CN110129484A - A method of influenza A virus is detected based on Doré metal nanocluster enhancing fluorescence combination ring mediated isothermal amplification - Google Patents

Abstract

This patent discloses a kind of methods based on Doré metal nanocluster enhancing fluorescence combination ring mediated isothermal amplification detection influenza A virus, are related to technical field of fluorescence detection.Doré metal nanocluster shows good fluorescence property, Cu²⁺Ion can quench the fluorescence of nanocluster, and PPi²⁺Ion energy and Cu²⁺Complexation reaction occurs, restores the fluorescence of quenching.The identification of specificity is realized using 4 groups of primer pair H1N1virus nucleic acid, 6 regions, and then template nucleic acid is expanded, and has by-product PPi in nucleic acid chains amplification procedure²⁺Ion generates, with the progress of reaction, PPi²⁺Content be gradually increased, and PPi²⁺Content and the additional amount of starting template nucleic acid be positively correlated.PPi in reaction solution after amplification 1 hour²⁺Ion can be such that nanocluster fluorescence restores, and the quantitative analysis of H1N1virus nucleic acid is realized by the Strength Changes that fluorescence restores.This method includes bimetal nano cluster synthesis-bimetal nano cluster fluorescent quenching-loop-mediated isothermal amplification-bimetal nano cluster fluorescence recovery-fluorescence detection-H1N1 viral nucleic acid detection line measurement.

Description

One kind enhancing fluorescence combination ring mediated isothermal amplification based on Doré metal nanocluster The method for detecting influenza A virus

Technical field

It is more specifically a kind of with ring mediated isothermal amplification specificity the present invention relates to fluorescence probe detection technique field The fluorescence detection A type stream that the mode of identification and amplification target nucleic acid and bimetal nano cluster rapid sensitive read output signal constructs Influenza Virus method.

Background technique

Popular influenza A virus causes about 0.25 to 500,000 people's injures and deaths of the whole world every year.According to the World Health Organization (WHO) data, 2009, swine flu pandemic influenza virus attacked more than 214 countries, and about 18,000 is aggrieved Person's virus infection.In particular, bird flu (H5, H7 and H9 hypotype) can be broadcast to the mankind by way of genetic resortment.For example, 2013, novel bird flu H7N9 virus outbreak；It is dead to cause a large amount of the infected.Although avian influenza type A influenza virus Direct circulation way from the mankind to the mankind has not proved out, but following it is possible to occurring to propagate in the mankind novel Bird flu.

The outburst of Influenza A H1N1 epidemic situation constitutes a serious threat to global public health.H1N1-2009 has height Infectiousness.Less than in one month after on April 23rd, 2009, the first reported cases occurred, 39 national reports 8480 H1N1-2009 cases of infection and 72 deaths.Traditional diagnosing influenza method needs multiple operating process, including virus Cracking, viral RNA extracts and molecular diagnosis, whole process are generally focused on the interior progress in laboratory, need accurate instrument and Skilled operator.However these conditions are often difficult to obtain in many circumstances, seriously hinder the quick diagnosis of influenza.

Traditional PCR method needs accurate complex instrument to control DNA fusing, the not equality of temperature that annealing and primer extend need Degree, this causes it to be difficult to apply in resource constrained environment.In recent years the isothermal amplification method risen, due to can be in a temperature The lower cyclic amplification for completing nucleic acid, it is receive more and more attention.Wherein, loop-mediated isothermal amplification method is due to brilliant spy Anisotropic and efficient amplification efficiency, the application in the fields such as early diagnosis of cancer and infectious disease detection are more and more wider.Due to A type The strong destructive and high mortality of H1N1 influenza virus, brings serious threat to the life and health of people, it is therefore desirable to develop A kind of quick, sensitive method detects H1N1virus.

Summary of the invention

The technical problem to be solved by the present invention is to construct it is a kind of can specific recognition H1N1virus and can be real The method of the rapid sensitive detection H1N1virus of existing follow-up signal amplification.

One kind detecting influenza A virus based on Doré metal nanocluster enhancing fluorescence combination ring mediated isothermal amplification Method, it is characterized in that the following steps are included:

(1) synthesis of bimetal nano cluster

By 5 mL bovine serum albumins (BSA, 50 mg/mL) and 4 mL gold chloride (HAuCl₄, 10 mM) and mixing, violent It is added with stirring 1 mL silver nitrate (AgNO₃, 2.5 mM), continue stirring at room temperature after ten minutes, 1mL sodium hydroxide is added (NaOH, 1 mM), 37 DEG C of mixed liquor are reacted 12 hours, and reaction solution is dialysed 48 hours in ultrapure water and (is replaced within every 6 hours Water), it can be obtained Doré metal nanocluster (Au-Ag NCs), by nanocluster in 4 DEG C of storages for further It uses；

(2) bimetal nano cluster fluorescent quenching

Take 1 mL(1) in nanocluster solution, be added 9 mL 4-(2- ethoxys) -1- piperazine ethanesulfonic acid (HEPES) buffering it is molten Liquid (10 mM, pH7.2) is uniformly mixed, and 1 mL copper sulphate (CuSO is added₄, 30 μM) and (this is existing for the fluorescence of quenching nanocluster It is verified as that the fluorescence intensity of copper sulphate front and back nanocluster can be added by measurement)；

(3) loop-mediated isothermal amplification

6 groups of primers of ring mediated isothermal amplification are denaturalized 5 minutes at 95 DEG C, take 2.5 μ 10 × isothermal duplication of L buffers, 1.5μL MgSO₄(100 mM), 3.5 μ L dNTP(5.6 mM), 1 FIP/BIP(40 μM of μ L inner primer), 1 μ L ring primer LF/LB(20 μM), 1 F3/B3(5 μM of μ L outer primer), 1 μ L Bst, 2.0 archaeal dna polymerase (8000 U/mL), 0.8 μ L AMV reverse transcriptase (10000U/mL), 1 μ L H1N1 viral nucleic acid (2.5 ng), 12.5 μ L are total without RNA enzyme water 25 63 DEG C of μ L solution react 60 minutes；

(4) bimetal nano cluster fluorescence restores

Reaction solution in 10 μ L (4) is taken, is added in 100 μ L (2) solution, is uniformly mixed, is incubated for 45 minutes at room temperature；

(5) fluorescence detection

Measure the solution after the completion of being incubated in (4), the experiment parameter of fluorescence detection is as follows: excitation wavelength is 270 nm, transmitted wave Long range is 570-770 nm；

(6) H1N1 viral nucleic acid detection line measures

H1N1 viral nucleic acid concentration in step (3) is changed to a series of concentration gradients, is then carried out under same parameter setting Fluorescence detection obtains working curve, Jin Ershi by the fluorescence signal scanning curve under different H1N1 viral nucleic acid concentration gradients Existing quantitative analysis.

Beneficial effects of the present invention

(1) specific recognition and amplification of object are realized using ring mediated isothermal amplification；

(2) Doré metal nanocluster fluorescent quenching and recovery properties are utilized, are realized fast to ring mediated isothermal amplification result Fast sensitive monitoring；

(3) cumbersome fluorescent marker step is avoided, step is simplified and is reduced costs.

Detailed description of the invention

Fig. 1 is the experimental principle figure of methods described herein.

Specific embodiment

For a better understanding of the present invention, below with reference to the embodiment and attached drawing content that the present invention is furture elucidated, but this The content of invention is not limited solely to following implementation.

Embodiment 1

A kind of side based on Doré metal nanocluster enhancing fluorescence combination ring mediated isothermal amplification detection influenza A virus Method, it is characterized in that the following steps are included:

(1) synthesis of bimetal nano cluster

By 5 mL bovine serum albumins (BSA, 50 mg/mL) and 4 mL gold chloride (HAuCl₄, 10 mM) and mixing, violent It is added with stirring 1 mL silver nitrate (AgNO₃, 2.5 mM), continue stirring at room temperature after ten minutes, 1mL sodium hydroxide is added (NaOH, 1 mM), 37 DEG C of mixed liquor are reacted 12 hours, and reaction solution is dialysed 48 hours in ultrapure water and (is replaced within every 6 hours Water), it can be obtained Doré metal nanocluster (Au-Ag NCs), by nanocluster in 4 DEG C of storages for further making With；

(2) bimetal nano cluster fluorescent quenching

Take 1 mL(1) in nanocluster solution, be added 9 mL 4-(2- ethoxys) -1- piperazine ethanesulfonic acid (HEPES) buffering it is molten Liquid (10mM, pH7.2) is uniformly mixed, and 1 mL copper sulphate (CuSO is added₄, 30 μM) quenching nanocluster fluorescence (this phenomenon It can be verified by the fluorescence intensity before and after measurement addition copper sulphate)；

(3) loop-mediated isothermal amplification

6 groups of primers of ring mediated isothermal amplification are denaturalized 5 minutes at 95 DEG C, take 10 × isothermal duplication buffer, 6 mM MgSO₄, 1.4 mM dNTP, 1.6 μM of inner primers (FIP, BIP), 0.8 μM of ring primer (LF, LB), 0.4 μM of outer primer (F3, B3), 0.8 U Bst, 2.0 archaeal dna polymerase, 0.8 μ L AMV reverse transcriptase (10000U/mL), 2.5 ng H1N1 Viral nucleic acid reacts 60 minutes for 65 DEG C of 25 μ L solution totally；

(4) bimetal nano cluster fluorescence restores

Reaction solution in 10 μ L (4) is taken, is added in 100 μ L (2) solution, is uniformly mixed, is incubated for 45 minutes at room temperature；

(5) fluorescence detection

Measure the solution after the completion of being incubated in (5), the experiment parameter of fluorescence detection is as follows: excitation wavelength is 270 nm, transmitted wave Long range is 570-770 nm；

(6) H1N1 viral nucleic acid detection line measures

H1N1 viral nucleic acid concentration in step (3) is changed to a series of concentration gradients, is then carried out under same parameter setting Fluorescence detection obtains working curve, Jin Ershi by the fluorescence signal scanning curve under different H1N1 viral nucleic acid concentration gradients Existing quantitative analysis.

Sequence table

<110>University Of Ji'nan

<120>a kind of based on Doré metal nanocluster enhancing fluorescence combination ring mediated isothermal amplification detection Flu-A disease The method of poison

<130> 2019

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 40

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

ggcacggtga gcgtgaacac accaatcctg tcacctctga 40

<210> 2

<211> 40

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

gagcgaggac tgcagcgtag gtttggatcc ccattcccat 40

<210> 3

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

aaatcctaaa atcccc 16

<210> 4

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

cgctttgtcc aaaatgcc 18

<210> 5

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gcgctcatgg aatggctaa 19

<210> 6

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

tgaccgctct gtccatgtt 19

Claims (1)

1. a kind of detect influenza A virus based on Doré metal nanocluster enhancing fluorescence combination ring mediated isothermal amplification Method, it is characterized in that the following steps are included:

(1) synthesis of bimetal nano cluster

By 5 mL bovine serum albumins (BSA, 50 mg/mL) and 4 mL gold chloride (HAuCl₄, 10 mM) and mixing, violent It is added with stirring 1 mL silver nitrate (AgNO₃, 2.5 mM), continue stirring at room temperature after ten minutes, 1mL sodium hydroxide is added (NaOH, 1 mM), 37 DEG C of mixed liquor are reacted 12 hours, and reaction solution is dialysed 48 hours in ultrapure water and (is replaced within every 6 hours Water), it can be obtained Doré metal nanocluster (Au-Ag NCs), by nanocluster in 4 DEG C of storages for further making With；

(2) bimetal nano cluster fluorescent quenching

Take 1 mL(1) in nanocluster solution, be added 9 mL 4-(2- ethoxys) -1- piperazine ethanesulfonic acid (HEPES) buffering it is molten Liquid (10 mM, pH7.2) is uniformly mixed, and 1 mL copper sulphate (CuSO is added₄, 30 μM) and (this is existing for the fluorescence of quenching nanocluster As that can be verified by the fluorescence intensity before and after measurement addition copper sulphate)；

(3) loop-mediated isothermal amplification

6 groups of primers of ring mediated isothermal amplification are denaturalized 5 minutes at 95 DEG C, wherein inner primer FIP sequence is GGCACGGTG AGCGTGAACACACCAATCCTGTCACCTCTGA, inner primer BIP sequence are GAGCGAGGACTGCAGCGTAGGTTTGGATC CCCATTCCCAT, ring primer LF sequence are AAATCCTAAAATCCCC, and ring primer LB sequence is CGCTTTGTCCAAAATGCC, Outer primer F3 sequence is GCGCTCATGGAATGGCTAA, and outer primer B3 sequence is TGACCGCTCTGTCCATGTT；Take 2.5 μ L 10 × isothermal duplication buffer, 1.5 μ L MgSO₄(100 mM), 3.5 μ L dNTP(5.6 mM), 1 μ L inner primer FIP/ BIP(40 μM), 1 LF/LB(20 μM of μ L ring primer), 1 F3/B3(5 μM of μ L outer primer), 1 μ L Bst, 2.0 DNA Polymerase (8000 U/mL), 0.8 μ L AMV reverse transcriptase (10000U/mL), 1 μ L H1N1 viral nucleic acid (2.5 Ng), 12.5 μ L react 60 minutes for 63 DEG C of 25 μ L solution totally without RNA enzyme water；

(4) bimetal nano cluster fluorescence restores

Reaction solution in 10 μ L (4) is taken, is added in 100 μ L (2) solution, is uniformly mixed, is incubated for 45 minutes at room temperature；

(5) fluorescence detection

Measure the solution after the completion of being incubated in (4), the experiment parameter of fluorescence detection is as follows: excitation wavelength is 270 nm, transmitted wave Long range is 570-770 nm；

(6) H1N1 viral nucleic acid detection line measures

H1N1 viral nucleic acid concentration in step (3) is changed to a series of concentration gradients, is then carried out under same parameter setting Fluorescence detection obtains working curve, Jin Ershi by the fluorescence signal scanning curve under different H1N1 viral nucleic acid concentration gradients Existing quantitative analysis.