CN110150137A - A kind of breeding method of arabidopsis nbr1/atg8f double-mutant and application - Google Patents
A kind of breeding method of arabidopsis nbr1/atg8f double-mutant and application Download PDFInfo
- Publication number
- CN110150137A CN110150137A CN201910474924.8A CN201910474924A CN110150137A CN 110150137 A CN110150137 A CN 110150137A CN 201910474924 A CN201910474924 A CN 201910474924A CN 110150137 A CN110150137 A CN 110150137A
- Authority
- CN
- China
- Prior art keywords
- nbr1
- atg8f
- mutant
- arabidopsis
- double
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Developmental Biology & Embryology (AREA)
- General Engineering & Computer Science (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Mycology (AREA)
Abstract
The invention discloses a kind of breeding method of arabidopsis nbr1/atg8f double-mutant and applications, the present invention determines that Arabidopsis Mutants nbr1 and atg8f mutant is able to suppress infecting for Brassica 2 et 4 (TuMV) first, then arabidopsis nbr1 mutant and atg8f mutant are hybridized by way of genetic cross, screening offspring obtains arabidopsis nbr1/atg8f double-mutant.The T3 obtained by the method for the invention can significantly inhibit infecting for Brassica 2 et 4 for arabidopsis nbr1/atg8f double-mutant plant.
Description
Technical field
The present invention relates to arabidopsis Cultivating techniques fields, more particularly to a kind of arabidopsis nbr1/atg8f double-mutant
Breeding method.
Background technique
Brassica 2 et 4 (TuMV) is one of most important plant virus in agricultural production, be currently known can infect to
Few 43 section, 318 kinds of dicotyledons, it is serious in 28 countries and regions harm.The virus is China brassicaceous vegetable and oil
The main pathogen of dish virus disease has generation in China overwhelming majority area, 50%~100% can be caused when endangering serious
The underproduction.TuMV is distributed widely in North America, Europe, South Africa, Asia, Australia etc. all over the world.Under field conditions (factors), TuMV
Mainly infect the crop in cruciferae such as rape, wild cabbage, Chinese cabbage, broccoli and vegetables.The metainfective plant of TuMV will appear seriously
Symptom, including Huang withers, floral leaf, it is mottled, downgrade etc..The virus is China brassicaceous vegetable and Rape virus disease at present
Main pathogen has generation in China overwhelming majority area.
At this stage there are no developing effectively to inhibit the chemical pesticide that infects of TuMV, thus produce depend on from from
Infecting for disease-resistant variety defence TuMV is found in right boundary.But disease-resistant variety is found from nature and is had the following problems: (1) imitating
Rate is low, although can have certain antiviral kind in nature, target zone is excessive, it is difficult to find；(2) resistance list
One, resistance is unstable, anti-disease mechanism is unintelligible, so that TuMV still is able to overcome the resistance of host, realizes and successfully infects, to posting
Main plant causes destructive harm.
Summary of the invention
The object of the present invention is to provide a kind of breeding method of arabidopsis nbr1/atg8f double-mutant and applications.
The present invention is the plant that dashes forward in view of arabidopsis known to information and function, may participate in disease by bioinformatic analysis
Then the gene that poison infects obtains the mutant of the target gene, be determined the mutant to the resistance of TuMV by experiment.
After the resistance for determining mutant, the plant of the double-mutant of anti-TuMV is further obtained by way of genetic cross, thus
Obtain more stable antiviral plant.Present invention has the advantage that (1) obtain double-mutant plant have it is stable antiviral
Characteristic, the double-mutant genetic background that (2) this method obtains is clear, is conducive to subsequent scientific research and Field information.
The present invention, which is searched for and analysed scientifically by bioinformatics, has found the arabidopsis that may be participated in TuMV and replicate/infect
Host factor NBR1 and ATG8f, and obtain corresponding Arabidopsis Mutants nbr1 and atg8f.Then inoculation TuMV is in control
On plant and mutant plants, discovery Arabidopsis Mutants nbr1 and atg8f are able to suppress Brassica 2 et 4 (TuMV) duplication
With infect.Arabidopsis double-mutant nbr1/atg8f is further obtained by genetic cross, is then inoculated with TuMV in nbr1/
On atg8f double-mutant, plant virus symptom, viral accumulation and the analysis for carrying out protoplast duplication experiment are analyzed, is found
These host factor mutant can significantly inhibit infecting for TuMV.These include two disease-resistant bases of recessiveness by hybridization acquisition
The arabidopsis double-mutant plant nbr1/atg8f of cause, is capable of infecting for stabilization checking TuMV.
To achieve the above object, the technical solution adopted by the present invention is specific as follows:
A kind of breeding method of arabidopsis nbr1/atg8f double-mutant, is to be mutated nbr1 by way of genetic cross
Body and atg8f mutant are hybridized, and screening offspring obtains arabidopsis nbr1/atg8f double-mutant.
Specifically includes the following steps:
(1) arabidopsis nbr1 mutant is obtained (to order by Arabidopsis Mutants library, be U.S. Ohio state
The scientific research institution that university is set up)；The Arabidopsis Mutants library number of the arabidopsis nbr1 mutant is SALK_
135513；
(2) it after sowing 20 days, is taken out from the Arabidopsis plant blade of nbr1 mutant respectively with CTAB method and Trizol method
Take DNA and RNA；
(3) primer pair LBb1.3-F and m-nbr1-RP, m-nbr1-LP and m-nbr1-RP are utilized, to extract DNA as template
PCR amplification is carried out, determines nbr1 mutant homozygote status；
LBb1.3-F:tcgcttgtgaatattgtgcag；M-nbr1-LP:ggaggcattaaggttcagtcc；m-
Nbr1-RP:tcgcttgtgaatattgtgcag；As shown in SEQ ID:No.3-5；
Then following primer pair NBR1-F and NBR1-R is utilized, the cDNA obtained using reverse transcription RNA carries out RT- as template
Really there is no complete NBR1 transcripts in the method validation nbr1 homozygous mutation body of PCR；The sequence of the NBR1 transcript
Column are as shown in SEQ ID:No.1；
NBR1-F:atggagtctactgctaacgcac；NBR1-R:cagcctccttctcccctgtgag；Such as SEQ ID:
Shown in No.6-7；
After determining nbr1 homozygote plant, reserve seed for planting to nbr1 homozygous mutation body；
(4) arabidopsis atg8f mutant is obtained (to order by Arabidopsis Mutants library, be U.S. Ohio state
The scientific research institution that university is set up)；It numbers in the Arabidopsis Mutants library of the arabidopsis atg8f mutant
SALK_057021C；
(5) it after sowing 20 days, is taken out from the Arabidopsis plant blade of atg8f mutant respectively with CTAB method and Trizol method
Take DNA and RNA；
(6) primer pair LBb1.3-F and m-atg8f-RP, m-atg8f-LP and m-atg8f-RP are utilized, is to extract DNA
Template carries out PCR amplification, determines atg8f mutant homozygote status；
M-atg8f-LP:acttcaatggtccaaaatccc；M-atg8f-RP:ttttcattcggacctgacttg；Such as
Shown in SEQ ID:No.8-9；
Using following primer pair ATG8f-F and ATG8f-R, the side of RT-PCR is carried out by the cDNA that reverse transcription RNA is obtained
Really there is no complete ATG8f transcripts in method verifying atg8f homozygous mutation body；The sequence of the ATG8f transcript is such as
Shown in SEQ ID:No.2；
ATG8f-F:gagaaggctgagaagagtgatata；ATG8f-R:tgtaagtgacatagaggaaccc；Such as SEQ
Shown in ID:No.10-11；
It reserves seed for planting atg8f homozygous mutation body；
(7) nbr1 homozygous mutation body and atg8f homozygous mutation body are sowed simultaneously；
(8) after sowing 40 days, in nbr1 homozygous mutation body and atg8f homozygous mutation body florescence, positive something lost is carried out
Pass hybridization and reverse genetic hybridization；
Forward genetics hybridization: being female parent with nbr1 mutant, choose unopened petal, removes stamen, and acquisition atg8f is prominent
The pollen of variant is stained on the column cap of nbr1 gynoecium；
Reverse genetic hybridization: being female parent with atg8f mutant, choose unopened petal, removes stamen, and acquisition nbr1 is prominent
The pollen of variant is stained on the column cap of atg8f gynoecium.
(9) after the silique wait hybridize is mature, sowing；
(10) after sowing F1 generation plant 20 days, the DNA of hybrid plant is extracted with CTAB method；
(11) existing heterozygote is detected with the primer pair in step (3) and step (6)；To contain nbr1 and atg8f T-
The mutant of DNA insertion, reserves seed for planting；
(12) sowing F2 extracts the DNA of hybrid plant with CTAB method for plant,
(13) existing nbr1/atg8f homozygote is detected with the primer pair in step (3) and step (6), PCR is detected
Positive plant, reserves seed for planting；
(14) sowing F2 extracts the DNA of miscellaneous nbr1/atg8f plant with CTAB method and Trizol method for plant respectively；
(15) existing nbr1/atg8f homozygote is detected with the primer pair in step (3) and step (6), determines F2 offspring
The homozygote reserved seed for planting be nbr1/atg8f double-mutant.
Compared with the existing technology, protrusion effect of the invention is:
Present invention obtains corresponding Arabidopsis Mutants nbr1 and atg8f, are inoculated in TuMV in check plant and mutation
On body plant, discovery Arabidopsis Mutants nbr1 and atg8f are able to suppress Brassica 2 et 4 (TuMV) duplication and infect.Into one
Step obtains arabidopsis double-mutant nbr1/atg8f by genetic cross, is then inoculated with TuMV in nbr1/atg8f double-mutant
Upper, analysis plant virus symptom, viral accumulation and the analysis for carrying out protoplast duplication experiment find that these host factors are prominent
Variant can significantly inhibit infecting for TuMV.These are double prominent by the arabidopsis comprising two recessive disease-resistant genes that hybridization obtains
Variant plant nbr1/atg8f is capable of infecting for stabilization checking TuMV.
Explanation and specific embodiment are to arabidopsis nbr1/atg8f double-mutant of the present invention with reference to the accompanying drawing
Breeding method and application are described further.
Detailed description of the invention
Fig. 1 is the confirmation of nbr1/atg8f double-mutant；LP: left Genome Primer, RP: right Genome Primer, LBb
Left primer in 1.3:T-DNA intron.
In Fig. 2, (A) Brassica 2 et 4 (TuMV) is inoculated with arabidopsis wild type Col-0, nbr1 mutant, atg8f mutation
Body and after nbr1/atg8f double-mutant 15 days (15dpi) symptom figure.Buffer (Buffer) is inoculated with as control.
(B) immune-blotting method TuMV coat protein (Coat protein, Cp).Use the antibody test of TuMV Cp
TuMVCp albumen infects arabidopsis wild type Col, nbr1 mutant, atg8f mutant, nbr1/atg8f double-mutant in TuMV
The accumulating level of (15dpi) after 20 days.The Rubisco large subunit of coomassie brilliant blue staining is as albumen loading control.
Specific embodiment
A kind of breeding method of arabidopsis nbr1/atg8f double-mutant, specifically includes the following steps:
(1) arabidopsis nbr1 mutant (Arabidopsis Mutants library number: SALK_135513) is obtained；
(2) it after sowing 20 days, is taken out from the Arabidopsis plant blade of nbr1 mutant respectively with CTAB method and Trizol method
Take DNA and RNA；
(3) primer pair LBb1.3-F and m-nbr1-RP, m-nbr1-LP and m-nbr1-RP are utilized, to extract DNA as template
PCR amplification is carried out, determines that (due to the insertion of T-DNA, LBb1.3-F and m-nbr1-RP can expand nbr1 mutant homozygote status
Increase the DNA fragmentation to special length, m-nbr1-LP and m-nbr1-RP can not expand the DNA fragmentation to special length).It is used
Primer sequence are as follows:
LBb1.3-F(TCGCTTGTGAATATTGTGCAG)
m-nbr1-LP(GGAGGCATTAAGGTTCAGTCC)
m-nbr1-RP(TCGCTTGTGAATATTGTGCAG)；As shown in SEQ ID:No.3-5；
Followed by following primer pair NBR1-F and NBR1-R, the cDNA obtained using reverse transcription RNA carries out RT- as template
Really there is no complete NBR1 transcripts in the method validation nbr1 homozygous mutation body of PCR；The sequence of the NBR1 transcript
Column are as shown in SEQ ID:No.1；
Used primer sequence are as follows:
NBR1-F(ATGGAGTCTACTGCTAACGCAC)
NBR1-R(CAGCCTCCTTCTCCCCTGTGAG)；As shown in SEQ ID:No.6-7；
After determining nbr1 homozygote plant, reserve seed for planting to nbr1 homozygous mutation body；
(4) arabidopsis atg8f mutant (Arabidopsis Mutants library number: SALK_057021C) is obtained；
(5) it after sowing 20 days, is taken out from the Arabidopsis plant blade of atg8f mutant respectively with CTAB method and Trizol method
Take DNA and RNA；
(6) primer pair LBb1.3-F and m-atg8f-RP, m-atg8f-LP and m-atg8f-RP are utilized, is to extract DNA
Template carry out PCR amplification, determine atg8f mutant homozygote status (due to the insertion of T-DNA, LBb1.3-F and m-atg8f-RP
The DNA fragmentation to special length can be expanded, m-atg8f-LP and m-atg8f-RP can not expand the DNA piece to special length
Section).Used primer sequence are as follows:
m-atg8f-LP(ACTTCAATGGTCCAAAATCCC)
m-atg8f-RP(TTTTCATTCGGACCTGACTTG)；As shown in SEQ ID:No.8-9；
Using following primer pair ATG8f-F and ATG8f-R, the side of RT-PCR is carried out by the cDNA that reverse transcription RNA is obtained
Really there is no complete ATG8f transcripts in method verifying atg8f homozygous mutation body.The sequence of the ATG8f transcript is such as
Shown in SEQ ID:No.2；
Used primer sequence are as follows:
ATG8f-F(GAGAAGGCTGAGAAGAGTGATATA)
ATG8f-R(TGTAAGTGACATAGAGGAACCC)；As shown in SEQ ID:No.10-11；It reserves seed for planting atg8f homozygote
Mutant；
(7) nbr1 homozygous mutation body and atg8f homozygous mutation body are sowed simultaneously；
(8) after sowing 40 days, in nbr1 homozygous mutation body and atg8f homozygous mutation body florescence, positive something lost is carried out
Pass hybridization and reverse genetic hybridization.Forward genetics hybridization: being female parent with nbr1 mutant, chooses unopened petal, and removal is male
The pollen of stamen, acquisition atg8f mutant is stained on the column cap of nbr1 gynoecium.Reverse genetic hybridization: it is with atg8f mutant
Female parent chooses unopened petal, removes stamen, and the pollen of acquisition nbr1 mutant is stained on the column cap of atg8f gynoecium；
(9) after the silique wait hybridize is mature, sowing；
(10) after sowing F1 generation plant 20 days, the DNA of hybrid plant is extracted with CTAB method；
(11) existing heterozygote is detected with the primer pair in (3) and (6)；It is inserted into containing nbr1 and atg8f T-DNA
Mutant (the Offspring F1 generation generated by hybridization is heterozygote, therefore four pairs of primers are i.e.: LBb1.3-F and m-nbr1-RP, m-
Nbr1-LP and m-nbr1-RP, LBb1.3-F and m-atg8f-RP, m-atg8f-LP and m-atg8f-RP can be expanded to special
The DNA fragmentation of length) plant, it reserves seed for planting；
(12) sowing F2 extracts the DNA of hybrid plant with CTAB method for plant,
(13) the nbr1/atg8f homozygote existing for the primer pair detection in (3) and (6) (due to the insertion of T-DNA,
LBb1.3-F and m-nbr1-RP can expand the DNA fragmentation to special length, m-nbr1-LP and m-nbr1-RP can not expand to
The DNA fragmentation of special length；LBb1.3-F and m-atg8f-RP can expand the DNA fragmentation to special length, m-atg8f-LP
The DNA fragmentation to special length can not be expanded with m-atg8f-RP) plant, reserve seed for planting；
(14) sowing F2 extracts the DNA of miscellaneous nbr1/atg8f plant with CTAB method and Trizol method for plant respectively；
(15) existing nbr1/atg8f homozygote is detected with the primer pair in step (3) and step (6), determines F2 offspring
The homozygote reserved seed for planting be nbr1/atg8f double-mutant.As shown in Figure 1, obtaining 8 plants in F2 generation by pcr gene parting
Nbr1/atg8f double-mutant homozygous plants.Col-0 and nbr1/atg8f arabidopsis thaliana genomic dna is taken to carry out PCR.Using two
Kind gene-specific primer (LP+RP) detects wild type genotype.Using T-DNA specific primer and gene-specific primer
(LBb 1.3+RP) detects T-DNA insertion.The result shows that no longer turning containing NBR1 and ATG8f in nbr1/atg8f double-mutant
Record originally, is all inserted into containing the corresponding T-DNA of nbr1 and atg8f.
(16) arabidopsis wild type Col-0, nbr1 homozygous mutation body, atg8f homozygous mutation body, nbr1/ are sowed
Atg8f homozygote double-mutant, after sowing 20 days, inoculation control (Buffer) and TuMV.After inoculation 14 days, virus symptoms are observed
With the viral accumulation of analysis.It is not bright to the phenotype of plant to will become apparent from mutation nbr1, atg8f or nbr1/atg8f in Fig. 2 (A)
Aobvious influence (phenotype of inoculation Buffer), but the symptom (table of inoculation TuMV of TuMV can be significantly inhibited after being mutated them
Type).Show that the coat protein of TuMV can be significantly reduced by being mutated nbr1, atg8f or nbr1/atg8f in Fig. 2 (B)
The accumulation of (Coatprotein, Cp) shows to be mutated the vigor that nbr1, atg8f or nbr1/atg8f are able to suppress TuMV, make
The accumulation of its virus protein is suppressed.
Embodiment described above only describe the preferred embodiments of the invention, not to model of the invention
It encloses and is defined, without departing from the spirit of the design of the present invention, those of ordinary skill in the art are to technical side of the invention
The various changes and improvements that case is made should all be fallen into the protection scope that claims of the present invention determines.
Sequence table
<110>Plant Protection institute, Chinese Academy of Agricultral Sciences
<120>a kind of breeding method of arabidopsis nbr1/atg8f double-mutant and application
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2115
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggagtcta ctgctaacgc actcgtcgtc aaggtgagct atggaggtgt gcttaggcgt 60
ttcagggtgc ctgttaaagc taatggacag cttgatcttg aaatggctgg tcttaaggaa 120
aagatcgctg ctctctttaa cctctctgcg gatgctgaat tgagtctgac ttactctgat 180
gaggatgggg atgtggttgc ccttgttgat gacaacgatc tctttgatgt tactaatcag 240
cgtcttaagt tcttaaagat caatgtgaac gctggcgtgt ccactaactc tgctgctcca 300
gagagtagtg ggagttccac acctgcgggt atgcctaacc cggtttccaa aatccagaag 360
ggtataaatg atgttctgat ggctgtacct aacccgatgc gtgataccat atcaaaggtg 420
tacatggacc ttgcatccaa ggcctcaact tctagtcctg tagttggtga gatgcttgat 480
tgcatttcca agctagggca gctctcaatt cctcaggaaa gtagtccttg ctcacctgtt 540
accaagcctg gttcttcagg tgcttccctg agcagggatg ttccttccgc tggtggaaag 600
aaggatatct ctgagaggac ccagaccgga aggaaacctg ttaatctgaa tgaacccact 660
ggcgctcatt caaagacttc tggtcatgta ccaaactcgt ctggactggg tgctaatttc 720
aacgagtgtc cctttagtgg cagtaccatg aattactcct gtccaaatcc agttaacctc 780
aacaagcatc ctcgtcgtgt ttgtcattcc aaaaagagca ccaatggtga ttactggact 840
tcattgggtg tattccataa gggcatccgt tgtgacggat gtggagttct tccaattact 900
gggcctagat ttaagtcgaa agttaaagaa gactatgatc tgtgcaccat ctgctattcg 960
gtgatgggta acgaggggga ttacacaaga atggataagc ctgtatccgt tcaacatctg 1020
catcctttta gaggaccgtt tacccaattt cctaatcctt ggttgagcca ccctgtgcca 1080
cgagcaacca atggaggtgc acctctcagg tgtactcgcc ctaaactaga cagtcggttt 1140
gtccttgatg tgaatgtaat tgatggaacc gttgttgctc catccgcccc atttactaag 1200
atttggaaaa tgaggaacag tggttcgctg gtgtggccac agggcacaca gattgtctgg 1260
atcggtgggg acaggttctg caactccttg tcagttgatt tacagattcc aaaggagggt 1320
gtgcctatct atagtgaact tgacgtcaaa gttgattttg ttgcaccaga gttacctggt 1380
cgatacattt cttattggag gatggctacc tctgacggtg ctaagtttgg gcaacgtgtt 1440
tgggtgttga tacatgttga tgcatctctg aagaattctg ttgtgaatga gtttcatgga 1500
ctgaacctta atgcctcccc ctcccttgat gagaattttc caagcgaatt tctagggatt 1560
atgaattatg agtcagctca acctggcagc tccagtgtca atcctgggac cgtgaaaggt 1620
actgatctag agggcgaagt tggtgaaaca caggccgtgg aaaaagaaaa ccttttggtt 1680
ggtgaagctc atcctgctat ccctcacggt cattctcctt catcttcatc ttcttcattt 1740
aacatggtcg acttcccaag catgcctgct gttgaggtct tgtctggtgg ttcttcatct 1800
actacaaaag acgtgccagt tcctcttcag gaggatatag aaaagaatga cgtggagata 1860
accatgctca aggagctcga ggaaatgggt ttcaaggaga tagatttgaa caaggagatc 1920
ttgagggata acgagtacaa cctggagcag tctgttgatg ctctttgtgg agttagcgag 1980
tgggatccaa tcctagagga gcttcaggag atgggcttct gtgatgatgt gacgaacaag 2040
agactgctga agaagaacaa tggaagcatc aaaggcgtgg taatggatct cctcacaggg 2100
gagaaggagg cttga 2115
<210> 2
<211> 366
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atggcaaaaa gctcgttcaa gcaagagcat gacttagaga agagaagggc agaggctgct 60
aggattagag agaagtatcc tgataggatt ccggtgattg ttgagaaggc tgagaagagt 120
gatataccaa ccatcgacaa gaaaaagtac ctagtcccgg ctgatctgac tgtggggcag 180
tttgtgtatg tcattcgcaa aagaatcaaa ttgagtgcag aaaaggctat cttcatattc 240
gtggacaatg ttcttcctcc agcaggtgcg ctcatgtctt ctgtgtacga agagaaaaag 300
gatgatgatg ggttcctcta tgtcacttac agcggagaaa acacatttgg atttggatct 360
ccataa 366
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tcgcttgtga atattgtgca g 21
<210> 4
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ggaggcatta aggttcagtc c 21
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tcgcttgtga atattgtgca g 21
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
atggagtcta ctgctaacgc ac 22
<210> 7
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cagcctcctt ctcccctgtg ag 22
<210> 8
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
acttcaatgg tccaaaatcc c 21
<210> 9
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ttttcattcg gacctgactt g 21
<210> 10
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gagaaggctg agaagagtga tata 24
<210> 11
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
tgtaagtgac atagaggaac cc 22
Claims (8)
1. a kind of breeding method of arabidopsis nbr1/atg8f double-mutant, it is characterised in that: will by way of genetic cross
Nbr1 mutant and atg8f mutant are hybridized, and screening offspring obtains arabidopsis nbr1/atg8f double-mutant.
2. the breeding method of arabidopsis nbr1/atg8f double-mutant according to claim 1, which is characterized in that including with
Lower step:
(1) arabidopsis nbr1 mutant is obtained；
(2) after sowing 20 days, with CTAB method and Trizol the method DNA extraction from the Arabidopsis plant blade of nbr1 mutant respectively
And RNA；
(3) primer pair LBb1.3-F and m-nbr1-RP, m-nbr1-LP and m-nbr1-RP are utilized, is carried out using extracting DNA as template
PCR amplification determines nbr1 mutant homozygote status；
LBb1.3-F:tcgcttgtgaatattgtgcag；M-nbr1-LP:ggaggcattaaggttcagtcc；M-nbr1-RP:
tcgcttgtgaatattgtgcag；As shown in SEQ ID:No.3-5；
Then following primer pair NBR1-F and NBR1-R is utilized, the cDNA obtained using reverse transcription RNA carries out RT-PCR's as template
Really there is no complete NBR1 transcripts in method validation nbr1 homozygous mutation body；
NBR1-F:atggagtctactgctaacgcac；NBR1-R:cagcctccttctcccctgtgag；Such as SEQ ID:
Shown in No.6-7；
After determining nbr1 homozygote plant, reserve seed for planting to nbr1 homozygous mutation body；
(4) arabidopsis atg8f mutant is obtained；
(5) it after sowing 20 days, is extracted from the Arabidopsis plant blade of atg8f mutant respectively with CTAB method and Trizol method
DNA and RNA；
(6) primer pair LBb1.3-F and m-atg8f-RP, m-atg8f-LP and m-atg8f-RP are utilized, to extract DNA as template
PCR amplification is carried out, determines atg8f mutant homozygote status；
M-atg8f-LP:acttcaatggtccaaaatccc；M-atg8f-RP:ttttcattcggacctgacttg；Such as SEQ
Shown in ID:No.8-9；
Using following primer pair ATG8f-F and ATG8f-R, the method that the cDNA obtained by reverse transcription RNA carries out RT-PCR is tested
Really there is no complete ATG8f transcripts in card atg8f homozygous mutation body；
ATG8f-F:gagaaggctgagaagagtgatata；ATG8f-R:tgtaagtgacatagaggaaccc；Such as SEQ ID:
Shown in No.10-11；
It reserves seed for planting atg8f homozygous mutation body；
(7) nbr1 homozygous mutation body and atg8f homozygous mutation body are sowed simultaneously；
(8) after sowing 40 days, in nbr1 homozygous mutation body and atg8f homozygous mutation body florescence, it is miscellaneous that forward genetics are carried out
It hands over and reverse genetic hybridizes；
(9) after the silique wait hybridize is mature, sowing；
(10) after sowing F1 generation plant 20 days, the DNA of hybrid plant is extracted with CTAB method；
(11) existing heterozygote is detected with the primer pair in step (3) and step (6)；To contain nbr1 and atg8f T-DNA
The mutant of insertion, reserves seed for planting；
(12) sowing F2 extracts the DNA of hybrid plant with CTAB method for plant,
(13) existing nbr1/atg8f homozygote is detected with the primer pair in step (3) and step (6), PCR is detected positive
Plant, reserve seed for planting；
(14) sowing F2 extracts the DNA of miscellaneous nbr1/atg8f plant with CTAB method and Trizol method for plant respectively；
(15) existing nbr1/atg8f homozygote is detected with the primer pair in step (3) and step (6), determines staying for F2 offspring
The homozygote of kind is nbr1/atg8f double-mutant.
3. the breeding method of arabidopsis nbr1/atg8f double-mutant according to claim 2, it is characterised in that: described quasi-
The Arabidopsis Mutants library number of southern mustard nbr1 mutant is SALK_135513.
4. the breeding method of arabidopsis nbr1/atg8f double-mutant according to claim 2, it is characterised in that: described quasi-
The Arabidopsis Mutants library number of southern mustard atg8f mutant is SALK_057021C.
5. the breeding method of arabidopsis nbr1/atg8f double-mutant according to claim 2, it is characterised in that: described
The sequence of NBR1 transcript is as shown in SEQ ID:No.1.
6. the breeding method of arabidopsis nbr1/atg8f double-mutant according to claim 2, it is characterised in that: described
The sequence of ATG8f transcript is as shown in SEQ ID:No.2.
7. the breeding method of arabidopsis nbr1/atg8f double-mutant according to claim 2, it is characterised in that: the step
Suddenly in (8), forward genetics hybridization: being female parent with nbr1 mutant, choose unopened petal, removes stamen, and acquisition atg8f is prominent
The pollen of variant is stained on the column cap of nbr1 gynoecium；
Reverse genetic hybridization: it is female parent with atg8f mutant, chooses unopened petal, remove stamen, acquire nbr1 mutant
Pollen be stained on the column cap of atg8f gynoecium.
8. the breeding method of arabidopsis nbr1/atg8f double-mutant as claimed in claim 1 to 7 is inhibiting Turnip mosaic virus
Poison infect in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910474924.8A CN110150137B (en) | 2019-06-03 | 2019-06-03 | Cultivation method and application of arabidopsis nbr1/atg8f double mutants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910474924.8A CN110150137B (en) | 2019-06-03 | 2019-06-03 | Cultivation method and application of arabidopsis nbr1/atg8f double mutants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110150137A true CN110150137A (en) | 2019-08-23 |
| CN110150137B CN110150137B (en) | 2020-12-29 |
Family
ID=67627129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910474924.8A Active CN110150137B (en) | 2019-06-03 | 2019-06-03 | Cultivation method and application of arabidopsis nbr1/atg8f double mutants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110150137B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114292946A (en) * | 2021-12-30 | 2022-04-08 | 南京林业大学 | Method for cultivating and identifying arabidopsis thaliana csn5a/csn5b double mutants |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR9909303A (en) * | 1998-03-31 | 2000-11-21 | Zeneca Mogen B V | Process to induce resistance to pathogen in plants, protein that has the activity of isocorismato synthase, nucleotide sequence, promoter inducible by pathogen, use of the same, vector, agrobacterium strain, plant cells, and, plants |
| JP2004344129A (en) * | 2003-05-26 | 2004-12-09 | Nara Institute Of Science & Technology | Protein for keeping mutation inhibiting lateral root formation and gene encoding the same |
| CN103145819A (en) * | 2013-03-11 | 2013-06-12 | 中国科学院植物研究所 | Two proteins and application of encoding genes of two proteins in regulation and control of salt tolerance of plants |
| CN106381300A (en) * | 2016-10-13 | 2017-02-08 | 福建农林大学 | Application of Arabidopsis thaliana SAL gene on regulating flowering time and amount of rosette leaves |
-
2019
- 2019-06-03 CN CN201910474924.8A patent/CN110150137B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR9909303A (en) * | 1998-03-31 | 2000-11-21 | Zeneca Mogen B V | Process to induce resistance to pathogen in plants, protein that has the activity of isocorismato synthase, nucleotide sequence, promoter inducible by pathogen, use of the same, vector, agrobacterium strain, plant cells, and, plants |
| JP2004344129A (en) * | 2003-05-26 | 2004-12-09 | Nara Institute Of Science & Technology | Protein for keeping mutation inhibiting lateral root formation and gene encoding the same |
| CN103145819A (en) * | 2013-03-11 | 2013-06-12 | 中国科学院植物研究所 | Two proteins and application of encoding genes of two proteins in regulation and control of salt tolerance of plants |
| CN106381300A (en) * | 2016-10-13 | 2017-02-08 | 福建农林大学 | Application of Arabidopsis thaliana SAL gene on regulating flowering time and amount of rosette leaves |
Non-Patent Citations (4)
| Title |
|---|
| AY091667.1: "Arabidopsis thaliana AT4g16520/dl4285c mRNA, complete cds", 《GENBANK》 * |
| BT008425.1: "Arabidopsis thaliana At4g24690 gene, complete cds", 《GENBANK》 * |
| JIE ZHOU等: "NBR1-mediated Selective Autophagy Targets Insoluble Ubiquitinated Protein Aggregates in Plant Stress Responses", 《PLOS GENET.》 * |
| 谢鑫等: "拟南芥CPK10/CPK30双突变体的构建及表型分析", 《华北农学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114292946A (en) * | 2021-12-30 | 2022-04-08 | 南京林业大学 | Method for cultivating and identifying arabidopsis thaliana csn5a/csn5b double mutants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110150137B (en) | 2020-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Brigneti et al. | Virus‐induced gene silencing in Solanum species | |
| Shi et al. | A combined association mapping and linkage analysis of kernel number per spike in common wheat (Triticum aestivum L.) | |
| Yoshimura et al. | Tagging and combining bacterial blight resistance genes in rice using RAPD and RFLP markers | |
| Hily et al. | Stability of gene silencing-based resistance to Plum pox virus in transgenic plum (Prunus domestica L.) under field conditions | |
| CN106011150A (en) | Rice grain number per ear Gn1a gene artificial site-directed mutant and application thereof | |
| AU2017235928B2 (en) | Genetic markers for myb28 | |
| CN112351679A (en) | Methods for identifying, selecting and producing southern corn rust resistant crops | |
| CN104830845B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878 | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| CN104830846B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898 | |
| CN113631722A (en) | Methods for identifying, selecting and producing southern corn rust resistant crops | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| WO2013112568A1 (en) | Cotton event pdab4468.18.07.1 detection method | |
| AU2013205609A1 (en) | Cotton event pDAB4468.18.07.1 detection method | |
| WO2020052415A1 (en) | Recessive resistance tobacco gene eifiso4e-s of tobacco vein banding mosaic virus and application thereof | |
| CN107177667B (en) | Wheat head density QTL (quantitative trait locus) linked HRM (high resolution melting) molecular marker and application thereof | |
| CN111961749A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof | |
| Hareesh et al. | Cassava mosaic disease in South and Southeast Asia: current status and prospects | |
| CN112195268B (en) | Molecular marker, primer, application and variety breeding method closely linked with origin green peach aphid resistance character of cultivar | |
| CN110150137A (en) | A kind of breeding method of arabidopsis nbr1/atg8f double-mutant and application | |
| CN110150138B (en) | Cultivation method and application of arabidopsis xpo1a/xpo1b +/-double mutants | |
| CN115335506A (en) | Methods for identifying, selecting and producing southern corn rust resistant crops | |
| Baloglu | Genomics of cucurbits | |
| US10294489B2 (en) | Soybean resistant to cyst nematodes | |
| Li et al. | Highly genotype-and tissue-specific single-parent expression drives dynamic gene expression complementation in maize hybrids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |