the present invention, a kind of method for constructing above-mentioned aptamer is provided, using SELEX skill
Art, comprising the following steps: (1) establish single stranded DNA random library Library50, the core of single stranded DNA random library Library50
Nucleotide sequence are as follows:
5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT；(2) lonely I type of intestines is exhaled using grass carp
Virus infected cell screens single stranded DNA random library Library50, show that grass carp exhales the specific DNA text of the lonely I type virus of intestines
Library；(3) using specific DNA libraries as template, the primer of SEQ ID NO.3 is classified as with nucleotides sequence, nucleotides sequence is classified as SEQ
The primer of ID NO.4 carries out PCR amplification.
Preferably, the amplification program of PCR amplification is: 94 DEG C 5 minutes, 94 DEG C 1 minute, 56 DEG C 30 seconds, 72 DEG C 1 minute, 25
Wheel circulation；72 DEG C 5 minutes.
According to another aspect of the present invention, above-mentioned aptamer is provided to exhale in the lonely I type virus of intestines in detection grass carp
Using.
According to another aspect of the present invention, providing a kind of grass carp exhales the quantitative fluorescent PCR of the lonely I type virus of intestines quickly to detect
Kit: including fluorescent molecule detection probe, using above-mentioned aptamer as fluorescent molecule detection probe, marker is hydroxyl
Fluorescein.
The molecular weight of aptamer provided by the invention is smaller, short preparation period, favorable reproducibility, closes convenient for iii vitro chemical
At convenient for label, sequence is stable and easy to transport and save.The aptamer exhales the lonely I type virus of intestines with higher grass carp
Specificity and affinity, and non-immunogenicity.In addition, the nucleotide sequence for forming the aptamer is easy to be substituted or repair
Decorations.Partially replaced or the above-mentioned aptamer after modification be able to maintain with former aptamer it is essentially identical or
Similar molecular structure, physicochemical property and function equally can effectively realize that grass carp exhales the detection of the lonely I type virus of intestines.Utilize hydroxyl
Base fluorescein marks aptamer provided by the invention, the aptamer is fabricated to fluorescence probe as a result, by itself and reality
When fluorescence quantitative PCR detection technique combine, can be realized and the high specific of the lonely I type virus of intestines, high sensitivity are exhaled to grass carp
Real-time qualitative, quantitative detection.
Detailed description of the invention
Fig. 1 is the secondary structure prediction figure for the aptamer that nucleotides sequence is classified as SEQ ID NO.2；
Fig. 2 is the sample F AM fluorescent value test result of flow cytomery in embodiment 2；
Fig. 3 is the observed result of laser scanning co-focusing microscope in embodiment 2: (a) the light microscopic figure of control sample,
(b) fluorogram of control sample, (c) the light microscopic figure of test group sample, (d) fluorogram of test group sample.
Specific embodiment
It in order to enable those skilled in the art to better understand the solution of the present invention, below will be to the skill in the embodiment of the present invention
Art scheme is clearly and completely described, it is clear that and the described embodiment is only a part of the embodiment of the present invention, without
It is whole embodiments.
Embodiment 1 detects the screening and preparation of the aptamer of I type of grass carp GCRV virus
S1. the synthesis of the building in the library random single chain DNA (ssDNA) and primer
SsDNA pool Library50 is constructed, both ends are fixed sequence program, and intermediate 50 nucleotide are random sequence,
Nucleotide sequence is as follows:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT。
5 ' primers (SEQ ID NO.3): 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3 '.
3 ' primers (SEQ ID NO.4): 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3 '.
SsDNA pool and primer are synthesized by the raw work biology Co., Ltd in Shanghai.
S2.SELEX screens (being equivalent to positive-selecting)
The above-mentioned ssDNA pool of 10nmol is dissolved in 500 μ L PBS, 92 DEG C of water bath with thermostatic control 5min, then rapidly
It is inserted into ice, ice bath 10min, by treated, ssDNA pool is incubated on ice with I type virus infected cell of grass carp GCRV
1h。
After the completion of hatching combination, centrifugation removes supernatant, and it is thin to wash I type virus infection of grass carp GCRV with the process PBS of 10mL
Supernatant, as I type virus infected cell of specific recognition grass carp GCRV is collected by centrifugation in born of the same parents, 92 DEG C of waters bath with thermostatic control 10min, 12000g
SsDNA nucleic acid library.
S3.PCR amplification
The library ssDNA for the I type virus infected cell of identification grass carp GCRV for taking 100 μ L to screen and 5 ' primers, 3 ' are drawn
Object carries out PCR amplification.Following (1000 μ L): 10 × Buffer 100 μ L, dNTP Mix (2.5mM) the 80 μ L of PCR reaction system,
40 library μ L, ssDNA of primer, 100 μ L, rTaq enzyme 12.5 the μ L, ddH of 40 μ L, the SEQ ID NO.4 of primer of SEQ ID NO.32O
627.5μL.The amplification program of PCR are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled by 25 wheels；72
℃5min.The supernatant obtained after the screening of first round SELEX will be completely used for carrying out PCR amplification, obtain double-strandednucleic acid after amplification
(dsDNA) library.
The preparation in the library S4.ssDNA
The library dsDNA made from the magnetic bead and S3 of 100 μ L streptavidins label is incubated for 20min at normal temperature, is utilized
The affinity interaction of streptavidin, is integrated to magnetic bead surfaces for dsDNA on biotin and magnetic bead on dsDNA, utilizes magnetism point
From supernatant is removed on device, magnetic bead is washed with 2mL PBS, 200 μ L NaOH solutions (200mM) are then added in EP pipe, room temperature is anti-
10min is answered, dsDNA is made to be denaturalized unwinding, a chain with biotin stays on magnetic bead in conjunction with streptavidin, after completion of the reaction
It recycles to obtain supernatant using magnetic separation rack；Supernatant is added and removes salt plug after sterile water washing, in the work of gravity
It is dripped off naturally with lower.500 μ L PBS are added into filtrate, are collected into the solution containing the library ssDNA, the sieve for next round
Choosing.
The repeated screening in the library S5.ssDNA
The library ssDNA obtained in S4 is replaced into the ssDNA pool in S2, repeats the sieve of SELEX shown in S2-S4
Choosing, producing process 9 times of PCR amplification and the library ssDNA.
S6. negative screening
The second wheel of S5 and the second wheel are screened the obtained library ssDNA dissolution, 92 DEG C of waters bath with thermostatic control, ice baths later after,
It is incubated for 1h on ice with grass carp normal cell, supernatant solution is collected by centrifugation after the completion of being incubated for；Then by this supernatant solution and grass carp
Normal cell carries out ice bath combination；After the completion of hatching combination, supernatant is collected, at this point, the supernatant being collected into is by negative sieve
The library ssDNA of choosing.
This step uses grass carp normal cell for control, by the library ssDNA screened after S5 carry out negative screening with
Improve the screening efficiency in the library ssDNA.
S7.9 wheel screening
The supernatant that will be collected into S6, by the library ssDNA of the PCR amplification of S3 and S4 preparation after, be repeated in into
The process of row S6, S2, S3 and S4, using the library ssDNA obtained by flow cytomery to I type virus infected cell of grass carp GCRV
The situation of change of recognition capability repeats the screening of 9 wheels, and the obtained library ssDNA is to I type virus infected cell of grass carp GCRV
Recognition capability reaches most strong.By gained amplified production after cloning and sequencing is analyzed, finally obtains and can be used for detecting I type of grass carp GCRV
The ssDNA aptamer of virus infected cell, nucleotide sequence are as follows:
GGGTGTAGCTCGTTATGATTCGGACAAGACTTACCTTGCGCCTCTGGGAT (SEQ ID NO.1),
Or,
GTCTGAAGTAGACGCAGGAGGGGTGTAGCTCGTTATGATTCGGACAAGACTTACCTTGCGCCTCTGGG
ATAGTCACACCTGAGTAAGCGT(SEQ ID NO.2)。
Do you utilize MFOLD software (http://mfold.rna.albany.edu/? q=mfold/DNA-Folding-Form)
On-line prediction nucleotides sequence is classified as the secondary structure of the aptamer of SEQ ID NO.2, and prediction result is as shown in Figure 1, nucleic acid
Aptamers form special loop-stem structure and hairpin structure.
Embodiment 2
2.1 key instrument
Attune NxT flow cytometer (the silent winged generation that science and technology of match), FV3000 laser scanning co-focusing microscope (Olympic
Bath).
2.2 experimental implementation
The SEQ ID NO.2 aptamer that marks embodiment 1 to prepare respectively using hydroxyl fluorescein (FAM) and random
The library ssDNA Library50.
Test group: the SEQ ID NO.2 aptamer that 0.1nmol FAM is marked is dissolved in 500 μ L PBS, 92 DEG C
Water bath with thermostatic control 5min, is then rapidly inserted into ice, ice bath 10min, will treated SEQ ID NO.2 aptamer and grass carp
I type virus infected cell of GCRV is incubated for 1h on ice.After the completion of hatching combination, centrifugation removes supernatant.
Control group: the ssDNA pool Library50 that 0.1nmol FAM is marked is dissolved in 500 μ LPBS, 92 DEG C
Water bath with thermostatic control 5min, is then rapidly inserted into ice, ice bath 10min, will treated ssDNA pool Library50 and grass
I type virus infected cell of fish GCRV is incubated for 1h on ice.After the completion of hatching combination, centrifugation removes supernatant.
Flow cytometer and laser scanning co-focusing microscope detection test group and control group are utilized respectively by being incubated for institute
Obtained cell precipitate.
2.3 experimental result
The testing result of flow cytometer is apparently higher than control group as shown in Fig. 2, measuring fluorescent value corresponding with test group.
The testing result of laser scanning co-focusing microscope is as shown in figure 3, control group is barely perceivable apparent fluorescent effect, relatively
For, fluorescent effect corresponding to experimental group is obvious, and cell sample issues strong green light.
The test result of flow cytometer and laser scanning co-focusing microscope explanation, with ssDNA pool
Library50 is compared, and the SEQ ID NO.2 aptamer of FAM label has I type virus infected cell of grass carp GCRV higher
Affinity and specificity.
The above embodiments are merely illustrative of the technical solutions of the present invention rather than limiting the scope of the invention, although ginseng
The present invention is explained in detail according to preferred embodiment, those skilled in the art should understand that, it can be to of the invention
Technical solution is modified or replaced equivalently, without departing from the spirit and scope of technical solution of the present invention.
SEQUENCE LISTING
<110>Guangxi Academy Of Sciences
<120>a kind of aptamer and its construction method and application
<130>
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 50
<212> DNA
<213>artificial sequence
<400> 1
gggtgtagct cgttatgatt cggacaagac ttaccttgcg cctctgggat 50
<210> 2
<211> 90
<212> DNA
<213>artificial sequence
<400> 2
gtctgaagta gacgcaggag gggtgtagct cgttatgatt cggacaagac ttaccttgcg 60
cctctgggat agtcacacct gagtaagcgt 90
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
gtctgaagta gacgcaggag 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
acgcttactc aggtgtgact 20
Claims (10)
1. a kind of aptamer, it is characterised in that: the nucleotide sequence including SEQ ID NO.1.
2. aptamer as described in claim 1, it is characterised in that: the nucleotide sequence including SEQ ID NO.2.
3. aptamer as described in claim 1, it is characterised in that: at least one nucleotide on its nucleotide sequence is by phosphorus
Acidification, sulfhydrylation, methylation, amination or isotopologue.
4. the aptamer as described in any one of claim 1-3, it is characterised in that: be combined with mark on its nucleotide sequence
Object, the marker be selected from one of fluorescent material, luminescent material, biotin or enzyme or more than one.
5. aptamer as claimed in claim 4, it is characterised in that: the fluorescent material is selected from hydroxyl fluorescein, different sulphur cyanogen
One of sour fluorescein or carboxyl tetramethylrhodamine or more than one.
6. a kind of method of building aptamer as described in any one of claims 1 or 2, which is characterized in that use SELEX skill
Art, comprising the following steps:
(1) single stranded DNA random library Library50, the nucleotide sequence of the single stranded DNA random library Library50 are established
Are as follows:
5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT；
(2) it exhales the lonely I type virus infected cell of intestines to screen the single stranded DNA random library Library50 using grass carp, obtains grass carp
Exhale the specific DNA libraries of the lonely I type virus of intestines；
(3) using the specific DNA libraries as template, primer, the nucleotide sequence of SEQ ID NO.3 are classified as with nucleotides sequence
PCR amplification is carried out for the primer of SEQ ID NO.4.
7. the method for building aptamer as claimed in claim 6, which is characterized in that the amplification program of the PCR amplification is:
94 DEG C 5 minutes, 94 DEG C 1 minute, 56 DEG C 30 seconds, 72 DEG C 1 minute, 25 wheel circulation；
72 DEG C 5 minutes.
8. aptamer exhales the application in the lonely I type virus of intestines in detection grass carp as described in any one of claim 1-3.
9. aptamer as claimed in claim 4 exhales the application in the lonely I type virus of intestines in detection grass carp.
10. the quantitative fluorescent PCR quick detection kit that a kind of grass carp exhales the lonely I type virus of intestines, it is characterised in that: including fluorescence point
Sub- detection probe, using aptamer as claimed in claim 4 as the fluorescent molecule detection probe, the marker is hydroxyl
Base fluorescein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910598897.5A CN110257384B (en) | 2019-07-04 | 2019-07-04 | Aptamer and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910598897.5A CN110257384B (en) | 2019-07-04 | 2019-07-04 | Aptamer and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110257384A true CN110257384A (en) | 2019-09-20 |
| CN110257384B CN110257384B (en) | 2022-06-14 |
Family
ID=67924307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910598897.5A Active CN110257384B (en) | 2019-07-04 | 2019-07-04 | Aptamer and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257384B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040005543A1 (en) * | 2002-01-18 | 2004-01-08 | Abraham Grossman | Compositions and methods for binding agglomeration proteins |
| CN107034220A (en) * | 2017-05-16 | 2017-08-11 | 中国水产科学研究院珠江水产研究所 | Aptamer and its derivative, the screening technique and application of GCRV |
| CN109136229A (en) * | 2018-09-26 | 2019-01-04 | 广西科学院 | The aptamer of specific recognition egg-shaped pompano source nervous necrosis virus and its application |
-
2019
- 2019-07-04 CN CN201910598897.5A patent/CN110257384B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040005543A1 (en) * | 2002-01-18 | 2004-01-08 | Abraham Grossman | Compositions and methods for binding agglomeration proteins |
| CN107034220A (en) * | 2017-05-16 | 2017-08-11 | 中国水产科学研究院珠江水产研究所 | Aptamer and its derivative, the screening technique and application of GCRV |
| CN109136229A (en) * | 2018-09-26 | 2019-01-04 | 广西科学院 | The aptamer of specific recognition egg-shaped pompano source nervous necrosis virus and its application |
Non-Patent Citations (3)
| Title |
|---|
| LI OF等: ""Probing and characterizing the high specific sequences of ssDNA aptamer against SGIV-infected cells"", 《VIRUS RESEARCH》 * |
| TOMOHIRO SHIMADA等: ""RutR is the uracil/thymine-sensing master regulator of a set of genes for synthesis and degradation of pyrimidines"", 《MOLECULAR MICROBIOLOGY》 * |
| 李鹏飞等: ""基于新型核酸适配体-荧光分子检测探针的石斑鱼虹彩病毒病快速诊断"", 《广西科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110257384B (en) | 2022-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Félix et al. | Natural and experimental infection of Caenorhabditis nematodes by novel viruses related to nodaviruses | |
| International Silkworm Genome Consortium | The genome of a lepidopteran model insect, the silkworm Bombyx mori | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN110643611B (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN113215167B (en) | Aptamer and application thereof in detecting cells infected by largemouth black bass iridovirus | |
| CN106947827A (en) | One kind obtains flathead sex specific molecular marker and its screening technique and application | |
| CN111073892A (en) | Aptamer for identifying grouper iridovirus infected cells and construction method and application thereof | |
| CN105385691A (en) | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit | |
| CN112266967A (en) | Weever immune-related SNP (single nucleotide polymorphism) locus and application thereof in breeding | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN109825565A (en) | A kind of Cynoglossus semilaevis true and false milter discriminating method based on fluorescent molecule label system | |
| Chen et al. | RNA virome composition is shaped by sampling ecotype | |
| CN109207480B (en) | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof | |
| CN112746116A (en) | Litopenaeus vannamei female DNA label sequence, primer and application thereof in sex identification | |
| CN110257384A (en) | A kind of aptamer and its construction method and application | |
| CN110257387A (en) | The aptamer and its construction method of identification grass carp hemorrhagic disease virus and application | |
| CN113462693B (en) | Application of ssDNA aptamer in identifying largemouth black bass iridovirus infected cells | |
| CN110257385A (en) | Anti- grass carp exhales aptamer and its construction method and the application of the lonely I type virus of intestines | |
| CN110257386A (en) | The aptamer and its construction method of anti-I virus of grass carp GCRV and application | |
| CN111454956B (en) | Nucleic acid aptamer for Chinese soft-shelled turtle iridovirus as well as construction method and application thereof | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| CN109536624A (en) | For screening the fluorescent molecule tagging and testing method of Cynoglossus semilaevis true and false milter property | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN107937404A (en) | A kind of aptamer and its application in identification, detection vibrio alginolyticus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |