CN109988765B - Targeting inhibitor of FENDRR gene and application thereof - Google Patents

Targeting inhibitor of FENDRR gene and application thereof Download PDF

Info

Publication number
CN109988765B
CN109988765B CN201910250556.9A CN201910250556A CN109988765B CN 109988765 B CN109988765 B CN 109988765B CN 201910250556 A CN201910250556 A CN 201910250556A CN 109988765 B CN109988765 B CN 109988765B
Authority
CN
China
Prior art keywords
fendrr
gene
inhibitor
glioma
targeted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910250556.9A
Other languages
Chinese (zh)
Other versions
CN109988765A (en
Inventor
李新星
孙寒雪
郑继慧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shengjing Hospital of China Medical University
Original Assignee
Shengjing Hospital of China Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shengjing Hospital of China Medical University filed Critical Shengjing Hospital of China Medical University
Priority to CN201910250556.9A priority Critical patent/CN109988765B/en
Publication of CN109988765A publication Critical patent/CN109988765A/en
Application granted granted Critical
Publication of CN109988765B publication Critical patent/CN109988765B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a targeted inhibitor of a FENDRR gene and application thereof. The invention provides a targeted inhibitor of FENDRR gene, the gene sequence of the targeted inhibitor is 5-.

Description

Targeting inhibitor of FENDRR gene and application thereof
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a targeted inhibitor of a FENDRR gene and application thereof.
Background
Brain glioma is a primary intracranial tumor of high malignancy. Current conventional therapies include surgery, chemotherapy, and radiation therapy. Due to poor therapeutic efficacy, more and more researchers are working on developing new therapeutic drugs against molecular targets, including tumor markers, aberrant signaling pathways, epigenetic gene expression regulation, tumor angiogenesis inhibitors, and tumor immunotherapy, etc. In the application of the above therapeutic strategies, the presence of a Blood Tumor Barrier (BTB) between brain capillary endothelial cells and tumor cells greatly limits the therapeutic drugs from entering the tumor tissue, affecting the therapeutic efficacy. How to effectively increase the permeability of the blood tumor barrier and promote the therapeutic drugs to selectively enter the tumor tissues is a key problem to be solved urgently.
Long non-coding RNAs (lncrnas) are a class of non-coding RNA transcripts that are greater than 200 nucleotides in length. Research shows that LncRNA can regulate the generation and development of glioma. Research shows that FENDRR promotes the transfer of gastric cancer cells. The research reports that FENDRR is highly expressed in lung cancer tissues and gallbladder cancer tissues. The expression of FENDRR in the microvascular endothelium of glioma and the involvement in the regulation of the barrier permeability of hemangiomas have not been found. In the early stage, the expression level of FENDRR was detected by real-time PCR. The results show that the expression level of FENDRR in brain glioma microvascular endothelial cells is significantly higher than that of a normal control group, and the results suggest that FENDRR may be involved in the functional regulation and control of brain glioma microvascular endothelial cells.
The principle of RNA interference technology is the process of utilizing Dicer enzyme to cut RNA molecules, forming an RNA silencing complex, combining target RNA molecules in a targeted mode and further degrading the RNA molecules. The invention develops the inhibitor of the FENDRR gene by using an RNA interference technology, and plays a role in the field of glioma gene therapy.
At present, the mechanism related to the influence of FENDRR on glioma hematoma barrier is not reported, and the application of FENDRR in glioma gene therapy is still blank. Therefore, the development of a drug related to FENDRR is a problem to be solved urgently.
Disclosure of Invention
Experiments prove that the FENDRR gene is highly expressed in glioma tissues, and inhibition of the expression of FENDRR can open a hematoma barrier, increase the permeability of the hematoma barrier and improve the drug concentration in tumor tissues, so that the chemotherapy curative effect of brain glioma is improved.
The invention aims to design and provide a FENDRR gene targeted inhibitor and application thereof by utilizing an RNA interference technology, wherein the inhibitor can be specifically combined with a FENDRR gene to silence the FENDRR gene, so that the influence of the FENDRR gene on the permeability of a hematoma barrier is inhibited, the permeability of the hematoma barrier is increased by a safe and effective method, the drug concentration in a tumor tissue is increased, the chemotherapy curative effect of brain glioma is improved, the purpose of treating glioma is achieved, and a new thought and a new treatment method are provided for the gene therapy of glioma.
In order to achieve the above object, the present invention adopts the following technical solutions.
A targeted inhibitor of the FENDRR gene, the gene sequence of the targeted inhibitor is as follows:
5’-GGAGGCAGACATTGGAGAAAT-3’（SEQ ID No. 1）。
further, the targeting agent can inhibit shRNA sequence of FENDRR gene, the shRNA template sequence comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are respectively:
sense strand:
5' -CACCACCTCGGAGGCAGACATTGGAGAAATTCAAGAGATTTCTCCAATGTCTGCCTCCTT -3'（SEQ ID No. 2）。
antisense strand:
5’-
GATCAAGGAGGCAGACATTGGAGAAATCTCTTGAATTTCTCCAATGTCTGCCTCCGAGGT-3'（SEQ ID No. 3）。
further, transcription product sequences of the shRNA as described above were transcribed:
5' -ACCTCGGAGGCAGACATTGGAGAAATTCAAGAGATTTCTCCAATGTCTGCCTC-3'（SEQ ID No. 4）。
preferably, the inhibitor is in any pharmaceutically therapeutically acceptable dosage form.
Preferably, the inhibitor is in the form of an injection.
Preferably, the inhibitor is in any pharmaceutically therapeutically acceptable dose.
An application of a FENDRR gene inhibitor in preparing a medicament for treating human brain glioma.
Compared with the prior art, the invention has the following technical effects.
1. The targeted inhibitor has strong specificity and inhibits the expression of the FENDRR gene.
2. The FENDRR gene inhibitor is used for targeted therapy, is cooperated with the traditional chemotherapeutic drug, increases the blood and tumor barrier permeability of the chemotherapeutic drug, and can remarkably reduce the problem of low drug concentration in the brain of the traditional therapeutic drug.
3. Experiments prove that the traditional Chinese medicine composition is applied to the in vitro cytology level, has definite treatment effect and does not have adverse reaction.
4. The FENDRR gene inhibitor targeted therapy can improve the chemotherapy curative effect of the glioma, achieve the purpose of treating the glioma, and provide a new thought and a new treatment method for the gene therapy of the glioma.
Drawings
FIG. 1 is a bar graph showing the expression of long non-coding FENDRR genes in normal endothelial cells (control group) and glioma endothelial cells (experimental group).
FIG. 2 is a bar graph showing the effect of transendothelial resistance measurement (A) and horseradish peroxidase permeability assay (B) on BTB permeability after FENDRR gene inhibitor was applied.
FIG. 3 is an electrophoresis and bar graph of Western blot analysis of the effect of FENDRR gene inhibitor on the expression of claudin.
FIG. 4 is a photograph showing the change in expression and distribution of claudin detected by immunofluorescence after application of a FENDRR gene inhibitor.
Detailed Description
The main technical scheme of the invention is as follows.
Design of shRNA and preparation of interference vectors.
And 2, verifying interference efficiency.
Transendothelial resistance measurement.
And 4, horseradish peroxidase permeability test.
5 . Western blot。
And 6, performing cell immunofluorescence experiment.
Examples
1. Establishment of an in vitro haematoma barrier.
hCMEC/D3 cells were cultured in the upper chamber of a transwell chamber (collagen IV coating, 0.4 um porasize, 12 mm diameter, costar, USA) and placed in 6-well plates; simultaneously, human brain glioma U251 cells were seeded at a density of 20000 cells/ml in the wells of another 6-well plate. And (3) transferring the transwell chamber full of the endothelial cells to a hole of a 6-hole plate seeded with human brain glioma U251 cells after the endothelial cells in the chamber grow to be full of a monolayer, giving 1 ml of culture solution to the chamber, giving 2.5 ml of culture solution to the hole of the 6-hole plate, and replacing new culture solution every other day for culturing for 4 days.
2. Real-time quantitative PCR was used to detect FENDRR expression.
(1) Total RNA was extracted from the cells by Trizol method.
(1) The collected cells were washed with cold PBS, blown several times with 1 ml Trizol reagent, and the cells were observed under the microscope to be in the form of oil droplets (fully lysed), transferred to a 1.5 ml EP tube, and left to stand for 5 minutes to be fully lysed.
(2) To the sample was added 0.2 ml of chloroform, and the mixture was allowed to stand at room temperature for 3 minutes by manual vigorous shaking.
(3) Centrifuging at 12000g at 4 deg.C for 15min, adding the upper aqueous phase into a new EP tube, adding 0.5 ml isopropanol, mixing by turning upside down, and standing at room temperature for 10min.
(4) Centrifuging at 12000g at 4 deg.C for 15min, removing supernatant, and adding 1 ml 75% ethanol; after centrifugation at 7500g for 5 minutes at 4 ℃ and drying for 15 minutes, 40. Mu.l of DEPC water was added and the samples were frozen in a freezer at-80 ℃.
(2) And detecting the expression of FENDRR by a one-step dye method qRT-PCR.
CT values were determined using GAPDH as internal reference and 2 -△△Ct The relative expression level of FENDRR was shown.
The expression level of the FENDRR gene in normal brain microvascular endothelial cells and glioma microvascular endothelial cells was examined (as shown in FIG. 1). The expression of FENDRR in the experimental group was significantly increased compared to the normal endothelial group. Data represent mean ± standard deviation (n =3,. Times.p < 0.05).
3. Preparation and application of FENDRR gene inhibitor.
Designing an interference sequence of the FENDRR gene, selecting a target gene sequence which targets the human FENDRR gene and specifically inhibits the FENDRR gene expression as follows:
5 'GGAGGCAGACATTGGAGAAAT-3' GGAGGCAGACATTGGAGAAAT sequence is input in the homologous sequence alignment analysis nucleotide blast of NCBI for alignment analysis, and the result shows that the sequence has no high homology with other human mRNA genes and can be used as a specific sequence for specifically interfering the FENDRR gene.
The shRNA sequence which targets the human FENDRR gene and inhibits the FENDRR gene expression is designed aiming at the target sequence and comprises a sense strand and an antisense strand, and the shRNA sequence is as follows:
a sense strand:
5' -CACCACCTCGGAGGCAGACATTGGAGAAATTCAAGAGATTTCTCCAATGTCTGCCTCCTT -3'。
antisense strand:
5’-
GATCAAGGAGGCAGACATTGGAGAAATCTCTTGAATTTCTCCAATGTCTGCCTCCGAGGT-3'。
transcribing the transcription product of the shRNA with the sequence as follows:
5' -ACCTCGGAGGCAGACATTGGAGAAATTCAAGAGATTTCTCCAATGTCTGCCTC-3'。
the sequence information is designed and synthesized into corresponding plasmids which are used as FENDRR gene inhibitors. FENDRR gene inhibitor transfection: the sh-NC and sh-FENDRR plasmids U6/GFP/Neo silence FENDRR expression, and empty plasmids without FENDRR sequences or shRNA are used as experimental negative controls; culturing the vascular endothelial cells of the glioma by using a 24-hole culture plate, and transfecting when the cell growth reaches about 80%; plasmid, opti-MEM, required for the preparation of transfections ® I and LTX and plus reagent (Life Technologies) transfection reagents. Tube A: one well was dissolved in 50. Mu.l of Opti-MEM as 1. Mu.g of plasmid DNA ® I + 1. Mu.l p3000, left for 5 min: the wells were dissolved in 50. Mu.l of Opti-MEM according to 1. Mu.l of LTX and Plus ® In the step I; mixing the tube A and the tube B uniformly, and standing for 5 min; sucking out the culture solution, adding 100 mu L of transfection mixed solution into each hole, and adding 400 mu L of EBM-2 culture solution; 48 After h, the medium containing the antibiotic G418 with the concentration of 0.4 mg/mL is used for screening, the concentration of the G418 is increased continuously, and a cell line capable of stably silencing MCM3AP-AS1 is obtained after about 4 weeks. In subsequent experiments, the groups were divided into 3 groups, each of which was: is justPerforming common combination; a blank control group transfected with FENDRR silent empty plasmid; inhibitor groups transfected with FENDRR silencing plasmids.
4. Transendothelial resistance values of the normal group, the blank control group and the inhibitor group were measured, respectively.
Determination of transendothelial resistance values after establishment of the in vitro BTB model: the measurement is carried out by adopting millicell-ERS system, firstly, a co-cultured cell culture plate is placed under a constant temperature condition at 37 ℃, electrode plates are respectively placed at the inner side and the outer side of a chamber, after the reading is stable, the result is respectively recorded, each chamber measures three different points, the TEER value is calculated as the multiplication calculation of the reading and the surface area of a Transwell chamber after the average number is taken and the reading of a blank background is subtracted, and the calculation unit is expressed by omega cm <2 >.
The experimental result is shown in fig. 2A, after detecting that the FENDRR gene inhibitor is applied, the transendothelial resistance value of the in vitro blood tumor barrier model is significantly reduced compared with the normal group and the blank control group; suggesting that the BTB permeability in vitro is obviously increased after the FENDRR gene inhibitor is applied.
5. And (3) carrying out horseradish peroxidase permeation quantity experiments on a normal group, a blank control group and an inhibitor group.
After the in vitro BTB model was established, serum-free EBM-2 medium containing 0.5 umol/l horseradish peroxidase was added to the Transwell chamber of the in vitro BTB model. And collecting the culture solution in the lower chamber of the BTB model after 24h, measuring the content of HRP by using a microplate reader, drawing an HRP standard curve by using an HRP standard, and calculating the amount of HRP permeating into the lower chamber. HRP amount = picomole representation of HRP per hour per square centimeter of surface area.
The experimental result is shown in fig. 2B, and after detecting that the FENDRR gene inhibitor is applied, the in vitro blood tumor barrier model horseradish peroxidase permeability is significantly increased compared with the normal group and the blank control group; suggesting that the BTB permeability in vitro is obviously increased after the FENDRR gene inhibitor is applied.
6. Western blot experiment.
(1) Collecting cells, adding RIPA protein lysate, shaking, standing on ice for 30min, and centrifuging at 12000g at 4 deg.C for 30min.
(2) Supernatants were obtained and collected and the protein concentration of the samples was determined using BCA method.
(3) 40mg of protein was mixed with 5 Xloading buffer (1.
(4) Adding the denatured protein into SDS denatured polyacrylamide gel with different concentration of 8-10% for electrophoretic separation.
(5) Film transfer: the voltage is 100V, the current is 120mA, and the time is 90min-200min.
(6) Sealing with 5% skimmed milk for 2h.
(7) The primary antibody dilution diluted the relevant antibody-bound membrane in a certain proportion and was kept at 4 ℃ overnight.
(8) TTBS washing for 5min,3 times, adding corresponding secondary antibody, and incubating for 2h on a shaking table at room temperature.
(9) ECL luminescence, photography, quantification one software quantitative analysis.
The experimental result is shown in fig. 3, and after the FENDRR gene inhibitor is detected and applied, compared with a normal group and a blank control group, the expression levels of tumor vascular endothelial cell tight junction related proteins ZO-1, occludin and Claudin-5 in an in-vitro blood tumor barrier model are obviously reduced.
7. Immunofluorescence.
Endothelial cells were seeded at 2000/cm2 density on 1.5% gelatin-coated coverslips. After 90% confluence, PBS three times each 5min, with 4% paraformaldehyde fixed for 30 minutes. PBS wash three times for 5min,5% BSA block for 15min, then incubate overnight with the corresponding antibody. PBS was washed three times for 5min each, then goat anti-rabbit fluorescent secondary antibody labeled with Cy3 was incubated for 30min in the dark, and nuclei were stained with DAPI according to 1:500 for 10min. PBS was washed three times for each 5min,50% glycerol mounting and visualized on the Olympus BX60 Upper Fluorescence System.
The results of the experiment are shown in FIG. 4: compared with a normal group and a blank control group, after the FENDRR gene inhibitor is detected and applied, the expression of tumor vascular endothelial cell tight junction related proteins ZO-1, occludin and Claudin-5 in an in vitro hematoma barrier model is changed from continuous distribution to discontinuous distribution.
SEQUENCE LISTING
<110> Shengjing Hospital affiliated to Chinese medical university
<120> targeted inhibitor of FENDRR gene and application thereof
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
ggaggcagac attggagaaa t 21
<210> 2
<211> 60
<212> DNA
<213> Artificial sequence
<400> 2
caccacctcg gaggcagaca ttggagaaat tcaagagatt tctccaatgt ctgcctcctt 60
<210> 3
<211> 60
<212> DNA
<213> Artificial sequence
<400> 3
gatcaaggag gcagacattg gagaaatctc ttgaatttct ccaatgtctg cctccgaggt 60
<210> 4
<211> 53
<212> DNA
<213> Artificial sequence
<400> 4
acctcggagg cagacattgg agaaattcaa gagatttctc caatgtctgc ctc 53

Claims (4)

1. The application of the FENDRR gene targeted inhibitor in the preparation of drugs for treating human brain glioma is characterized in that the targeted preparation is a shRNA sequence capable of inhibiting the FENDRR gene, the shRNA template sequence comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are respectively:
a sense strand:
5’ -CACCACCTCGGAGGCAGACATTGGAGAAATTCAAGAGATTTCTCCAATGTCTGCCTCCTT -3’（SEQ ID No. 2）；
antisense strand:
5’-
GATCAAGGAGGCAGACATTGGAGAAATCTCTTGAATTTCTCCAATGTCTGCCTCCGAGGT-3’（SEQ ID No. 3）。
2. the use according to claim 1, wherein the targeted inhibitor is in any pharmaceutically and therapeutically acceptable dosage form.
3. The use of claim 1, wherein the targeted inhibitor is in the form of an injectable formulation.
4. The use according to claim 1, wherein the targeted inhibitor is in any pharmacotherapeutically acceptable dose.
CN201910250556.9A 2019-03-29 2019-03-29 Targeting inhibitor of FENDRR gene and application thereof Active CN109988765B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910250556.9A CN109988765B (en) 2019-03-29 2019-03-29 Targeting inhibitor of FENDRR gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910250556.9A CN109988765B (en) 2019-03-29 2019-03-29 Targeting inhibitor of FENDRR gene and application thereof

Publications (2)

Publication Number Publication Date
CN109988765A CN109988765A (en) 2019-07-09
CN109988765B true CN109988765B (en) 2023-02-28

Family

ID=67131941

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910250556.9A Active CN109988765B (en) 2019-03-29 2019-03-29 Targeting inhibitor of FENDRR gene and application thereof

Country Status (1)

Country Link
CN (1) CN109988765B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102482601B1 (en) * 2020-05-27 2022-12-29 연세대학교 산학협력단 Composition for preventing or treating cancer
WO2023143474A1 (en) * 2022-01-26 2023-08-03 Anchordx Medical Co., Ltd. Methods for treating gastric cancer

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107661509A (en) * 2017-10-23 2018-02-06 中国医科大学附属盛京医院 A kind of targeted inhibition agent of linc00673 genes and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107661509A (en) * 2017-10-23 2018-02-06 中国医科大学附属盛京医院 A kind of targeted inhibition agent of linc00673 genes and application thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Decreased expression of the long non-coding RNA FENDRR is associated with poor prognosis in gastric cancer and FENDRR regulates gastric cancer cell metastasis by affecting fibronectin1 expression;Tong-peng Xu等;《Journal of Hematology & Oncology》;20140829;1-15 *
Long non-coding RNA FENDRR inhibits cell proliferation and is associated with good prognosis in breast cancer;Yan Li等;《OncoTargets and Therapy》;20180314;1403-1412 *
miR-342对胶质瘤细胞增殖，迁移侵袭及凋亡的影响;奚卓等;《解剖科学进展》;20180115;第24卷(第1期);45-48 *
PM_(2.5)暴露BEAS2B细胞lncRNA FENDRR的表达及其分子机制;林永强等;《环境与健康杂志》;20180520(第05期);13-16 *
长链非编码RNA在胃癌发生中的作用及其应用;杨允奔等;《中国生物化学与分子生物学报》;20160420(第04期);40-47 *

Also Published As

Publication number Publication date
CN109988765A (en) 2019-07-09

Similar Documents

Publication Publication Date Title
Huang et al. Downregulation of miR-141-3p promotes bone metastasis via activating NF-κB signaling in prostate cancer
Li et al. MicroRNA-19 triggers epithelial–mesenchymal transition of lung cancer cells accompanied by growth inhibition
Zhou et al. miR-30a negatively regulates TGF-β1–induced epithelial-mesenchymal transition and peritoneal fibrosis by targeting Snai1
CN107661509B (en) Linc00673 gene targeted inhibitor and application thereof
Chuang et al. Functional role of the long noncoding RNA X-inactive specific transcript in leiomyoma pathogenesis
Zhao et al. EGF promotes HIF-1α expression in colorectal cancer cells and tumor metastasis by regulating phosphorylation of STAT3.
CN109988765B (en) Targeting inhibitor of FENDRR gene and application thereof
Xing et al. Silencing of LINC01963 enhances the chemosensitivity of prostate cancer cells to docetaxel by targeting the miR-216b-5p/TrkB axis
CN110201172B (en) Application of YY1 expression inhibitor in preparation of medicine for treating breast cancer
CN109321656B (en) Use of protein DEPDC1 as marker for diagnosing triple-negative breast cancer
Li et al. Effect of miR-21 on rat thoracic aortic aneurysm model by regulating the expressions of MMP-2 and MMP-9.
CN112791187A (en) Application of miR-142-5p in preparation of medicine for treating chronic granulocytic leukemia
CN107523566B (en) Targeting inhibitor of MCM3AP-AS1 gene and application thereof
Sun et al. Long non-coding RNA UCA1 mediates proliferation and metastasis of laryngeal squamous cell carcinoma cells via regulating miR-185-5p/HOXA13 axis.
WO2020113877A1 (en) Function and use of e2f6 inhibitor
Zhang et al. Downregulation of MST4 underlies a novel inhibitory role of MicroRNA let-7a in the progression of retinoblastoma
CN110241118B (en) Targeting inhibitor of ZFAS1 gene and application thereof
CN110946873B (en) Application of microRNA-29a-3p as glioma blood vessel mimicry prevention and treatment target
Ren et al. Regulation of miR-375 and Sonic hedgehog on vascular endothelial growth factor in preeclampsia rats and its effect on trophoblast cells
CN107753956B (en) Targeted inhibitor of RAX2 gene and application thereof
JP2010270119A (en) Oligonucleotide for inhibiting tumor cell proliferation and method therefor
US9567583B2 (en) Method for treating glioma using Tarbp2 expression inhibitor
CN108424914B (en) Targeted AUF1 gene inhibitor for inhibiting human malignant brain glioma and application thereof
CN113018440B (en) Application of miR-7977 as drug target for inhibiting high-sugar-induced apoptosis of Ad-MSCs
Fu et al. KIF4 enforces the progression of colorectal cancer by inhibiting the autophagy via activating the Hedgehog signaling pathway

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant