CN110241118B

CN110241118B - Targeting inhibitor of ZFAS1 gene and application thereof

Info

Publication number: CN110241118B
Application number: CN201910552940.4A
Authority: CN
Inventors: 李新星; 孙寒雪; 郑继慧
Original assignee: Shengjing Hospital of China Medical University
Current assignee: Shengjing Hospital of China Medical University
Priority date: 2019-06-25
Filing date: 2019-06-25
Publication date: 2023-04-18
Anticipated expiration: 2039-06-25
Also published as: CN110241118A

Abstract

The invention belongs to the technical field of medicines, and particularly relates to a targeted inhibitor of a ZFAS1 gene and application thereof. A targeted inhibitor of ZFAS1 gene has a gene sequence of 5'-GTGCCCACTTCAAGAATGTCA-3'. The inhibitor can be specifically combined with ZFAS1 gene to silence ZFAS1 gene, thereby inhibiting the influence of ZFAS1 gene on the permeability of hematoma barrier, safely and effectively increasing the permeability of hematoma barrier, and improving the concentration of traditional chemotherapy drugs in tumor tissues when being used in cooperation with the traditional chemotherapy drugs.

Description

Targeting inhibitor of ZFAS1 gene and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to a targeted inhibitor of a ZFAS1 gene and application thereof.

Background

Brain glioma is the most common malignant tumor of the central system and accounts for 50% -60% of primary brain tumors. At present, the treatment means mainly comprises operation and radiotherapy and chemotherapy as auxiliary treatment. However, since gliomas have the biological characteristics of aggressive growth and are more aggressive at higher grade, recurrence is inevitable even when imaging and microscopic resection is performed. Statistics after the current mainstream surgery and postoperative synchronous chemotherapy show that the median survival period is only 12 months, and the 5-year survival rate is less than 13%. High-grade gliomas have a poorer prognosis, and for example, glioblastoma multiforme (GBMs) still has poor curative effect, and the median survival still does not exceed 15 months. Due to poor therapeutic efficacy, more and more researchers are working on developing new therapeutic drugs against molecular targets, including tumor markers, aberrant signaling pathways, epigenetic gene expression regulation, tumor angiogenesis inhibitors, tumor immunotherapy, and the like. In the application of the above therapeutic strategies, the presence of a Blood Tumor Barrier (BTB) between brain capillary endothelial cells and tumor cells greatly limits the therapeutic drugs from entering the tumor tissue, affecting the therapeutic efficacy. How to effectively increase the permeability of the blood tumor barrier and promote the therapeutic drugs to selectively enter the tumor tissues is a key problem to be solved urgently.

Long non-coding RNAs (lncrnas) are a class of non-coding RNA transcripts that are greater than 200 nucleotides in length. Research shows that LncRNA can regulate the generation and development of glioma. Research shows that ZFAS1 promotes proliferation and migration of gastric cancer cells, abnormal expression of ZFAS1 in non-small cell lung cancer tissues, and recent research reports that ZFAS1 is highly expressed in colorectal cancer tissues, ovarian cancer tissues and melanoma tissues, so that ZFAS1 inhibitors are only used in the tumor tissues. Expression of ZFAS1 in glioma microvascular endothelium and involvement in the regulation of hematoma barrier permeability have not been discovered so far.

The principle of RNA interference technology is the process of utilizing Dicer enzyme to cut RNA molecules, forming an RNA silencing complex, combining target RNA molecules in a targeted mode and further degrading the RNA molecules. The invention hopes to develop the ZFAS1 gene inhibitor by using the RNA interference technology, and plays a role in the field of glioma gene therapy.

At present, a related mechanism of ZFAS1 influencing glioma hematoma barrier is not reported, and an application of ZFAS1 in glioma gene therapy is blank at present. Therefore, the development of a ZFAS 1-related drug is a problem to be solved urgently at present.

Disclosure of Invention

Experiments prove that the ZFAS1 gene is highly expressed in glioma tissues, and can open a hematoma barrier, increase the permeability of the hematoma barrier and improve the drug concentration in tumor tissues by inhibiting the expression of ZFAS1, so that the curative effect of brain glioma chemotherapy is improved.

The invention aims to design and provide a ZFAS1 gene targeting inhibitor and application thereof by utilizing an RNA interference technology, wherein the inhibitor can be specifically combined with a ZFAS1 gene to silence the ZFAS1 gene, so that the influence of the ZFAS1 gene on the barrier permeability of hematoma is inhibited, and the purpose of treating glioma is achieved.

In order to achieve the purpose, the invention adopts the following technical scheme: the invention provides a targeted inhibitor of a ZFAS1 gene, which has the following gene sequence:

5'- GTGCCCACTTCAAGAATGTCA -3'（SEQ ID No.1）。

the ZFAS1 gene targeted inhibitor can inhibit a shRNA sequence expressed by the ZFAS1 gene, the shRNA template sequence comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are respectively:

a sense strand:

5'-CACCGTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTTTTTTG -3'（SEQ ID No.2）；

antisense strand:

5'-GATCAAAAAAGTGCCCACTTCAAGAATGTCATCTCTTGAATGACATTCTTGAAGTGGGCAC -3'（SEQ ID No.3）。

further, transcription product sequences of the shRNA described above were transcribed:

5'- GTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTT -3'（SEQ ID No.4）。

the ZFAS1 gene targeted inhibitor can open a hematoma barrier of glioma tissues and increase the permeability of the hematoma barrier.

The ZFAS1 gene targeted inhibitor is used for preparing a medicament for treating human brain glioma.

The drug for treating human brain glioma is a drug composition which comprises a therapeutic amount of ZFAS1 gene targeted inhibitor and a pharmaceutical carrier or excipient.

The inhibitor is any pharmaceutically and therapeutically acceptable dosage form, including injection, tablet, capsule, granule, suspension, emulsion, solution, sol, lyophilized powder for injection, mucilage, aerosol, microcapsule, microsphere, liposome, micelle, sustained release preparation or controlled release preparation, etc. The inhibitor is preferably in the form of injection.

Such carriers or excipients include diluents, binders, wetting agents, disintegrants, lubricants, glidants and the like as are well known in the art. Diluents include, but are not limited to, powders, dextrins, sucrose, glucose, lactose, mannitol, sorbitol, xylitol, dibasic calcium phosphate, and the like; the humectant includes water, ethanol, isopropanol, etc.; binders include, but are not limited to, starch slurry, dextrin, syrup, honey, glucose solution, acacia slurry, gelatin slurry, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, ethylcellulose, polyethylene glycol, and the like; disintegrants include, but are not limited to, dry starch, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, crospovidone, croscarmellose sodium, sodium carboxymethyl starch, sodium lauryl sulfate, and the like; lubricants and glidants include, but are not limited to, talc, silicon dioxide, polyethylene glycol, and the like.

The inhibitor is in any pharmaceutically acceptable dose.

The ZFAS1 gene targeted inhibitor can inhibit the expression of ZFAS1 so as to open a hematoma barrier and increase the permeability of the hematoma barrier.

When the ZFAS1 gene targeted inhibitor is cooperatively used with the traditional chemotherapeutic drug, the brain glioma disease is synergistically and effectively treated or prevented.

Compared with the prior art, the invention has the following technical effects.

1. The targeted inhibitor has strong specificity and inhibits the expression of ZFAS1 gene.

2. The ZFAS1 gene targeted inhibitor can increase the barrier permeability of the chemotherapy drug hematoma when used in cooperation with the traditional chemotherapy drug, and solves the problem of low drug concentration in the brain of the traditional treatment drug.

3. Experiments prove that the traditional Chinese medicine composition is applied to the in vitro cytology level, has definite treatment effect and does not have adverse reaction.

Drawings

Fig. 1 is a bar graph of long-chain non-coding ZFAS1 expression in normal endothelial cells (control group) and glioma endothelial cells (experimental group).

FIG. 2 is a bar graph showing the effect of trans-endothelial resistance measurement (A) and horseradish peroxidase permeability assay (B) on BTB permeability after application of ZFAS1 gene inhibitor.

FIG. 3 is an electrophoresis chart and a bar chart of Western blot detection of the effect on the expression of claudin after application of ZFAS1 gene inhibitor.

FIG. 4 is a diagram showing the change of expression and distribution of tight junction protein detected by immunofluorescence after ZFAS1 gene inhibitor is applied.

Detailed Description

The main technical scheme of the invention is as follows.

Design of shRNA and preparation of interference vectors.

And 2, verifying interference efficiency.

Transendothelial resistance measurement.

And 4, horseradish peroxidase permeability test.

5 . Western blot。

And 6, performing cell immunofluorescence experiment.

Example 1.

1. Establishment of a blood tumor barrier in vitro.

hCMEC/D3 cells were cultured in the upper chamber of a transwell chamber (collagen IV coating, 0.4 um poresize,12 mm diameter, costar, USA) and placed in 6-well plates; at the same time, human glioma U251 cells were seeded at a density of 20,000 cells/ml in wells of another 6-well plate.

Transferring the transwell chamber full of endothelial cells to the hole of a 6-pore plate seeded with human brain glioma U251 cells after the endothelial cells in the chamber grow to a monolayer, adding 1 ml of culture solution to the chamber, adding 2.5 ml of culture solution to the hole of the 6-pore plate, replacing the culture solution every other day, and culturing for 4 days

2. Real-time quantitative PCR detection of expression of ZFAS 1.

(1) Total RNA was extracted from the cells by Trizol method.

(1) Washing the collected cells with cold PBS, adding 1 ml Trizol reagent, blowing for several times, observing the cells under a mirror to form oil drops (fully cracking), then transferring into a 1.5 ml EP tube, and standing for 5 minutes to fully crack the cells; (2) adding 0.2 ml of chloroform into the sample, and manually and violently shaking the sample and standing the sample for 3 minutes at room temperature; (3) centrifuging at 12000g at 4 deg.C for 15min, collecting the upper water phase, adding 0.5 ml isopropanol, mixing, and standing at room temperature for 10 min; (4) centrifuging at 12000g at 4 deg.C for 15min, discarding supernatant, and adding 1 ml 75% ethanol; after centrifuging at 7500g for 5 minutes at 4 ℃ and drying for 15 minutes, 40. Mu.l of DEPC water is added, and the sample can be frozen in a refrigerator at-80 ℃.

(2) And detecting the expression of ZFAS1 by a one-step dye method qRT-PCR.

CT values were determined using GAPDH as internal reference and 2 ^-△△Ct The relative expression level of ZFAS1 is shown.

The expression level of the ZFAS1 gene in normal brain microvascular endothelial cells and glioma microvascular endothelial cells was detected (as shown in FIG. 1). Compared with the normal endothelial group, the expression of ZFAS1 in the experimental group is obviously increased, and the result indicates that ZFAS1 participates in the function regulation of brain glioma microvascular endothelial cells. Data represent mean ± standard deviation (n =3,. Times.p < 0.05).

3. Preparation and application of ZFAS1 gene inhibitor.

Designing an interference sequence of the ZPAS 1 gene, selecting a target human ZPAS 1 gene and specifically inhibiting the target gene sequence expressed by the ZPAS 1 gene as follows:

5'-GTGCCCACTTCAAGAATGTCA-3' the GTGCCCACTTCAAGAATGTCA sequence was inputted into the NCBI homology analysis nucleotide blast for alignment analysis, and the results showed that the sequence has no high homology with other human mRNA genes and can be used as a specific sequence for specifically interfering ZFAS1 gene.

The shRNA sequence which targets the human ZFAS1 gene and inhibits the expression of the ZFAS1 gene is designed according to the target sequence and comprises a sense strand and an antisense strand, wherein the shRNA sequence is as follows:

a sense strand:

5' -CACCGTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTTTTTTG -3'，

antisense strand:

5’-

GATCAAAAAAGTGCCCACTTCAAGAATGTCATCTCTTGAATGACATTCTTGAAGTGGGCAC -3'，

transcribing the transcript of the shRNA with the sequence:

5'-GTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTT -3'。

the sequence information is designed and synthesized into corresponding plasmids which are used as ZFAS1 gene inhibitors. Transfection of ZFAS1 gene inhibitor: the plasmids U6/GFP/Neo of sh-NC and sh-ZFEAS 1 silence expression of ZFEAS 1, and empty plasmids containing no ZFEAS 1 sequences or shRNA are used as experimental negative controls; culturing the vascular endothelial cells of the glioma by using a 24-hole culture plate, and transfecting when the cell growth reaches about 80%; plasmid, opti-MEM, required for the preparation of transfections ^® I and LTX and plus reagent (Life Technologies) transfection reagents. Tube A: one well was dissolved with 1. Mu.g of plasmid DNA in 50. Mu.l of Opti-MEM ^® I + 1. Mu. L p3000, left for 5 min: the wells were dissolved in 50. Mu.l of Opti-MEM according to 1. Mu.l of LTX and Plus ^® In the step I; mixing A, B tubes, standing for 5 min; sucking out the culture solution, adding 100 mu L of transfection mixed solution into each hole, and adding 400 mu L of EBM-2 culture solution; 48 After h, the cell line capable of stably silencing ZFAS1 is obtained after about 4 weeks by using a culture medium containing antibiotic G418 with the concentration of 0.4 mg/mL for screening and increasing the concentration of G418. In subsequent experiments, the groups were divided into 3 groups, each of which was: a normal group; a blank control group transfected with ZFAS1 silent empty plasmid; inhibitor groups transfected with ZFAS1 silencing plasmids.

4. Transendothelial resistance values of the normal group, the blank control group and the inhibitor group were measured, respectively.

Determination of transendothelial resistance values after establishment of the in vitro BTB model: the measurement is carried out by adopting a millicell-ERS system, firstly, a co-cultured cell culture plate is placed at 37 ℃ under a constant temperature condition, electrode plates are respectively placed on the inner side and the outer side of a small chamber, after the reading is stable, the result is respectively recorded, three different points are measured in each small chamber, the average number is taken, after the reading of a blank background is subtracted, the TEER value is calculated by multiplying the reading and the surface area of a Transwell small chamber, and the calculation unit is expressed by omega cm 2.

The experimental result is shown in fig. 2 (a), after detecting that the ZFAS1 gene inhibitor is applied, the transendothelial resistance value of the in vitro blood tumor barrier model is significantly reduced compared with the normal group and the blank control group; the in vitro BTB permeability is obviously increased after the ZFAS1 gene inhibitor is applied.

5. And (3) carrying out horseradish peroxidase permeation quantity experiments on a normal group, a blank control group and an inhibitor group.

After the in vitro BTB model was established, serum-free EBM-2 medium containing 0.5 umol/l horseradish peroxidase was added to the Transwell chamber of the in vitro BTB model. And collecting the culture solution in the lower chamber of the BTB model after 24h, measuring the content of HRP by using a microplate reader, drawing an HRP standard curve by using an HRP standard, and calculating the amount of HRP permeating into the lower chamber. HRP quantity = picomolar representation of HRP per hour per square centimeter of surface area.

The experimental result is shown in fig. 2 (B), after the ZFAS1 gene inhibitor is detected and applied, compared with a normal group and a blank control group, the in vitro blood tumor barrier model horseradish peroxidase permeability is obviously increased; the in vitro BTB permeability is obviously increased after the ZFAS1 gene inhibitor is applied.

6. And (3) Western blot.

(1) Collecting cells, adding RIPA protein lysate, shaking, standing on ice for 30min, and centrifuging at 12000g for 30min at 4 deg.C;

(2) Obtaining and collecting a supernatant and determining the protein concentration of the sample by using a BCA method;

(3) Mixing 40mg protein with 5 Xloading buffer (1:4), boiling for 5min for denaturation;

(4) Adding the denatured protein into 8-10% of SDS (sodium dodecyl sulfate) denatured polyacrylamide gel for electrophoresis separation;

(5) Film transfer: the voltage is 100V, the current is 120mA, and the voltage is 90min-200min;

(6) Sealing 5% skimmed milk for 2h;

(7) Diluting related antibody sealing membrane with an anti-dilution solution according to a certain proportion, and standing overnight at 4 ℃;

(8) Washing with TTBS for 5min for 3 times, adding corresponding secondary antibody, and incubating on a shaker at room temperature for 2h;

(9) ECL luminescence, photography, quality one software quantitative analysis.

The experimental result is shown in fig. 3, and after the ZFAS1 gene inhibitor is detected and applied, compared with a normal group and a blank control group, the expression levels of tumor vascular endothelial cell tight junction related proteins ZO-1, occludin and Claudin-5 in an in vitro blood tumor barrier model are obviously reduced.

7. Immunofluorescence.

Endothelial cells were seeded at 2000/cm2 density on 1.5% gelatin-coated coverslips. After 90% confluence, PBS three times each 5min, with 4% paraformaldehyde fixed for 30 minutes. PBS wash three times for 5min,5% BSA blocking for 15min, then incubation with the corresponding antibody overnight. PBS was washed three times for 5min each, then goat anti-rabbit fluorescent secondary antibody labeled with Cy3 was incubated for 30min in the dark, and nuclei were stained with DAPI according to 1:500 for 10min. PBS was washed three times for each 5min,50% glycerol mounting and visualized on the Olympus BX60 Upper Fluorescence System.

The results of the experiment are shown in FIG. 4: compared with a normal group and a blank control group, after the ZFAS1 gene inhibitor is detected and applied, the expression of tumor vascular endothelial cell tight junction related proteins ZO-1, occludin and Claudin-5 in an in vitro hematoma barrier model is changed from continuous distribution to discontinuous distribution.

Sequence listing

<110> Shengjing Hospital affiliated to Chinese medical university

<120> targeted inhibitor of ZFAS1 gene and application thereof

<160> 4

<210> 1

<211> 21

<212> DNA

<213> Artificial

<400> 1

GTGCCCACTTCAAGAATGTCA 21

<210> 2

<211> 21

<212> DNA

<213> Artificial

<400> 2

CACCGTGCCC ACTTCAAGAA TGTCATTCAA GAGATGACAT TCTTGAAGTG GGCACTTTTT TG 62

<210> 3

<211> 61

<212> DNA

<213> Artificial

<400> 3

GATCAAAAAA GTGCCCACTT CAAGAATGTC ATCTCTTGAA TGACATTCTT GAAGTGGGCA C 61

<210> 4

<211> 53

<212> DNA

<213> Artificial

<400> 4

GTGCCCACTT CAAGAATGTC ATTCAAGAGA TGACATTCTT GAAGTGGGCA CTT 53

Claims

1. The application of a target inhibitor of ZFAS1 gene in preparing a hematoma barrier of an open glioma tissue and a drug for increasing the permeability of the hematoma barrier is characterized in that the target inhibitor is a shRNA sequence for inhibiting the expression of the ZFAS1 gene, the shRNA template sequence comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are respectively:

sense strand:

5'-CACCGTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTTTTTTG -3'；

antisense strand:

5'-GATCAAAAAAGTGCCCACTTCAAGAATGTCATCTCTTGAATGACATTCTTGAAGTGGGCAC -3'。

2. the use according to claim 1, wherein the medicament is a pharmaceutical composition comprising a therapeutic amount of a ZFAS1 gene-targeted inhibitor and a pharmaceutical carrier or excipient.

3. The use according to claim 2, wherein the gene-targeted inhibitor is in any pharmaceutically and therapeutically acceptable dosage form, including injection, tablet, capsule, granule, suspension, emulsion, solution, sol, lyophilized powder for injection, mucilage, aerosol, microcapsule, microsphere, liposome, micelle, sustained release preparation or controlled release preparation.

4. The use according to claim 2, wherein the gene targeting inhibitor is in any pharmaceutically therapeutically acceptable dose.