CN110241118A - A kind of targeted inhibition agent of ZFAS1 gene and application thereof - Google Patents
A kind of targeted inhibition agent of ZFAS1 gene and application thereof Download PDFInfo
- Publication number
- CN110241118A CN110241118A CN201910552940.4A CN201910552940A CN110241118A CN 110241118 A CN110241118 A CN 110241118A CN 201910552940 A CN201910552940 A CN 201910552940A CN 110241118 A CN110241118 A CN 110241118A
- Authority
- CN
- China
- Prior art keywords
- zfas1
- gene
- targeted inhibition
- inhibition agent
- agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to pharmaceutical technology fields, and in particular to a kind of targeted inhibition agent of ZFAS1 gene and application thereof.A kind of targeted inhibition agent of ZFAS1 gene, the gene order of the targeted inhibition agent are 5'-GTGCCCACTTCAAGAATGTCA-3'.The inhibitor can be in conjunction with ZFAS1 gene specific, make ZFAS1 gene silencing, to inhibit the influence of ZFAS1 gene pairs blood tumor barrier permeability, the permeability for safely and effectively increasing blood tumor barrier, the classic chemotherapy drug concentration that can be improved in tumor tissues when using is cooperateed with classic chemotherapy drug.
Description
Technical field
The invention belongs to pharmaceutical technology fields, and in particular to a kind of targeted inhibition agent of ZFAS1 gene and application thereof.
Background technique
Glioma is the most common malignant tumour of cental system, accounts for the 50%-60% of primary brain tumors.Treatment hand at present
For section mainly based on operation, chemicotherapy is adjuvant treatment.But since glioma has the biological property of invasive growth,
And glioma rank is higher, and invasion is stronger, cuts entirely under iconography and microscope even if operation reaches, and recurrence is still difficult in institute
Exempt from.The operation of mainstream at present adds statistics after postoperative concurrent chemotherapy to show that its median survival interval is only 12 months, 5 years survival rate deficiencies
13%.High-grade glioma prognosis is worse, as glioblastoma multiforme (Glioblastoma multiforme,
GBMs curative effect) is still very poor, and existence median is still no more than 15 months.Due to weak curative effect, more and more researchers are caused
Power is in researching and developing new therapeutic agent for molecular target, including tumor markers, abnormal signal pathway, epigenetics gene
Expression regulation, tumor vessel inhibitor and immunotherapy of tumors etc..In the application process of above-mentioned therapeutic strategy, it is present in brain hair
Blood tumor barrier (blood tumor barrier, BTB) between thin vascular endothelial cell and tumour cell, greatly limits
Therapeutic agent enters tumor tissues, affects the treatment.The permeability of blood tumor barrier how is effectively increased, therapeutic agent choosing is promoted
Entering tumor tissues to selecting property is critical issue urgently to be resolved.
It is more than 200 nucleotide that long-chain non-coding RNA (long non-coding RNA, lncRNA), which is a kind of length,
Non-coding RNA transcript.The study found that LncRNA can regulate and control the generation and development of glioma.Some researches show that ZFAS1
Promote the proliferation and migration of stomach cancer cell, ZFAS1 is in the unconventionality expression of Non-Small Cell Lung Carcinoma, and research is reported recently, ZFAS1
The high expression in Colorectal Carcinoma, ovarian cancer tissue and melanoma tissue, thus ZFAS1 inhibitor is only limitted to above-mentioned swollen
It is used in tumor tissue.Not yet expression of the discovery ZFAS1 in glioma microvascular endothelial and to participate in blood tumor barrier penetrating at present
The regulation of property.
The principle of RNA perturbation technique is that RNA molecule is cut using Dicer digestion, forms RNA silencing complex, and targeting combines
The process of target RNA molecule and then degradation of rna molecule.The present invention is desirable with the inhibition that RNA perturbation technique develops ZFAS1 gene
Agent plays a role in glioma field of gene.
It is had not been reported currently, ZFAS1 influences glioma blood tumor barrier related mechanism, about ZFAS1 in glioma base
Because blank out is gone back in the application for the treatment of aspect at present.Therefore, developing a kind of relevant drug of ZFAS1 becomes urgently to be resolved at present
Problem.
Summary of the invention
The present invention is the experiment proved that ZFAS1 gene inhibits the expression of ZFAS1 that can open in glioma high expression in the tissue
Bloodletting tumor barrier increases the permeability of blood tumor barrier, the drug concentration in tumor tissues is improved, to improve glioma
Chemotherapeutic efficacy.
It is an object of the invention to utilize RNA perturbation technique, design and provide a kind of ZFAS1 gene target inhibitor and its
Purposes, which can make ZFAS1 gene silencing in conjunction with ZFAS1 gene specific, to inhibit ZFAS1 gene pairs hemotoncus
The influence of tumor Barrier Permeability achievees the purpose that treat glioma.
To achieve the goals above, the invention adopts the following technical scheme: the present invention provides a kind of targets of ZFAS1 gene
To inhibitor, the gene order of the targeted inhibition agent are as follows:
5'- GTGCCCACTTCAAGAATGTCA -3'(SEQ ID No.1).
The targeted inhibition agent of the ZFAS1 gene is able to suppress the shRNA sequence of ZFAS1 gene expression, the shRNA mould
Plate sequence includes positive-sense strand and antisense strand, and the positive-sense strand and antisense strand are respectively as follows:
Positive-sense strand:
5'-CACCGTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGC ACTTTTTTG -3'(SEQ
ID No.2)；
Antisense strand:
5'-GATCAAAAAAGTGCCCACTTCAAGAATGTCATCTCTTGAATGACATTCTTGAA GTGGGCAC -3'(SEQ
ID No.3).
Further, the transcription product sequence of above-mentioned shRNA is transcribed:
5'- GTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTT -3'(SEQ ID
No.4).
The ZFAS1 gene target inhibitor can open the blood tumor barrier of samples of human glioma, increase blood tumor barrier
Permeability.
The ZFAS1 gene target inhibitor is used to prepare the purposes for the treatment of human glioma drug.
The treatment human glioma drug is the ZFAS1 gene target inhibitor containing therapeutic dose and carrier pharmaceutically
Or the pharmaceutical composition of excipient composition.
The inhibitor is acceptable dosage form in any pharmacotherapeutics, including injection, tablet, capsule, particle
Agent, suspension, emulsion, solution, glue, freeze drying powder injection, mucilage, aerosol, micro-capsule, microballoon, liposome, micella,
Sustained release preparation or controlled release preparation etc..The preferred dosage form of the inhibitor is ejection preparation.
The carrier or excipient include diluent well known in the art, adhesive, wetting agent, disintegrating agent, lubricant, help
Flow agent etc..Diluent includes but is not limited to powder, dextrin, sucrose, glucose, lactose, mannitol, sorbierite, xylitol, phosphoric acid hydrogen
Calcium etc.；Wetting agent includes water, ethyl alcohol, isopropanol etc.；Adhesive includes but is not limited to starch slurry, dextrin, syrup, honey, grape
Sugar juice, mucialga of arabic gummy, gelatine size, sodium carboxymethylcellulose, hydroxypropyl methyl cellulose, ethyl cellulose, polyethylene glycol
Deng；Disintegrating agent include but is not limited to dried starch, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, crosslinked polyvinylpyrrolidone,
Croscarmellose sodium, sodium carboxymethyl starch, dodecyl sodium sulfate etc.；Lubricant and glidant include but is not limited to slide
Mountain flour, silica, polyethylene glycol etc..
The inhibitor is dosage acceptable in any pharmacotherapeutics.
The ZFAS1 gene target inhibitor is able to suppress the expression of ZFAS1 to open blood tumor barrier, increases blood
The permeability of tumor barrier.
When the ZFAS1 gene target inhibitor collaboration is used in conjunction with classic chemotherapy drug, effectively treatment or pre- is cooperateed with
Anti- treating brain glioma disease.
Compared with prior art, the present invention has the following technical effect that.
1, targeted inhibition agent high specificity of the present invention inhibits the expression of ZFAS1 gene.
2, ZFAS1 gene target inhibitor, collaboration classic chemotherapy drug lead in use, increasing chemotherapeutics blood tumor barrier
Permeability solves the problems, such as the low in intracerebral drug concentration of traditional treatment drug.
3, experiment is proved to apply in cytology level in vitro, and therapeutic effect is definite, has no adverse reaction.
Detailed description of the invention
Fig. 1 is long-chain non-coding ZFAS1 in normal endothelial cell (control group) and glioma endothelial cell (experimental group)
Expression column diagram.
Fig. 2 be using ZFAS1 gene inhibitor after, across transendothelial electrical resistance value measurement (A) and the penetrating amount reality of horseradish peroxidase
Test influence column diagram of the detection (B) to BTB permeability.
Fig. 3 be using ZFAS1 gene inhibitor after, Western blot detects the influence to the expression of tight junction protein
Electrophoretogram and column diagram.
Fig. 4 be using ZFAS1 gene inhibitor after, Immunofluorescence test tight junction protein expression with distribution change
Figure.
Specific embodiment
The main technical scheme is that.
The design of 1, shRNA and the preparation of interference carrier.
The verifying of 2, jamming effectiveness.
Across the transendothelial electrical resistance value measurement of 3,.
The penetrating amount experiment of 4, horseradish peroxidases.
5 . Western blot。
The experiment of 6, cellular immunofluorescences.
Embodiment 1.
One, the foundation of external blood tumor barrier.
By hCMEC/D3 cell culture, (collagen IV is coated with, 0 .4 um in the upper chamber of the cell transwell
Poresize, 12 mm diameter, Costar, USA), it is put into 6 orifice plates；Simultaneously by human glioma U251 cell with
The density of 20,000 cells/mls is planted in the hole of another 6 orifice plates.
Single layer is covered with to small indoor endothelial cell, the cell transwell for covering with endothelial cell, which is transferred to kind, human brain
In the hole of the 6 orifice plates of glioma U251 cell, cell gives 1 milliliter of culture solution, and culture solution 2 .5 milli is given in the hole of 6 orifice plates
It rises, the culture solution every other day more renewed, co-cultures 4 days
Two, the expression of real-time quantitative PCR detection ZFAS1.
(1) Trizol method extracts the total serum IgE in cell.
1. washing the cell collected with cold PBS, the piping and druming of 1 ml Trizol reagent is added for several times, microscopic observation cell is at oil
Drop-wise (sufficiently cracking), it is rear to move into 1 .5 ml EP pipe, 5 minutes are stood, cracks it sufficiently；2. 0 is added into sample
.2ml chloroform, acutely concussion stands 3 minutes at room temperature manually；3. being centrifuged 15 minutes in 4 DEG C of 12000g, take upper strata aqueous phase to newly
EP pipe in, add 0 .5 ml isopropanol, mixing of turning upside down stands 10 minutes at room temperature；4. 4 DEG C of 12000g centrifugations 15
Supernatant is abandoned after minute, and 1 ml, 75% ethyl alcohol is added；4 DEG C of 7500g are centrifuged 5 minutes, and 40 μ l DEPC are added after 15 minutes dry
Water, sample can freeze in -80 DEG C of refrigerators.
The expression of (2) one step dye method qRT-PCR detection ZFAS1.
CT value is measured, using GAPDH as internal reference, with 2-△△CtIndicate the relative expression quantity of ZFAS1.
Detect expression of the ZFAS1 gene in normal brain microvessel endothelial cells in vitro and glioma microvascular endothelial cells
(as shown in Figure 1).Compared with normal endothelial group, expression of the ZFAS1 in experimental group is dramatically increased, this result prompts ZFAS1
Participate in the function controlling to glioma microvascular endothelial cells.Data indicate mean+SD (P < 0 n=3, *
.05)。
Three, the preparation and application of ZFAS1 gene inhibitor.
The interference sequence of ZFAS1 gene is designed, targeting people ZFAS1 gene is selected and specificity inhibits ZFAS1 gene expression
Target-gene sequence it is as follows:
5'- GTGCCCACTTCAAGAATGTCA -3 ' is in the same original sequence alignment analysis nucleotide blast of NCBI
Input GTGCCCACTTCAAGAATGTCA sequence is compared, the results showed that other mRNA genes of the sequence and people do not have
There is high homology, the specific sequence of specificity interference ZFAS1 gene can be made.
Targeting people ZFAS1 gene is designed for the above target sequence and inhibits the shRNA sequence of ZFAS1 gene expression as follows,
Including positive-sense strand and antisense strand, this shRNA sequence are as follows:
Positive-sense strand:
5'-CACCGTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGC ACTTTTTTG -3',
Antisense strand:
5 '-GATCAAAAAAGTGCCCACTTCAAGAATGTCATCTCTTGAATGACATTCTTGAAGTG GGCAC -3',
Transcribe the transcription product of above-mentioned shRNA, sequence are as follows:
5'-GTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTT -3'。
The above sequence information is designed and synthesized into corresponding plasmid, as ZFAS1 gene inhibitor.ZFAS1 gene inhibitor
Transfection: the plasmid U6/GFP/Neo of sh-NC, sh-ZFAS1 make ZFAS1 expression silencing, without containing ZFAS1 sequence or shRNA
Empty plasmid is experiment negative control；Using the vascular endothelial cell of 24 well culture plate culture gliomas, when cell growth reaches 80%
It is transfected when left and right；Plasmid, the Opti-MEM that configuration transfection needs®I and LTX andPlus reagent (Life
Technologies) transfection reagent.A pipe: a hole is dissolved in 50 μ l Opti-MEM according to 1 μ g Plasmid DNA®Ⅰ+1μl
P3000 places 5 min, and B pipe: hole is dissolved in 50 μ l Opti-MEM according to 1 μ l LTX and Plus®In I；A, B two is managed
5 min are stood after mixing；Culture solution is sucked out, every hole is added 100 μ L of transfection cocktail, adds 400 μ L of EBM-2 culture solution；
It is screened after 48 h with containing the culture medium that concentration is 0 .4 mg/mL antibiotic G418, is continuously increased the concentration of G418, greatly
Obtain to stablize the cell line of silencing ZFAS1 after about 4 weeks.It is divided into 3 groups in subsequent experimental, is respectively: normal group；Transfection
The blank control group of ZFAS1 silencing empty plasmid；Transfect the inhibitor group of ZFAS1 silencing plasmid.
Four, normal group is measured respectively, blank control group and across the transendothelial electrical resistance value of inhibitor group.
After establishing external BTB model, the measurement across transendothelial electrical resistance value: millicell-ERS system measurement is used, first will
For the tissue culture plate of co-cultivation in the case where 37 °C are placed in constant temperature, electrode slice is respectively put into the interior outside of cell, stable reading
Afterwards, respectively record as a result, each cell measure three different points, be averaged, after the reading for subtracting blank background, TEER value
It is calculated as reading the calculating that is multiplied with the surface area of the cell Transwell, unit of account is indicated with Ω cm2.
Experimental result is as shown in Figure 2 (A) shows, after ZFAS1 gene inhibitor is applied in detection, relative to normal group and blank control
Across the transendothelial electrical resistance value of group, external blood tumor barrier model is remarkably decreased；After ZFAS1 gene inhibitor is applied in prompt, external BTB
Permeability dramatically increases.
Five, normal group, blank control group and the penetrating amount of inhibitor group horseradish peroxidase are tested.
After establishing external BTB model, the cell Transwell of external BTB model, which is added, contains 0 .5umol/l horseradish mistake
The serum-free EBM-2 culture medium of oxide enzyme.Collect the culture solution under BTB model in room afterwards for 24 hours, microplate reader measures HRP content,
HRP standard items curve is drawn with HRP standard items, calculates the HRP amount for penetrating into lower room.The surface every square centimeter of HRP amount=per hour
The picomole number of long-pending HRP indicates.
Shown in experimental result such as Fig. 2 (B), after ZFAS1 gene inhibitor is applied in detection, relative to normal group and blank control
Group, the external penetrating amount of blood tumor barrier model horseradish peroxidase dramatically increase；After ZFAS1 gene inhibitor is applied in prompt, body
Outer BTB permeability dramatically increases.
Six, Western blot.
(1) cell is collected, RIPA protein lysate is added, concussion shakes up, and 30min is stood on ice, under the conditions of 4 °C
12000g is centrifuged 30min；
(2) obtain and collect supernatant and using the protein concentration of BCA method measurement sample；
(3) it takes 40mg albumen to mix (1:4) with 5x sample-loading buffer, boils 5min denaturation；
(4) the SDS denaturing polyacrylamide gel electrophoresis that 8-10% is not waited is added in albuminate to separate；
(5) transferring film: voltage 100V, electric current 120mA, 90min-200min；
(6) 5% skim milks close 2h；
(7) primary antibody dilution dilutes associated antibodies sealer with certain proportion, and 4 °C overnight；
(8) TTBS washes 5min, 3 times, adds corresponding secondary antibody, is incubated for 2h on room temperature shaker；
(9) ECL shines, photograph, quantity one software quantitative analysis.
Experimental result as shown in figure 3, detection using after ZFAS1 gene inhibitor, relative to normal group and blank control group,
Tumor vascular endothelial cell closely connects GAP-associated protein GAP ZO-1, Occlud in, Claudin-5 in external blood tumor barrier model
Expression significantly lower.
Seven, immunofluorescence.
Endothelial cell is inoculated on the coated coverslip of 1.5% gelatin with 2000/cm2 density.After reaching 90% fusion, PBS
Three times each 5min are washed, fix 30 minutes with 4% paraformaldehyde.PBS washes three times each 5min, and 5%BSA closes 15min, then with
Corresponding antibody incubation is stayed overnight.PBS washes three times each 5min, and the goat antirabbit fluorescence secondary antibody then marked with Cy3 is protected from light incubation
30min, nucleus are diluted dyeing 10min according to 1:500 with DAPI.PBS washes three times each 5min, and 50% glycerol mounting is simultaneously
It is observed in Olympus BX60 Upright Fluorescence system.
Experimental result is as shown in Figure 4: relative to normal group and blank control group, after ZFAS1 gene inhibitor is applied in detection,
Tumor vascular endothelial cell closely connects GAP-associated protein GAP ZO-1, Occludin, Claudin-5 in external blood tumor barrier model
Expression becomes discontinuity distribution from continuity distribution.
Sequence table
<110>attached Shengjing city hospital, Chinese Medical Sciences University
<120>a kind of targeted inhibition agent of ZFAS1 gene and application thereof
<160> 4
<210> 1
<211> 21
<212> DNA
<213> Artificial
<400> 1
GTGCCCACTTCAAGAATGTCA 21
<210> 2
<211> 21
<212> DNA
<213> Artificial
<400> 2
CACCGTGCCC ACTTCAAGAA TGTCATTCAA GAGATGACAT TCTTGAAGTG GGCACTTTTT TG 62
<210> 3
<211> 61
<212> DNA
<213> Artificial
<400> 3
GATCAAAAAA GTGCCCACTT CAAGAATGTC ATCTCTTGAA TGACATTCTT GAAGTGGGCA C 61
<210> 4
<211> 53
<212> DNA
<213> Artificial
<400> 4
GTGCCCACTT CAAGAATGTC ATTCAAGAGA TGACATTCTT GAAGTGGGCA CTT 53
Claims (9)
1. a kind of targeted inhibition agent of ZFAS1 gene, which is characterized in that the gene order of the targeted inhibition agent are as follows:
5'- GTGCCCACTTCAAGAATGTCA -3'。
2. the targeted inhibition agent of ZFAS1 gene according to claim 1, which is characterized in that the targeted inhibition agent can
Inhibit the shRNA sequence of ZFAS1 gene expression, the shRNA template sequence includes positive-sense strand and antisense strand, the positive-sense strand and
Antisense strand is respectively as follows:
Positive-sense strand:
5'-CACCGTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTTTTTTG -3'；
Antisense strand:
5'-GATCAAAAAAGTGCCCACTTCAAGAATGTCATCTCTTGAATGACATTCTTGAAGTGGGCAC -3'。
3. the targeted inhibition agent of ZFAS1 gene according to claim 1, which is characterized in that the transcription shRNA sequence
Transcription product, sequence are as follows:
5'- GTGCCCACTTCAAGAATGTCATTCAAGAGATGACATTCTTGAAGTGGGCACTT -3'。
4. the targeted inhibition agent of ZFAS1 gene according to claim 1-3, which is characterized in that the ZFAS1 base
Because targeted inhibition agent can open the blood tumor barrier of samples of human glioma, increase the permeability of blood tumor barrier.
5. the targeted inhibition agent of ZFAS1 gene according to claim 1-3 is used to prepare treatment human glioma
Purposes in drug.
6. purposes according to claim 5, which is characterized in that the treatment human glioma drug is to contain therapeutic dose
The pharmaceutical composition of ZFAS1 gene target inhibitor and carrier or excipient composition pharmaceutically.
7. purposes according to claim 5, which is characterized in that the gene target inhibitor is in any pharmacotherapeutics
Acceptable dosage form, including injection, tablet, capsule, granule, suspension, emulsion, solution, glue, freeze-dried powder
Agent, mucilage, aerosol, micro-capsule, microballoon, liposome, micella, sustained release preparation or controlled release preparation etc., preferred dosage form are injection system
Agent.
8. purposes according to claim 5, which is characterized in that the gene target inhibitor is in any pharmacotherapeutics
Acceptable dosage.
9. ZFAS1 gene target inhibitor according to claim 1-4, which is characterized in that the ZFAS1 gene
When targeted inhibition agent and classic chemotherapy drug are used in conjunction with, collaboration effectively treats or prevents treating brain glioma disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910552940.4A CN110241118B (en) | 2019-06-25 | 2019-06-25 | Targeting inhibitor of ZFAS1 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910552940.4A CN110241118B (en) | 2019-06-25 | 2019-06-25 | Targeting inhibitor of ZFAS1 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110241118A true CN110241118A (en) | 2019-09-17 |
| CN110241118B CN110241118B (en) | 2023-04-18 |
Family
ID=67889282
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910552940.4A Active CN110241118B (en) | 2019-06-25 | 2019-06-25 | Targeting inhibitor of ZFAS1 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110241118B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661509A (en) * | 2017-10-23 | 2018-02-06 | 中国医科大学附属盛京医院 | A kind of targeted inhibition agent of linc00673 genes and application thereof |
| CN107753956A (en) * | 2017-10-23 | 2018-03-06 | 中国医科大学附属盛京医院 | A kind of targeted inhibition agent of RAX2 genes and application thereof |
-
2019
- 2019-06-25 CN CN201910552940.4A patent/CN110241118B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661509A (en) * | 2017-10-23 | 2018-02-06 | 中国医科大学附属盛京医院 | A kind of targeted inhibition agent of linc00673 genes and application thereof |
| CN107753956A (en) * | 2017-10-23 | 2018-03-06 | 中国医科大学附属盛京医院 | A kind of targeted inhibition agent of RAX2 genes and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| GONGLI YANG等: "ZFAS1 knockdown inhibits viability and enhances cisplatin cytotoxicity by up‐regulating miR‐432‐5p in glioma cells", 《BASIC CLIN PHARMACOL TOXICOL》 * |
| KAI GAO等: "Long non-coding RNA ZFAS1 is an unfavourable prognostic factor and promotes glioma cell progression by activation of the Notch signaling pathway", 《BIOMEDICINE & PHARMACOTHERAPY》 * |
| QIAO-LI LV等: "Upregulation of long noncoding RNA zinc finger antisense 1 enhances epithelial–mesenchymal transition in vitro and predicts poor prognosis in glioma", 《TUMOR BIOLOGY》 * |
| 徐艳雪等: "p53相关长链非编码RNA在肿瘤发生发展中作用的研究", 《安徽医药》 * |
| 苏伟杰等: "长链非编码RNA与脑胶质瘤发生发展的研究进展", 《中国微侵袭神经外科杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110241118B (en) | 2023-04-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dai et al. | AHIF promotes glioblastoma progression and radioresistance via exosomes | |
| Fang et al. | MicroRNA‐29b suppresses tumor angiogenesis, invasion, and metastasis by regulating matrix metalloproteinase 2 expression | |
| Sun et al. | Beclin1 overexpression inhibitis proliferation, invasion and migration of CaSki cervical cancer cells | |
| Huang et al. | STAT3-targeting RNA interference inhibits pancreatic cancer angiogenesis in vitro and in vivo | |
| CN107586781B (en) | Liver cancer marker lncRNA ENST00000620463.1 and application thereof | |
| Zhou et al. | MicroRNA‐195 suppresses the progression of lung adenocarcinoma by directly targeting apelin | |
| CN107661509A (en) | A kind of targeted inhibition agent of linc00673 genes and application thereof | |
| Zhang et al. | lncRNA LINC01296 promotes oral squamous cell carcinoma development by binding with SRSF1 | |
| CN109321656B (en) | Use of protein DEPDC1 as marker for diagnosing triple-negative breast cancer | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN109988765A (en) | A kind of targeted inhibition agent of FENDRR gene and application thereof | |
| Wu et al. | Long non-coding RNA SNHG1 promotes fibroblast-to-myofibroblast transition during the development of pulmonary fibrosis induced by silica particles exposure | |
| Wen et al. | Influences of S100A8 and S100A9 on proliferation of nasopharyngeal carcinoma cells through PI3K/Akt signaling pathway | |
| CN103966334B (en) | The application of CSF2RB gene in prostate cancer with osseous metastasis | |
| CN107523566B (en) | Targeting inhibitor of MCM3AP-AS1 gene and application thereof | |
| CN110241118A (en) | A kind of targeted inhibition agent of ZFAS1 gene and application thereof | |
| CN110628791B (en) | Application of tRNA (transfer RNA) modified enzyme gene in non-small cell lung cancer | |
| Fan et al. | SEC61G promotes cervical cancer proliferation by activating MAPK signaling pathway | |
| CN102747083B (en) | Application of splicing factor oncoprotein SF2/ASF in preparation of medicines used for treating leukemia | |
| Xu et al. | ApoM suppresses kidney renal clear cell carcinoma growth and metastasis via the Hippo-YAP signaling pathway | |
| CN101948544A (en) | FAT10 gene siRNA recombination analogue virus as well as preparation method and application thereof | |
| CN109939122B (en) | Application of substance for regulating and controlling one-carbon metabolism to influence dryness of tumor stem cells | |
| CN105671195B (en) | Purposes, pharmaceutical composition and the kit of miR-520c nucleotide | |
| WO2021037265A1 (en) | Sirna capable of inhibiting expression of mcm7 gene, composition, and application thereof | |
| WO2021037264A1 (en) | Sirna for inhibiting mcm7 gene expression, composition and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |