CN110129467A - For detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid - Google Patents
For detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid Download PDFInfo
- Publication number
- CN110129467A CN110129467A CN201810131895.0A CN201810131895A CN110129467A CN 110129467 A CN110129467 A CN 110129467A CN 201810131895 A CN201810131895 A CN 201810131895A CN 110129467 A CN110129467 A CN 110129467A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- aspergillus fumigatus
- dna
- tested
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses a kind of for detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid.Primer combination provided by the invention, 6 single strand dnas shown in sequence 1 to 6 form.The present invention also protects application of the primer combination in detection aspergillus fumigatus.The present invention also protects the method whether sample to be tested has infected aspergillus fumigatus that detects.Using LAMP primer and method of the invention, aspergillus fumigatus can be fast and accurately detected.
Description
Technical field
The present invention relates to a kind of for detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid.
Background technique
Mycotic endophthalmitis is that a kind of pair of eyesight threatens greatly infectious eye disease, and blind rate is high, invasioning delitescence
It is long, the even several months usual several weeks.Early clinic symptom is unobvious, difficult diagnosis, and therefore, clinically, especially early stage is normal
Affected adversely treatment by mistaken diagnosis.Clinical antifungal drug curative effect is insufficient and adverse reaction is larger, and fungi is destructive to ocular tissue strong
Etc. reasons lead to the poor prognosis of mycotic endophthalmitis.In recent years, corticosteroid is largely abused with postoperative and chronic inflammation to swash
Element, antibiotic and immune formulation, cause human flora to lack of proper care, and immune function decline, mycotic endophthalmitis disease incidence rises year by year.
Mycotic endophthalmitis is divided into endogenous endophthalmitis and two kinds of Exogenous endophthalmitis.Endogenous mycotic endophthalmitis is passed through by fungi
Caused by hematogenous spread arrival eye causes intraocular infection, patient, which usually has, is used for a long time hormone, antibiotic or immunosuppressor, or
The medical histories such as diabetes, malignant tumour, immune deficiency.The most common pathomycete is Candida albicans and Aspergillus.It is exogenous true
Bacterium property entophthamia is secondary to after penetrating ocular injuries, intraocular surgery or fungal keratitis, secondary to the fungi after intraocular surgery
Property entophthamia is mostly caused by Aspergillus.
Aspergillus fumigatus (Aspergillus funigatus) is a kind of important pathogenic bacteria, and invasiveness and virulence are strong, can lead
Extensive retinal necrosis and train of thought membrane damage are caused, compared with entophthamia poor prognosis caused by other pathomycetes.
The primarily discrete culture of the clinical detection method for fungi at present, smear for microscopic examination and serodiagnosis.These inspections
Survey method is cumbersome, and detection time is long, and positive rate is low, and is easy to happen missing inspection and false retrieval, be unable to satisfy it is clinical quickly detect want
It asks.The molecular detection technology to grow up in recent years, especially round pcr, in answering for microorganism Rapid identification and context of detection
With, for fungi it is quick detect open new approach.But that there are detection times is long, easy to pollute, false positive rate is high by PCR
Disadvantage is restricted its application.Loop-mediated isothermal amplification technique (loop-mediated isothermal
Amplification, LAMP) it is a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed in recent years, it is former
Reason is the 4-6 primer in 6-8 region to be identified, in isothermal item under the action of a kind of archaeal dna polymerase with strand-displacement activity
Under part quickly, specifically amplifying target genes, can be applied to and fast and accurately detect fungi.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid.
The present invention provides primer combinations, by primers F 3, primer B3, primers F IP, primer BIP, primer LF and primer LB group
At；
The primers F 3 is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) sequence 1 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1
The DNA molecular of identical function；
The primer B3 is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) sequence 2 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2
The DNA molecular of identical function；
The primers F IP is following (a5) or (a6):
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) sequence 3 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3
The DNA molecular of identical function；
The primer BIP is following (a7) or (a8):
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) sequence 4 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4
The DNA molecular of identical function；
The primer LF is following (a9) or (a10):
(a9) single strand dna shown in the sequence 5 of sequence table；
(a10) sequence 5 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5
The DNA molecular of identical function；
The primer LB is following (a11) or (a12):
(a11) single strand dna shown in the sequence 6 of sequence table；
(a12) sequence 6 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6
The DNA molecular of identical function.
The purposes of the primer combination is following (b1) or (b2) or (b3) or (b4):
(b1) it identifies or assists to identify whether fungi to be measured is aspergillus fumigatus；
(b2) prepare for identify or assist to identify fungi to be measured whether be aspergillus fumigatus kit；
(b3) whether detection sample to be tested has infected aspergillus fumigatus；
(b4) whether preparation has infected the kit of aspergillus fumigatus for detecting sample to be tested.
The present invention also protects the application of the primer combination, following (b1) or (b2) or (b3) or (b4):
(b1) it identifies or assists to identify whether fungi to be measured is aspergillus fumigatus；
(b2) prepare for identify or assist to identify fungi to be measured whether be aspergillus fumigatus kit；
(b3) whether detection sample to be tested has infected aspergillus fumigatus；
(b4) whether preparation has infected the kit of aspergillus fumigatus for detecting sample to be tested.
The present invention also protects the kit containing the primer pair；The purposes of the kit is following (c1) or (c2):
(c1) it identifies or assists to identify whether fungi to be measured is aspergillus fumigatus；
(c2) whether detection sample to be tested has infected aspergillus fumigatus.
The present invention also protects the preparation method of the kit, includes the steps that individually packing each primer.
The present invention, which also protects, identifies whether fungi to be measured is aspergillus fumigatus method, includes the following steps: with fungi to be measured
Genomic DNA is template, is combined using the primer and carries out LAMP amplified reaction, if may be implemented using primer combination
It is aspergillus fumigatus by the positive amplification of template, fungi to be measured of the genomic DNA, if cannot be real using primer combination
It is now non-aspergillus fumigatus by the positive amplification of template, fungi to be measured of the genomic DNA.
The present invention, which also protects, identifies whether fungi to be measured is aspergillus fumigatus method, includes the following steps: to detect fungi to be measured
Genomic DNA in the presence or absence of the primer combination target sequence, if there are primer combinations in the genomic DNA
Target sequence, fungi to be measured be aspergillus fumigatus, if in the genomic DNA there is no the primer combination target sequence, to
Survey fungi is non-aspergillus fumigatus.
The present invention also protects whether detection sample to be tested has infected the method for aspergillus fumigatus, includes the following steps: with to be measured
The total DNA of sample is template, is combined using the primer and carries out LAMP amplified reaction, if can be real using primer combination
Aspergillus fumigatus now is infected by the positive amplification of template, sample to be tested of the total DNA, if cannot using primer combination
It realizes and does not infect aspergillus fumigatus by the positive amplification of template, sample to be tested of the total DNA.
The present invention also protects whether detection sample to be tested has infected the method for aspergillus fumigatus, include the following steps: detection to
With the presence or absence of the target sequence of primer combination in the total DNA of test sample sheet, if there are primer combinations in the total DNA
Target sequence, sample to be tested have infected aspergillus fumigatus, if there is no the target sequences, to be measured of primer combination in the total DNA
Sample does not infect aspergillus fumigatus.
It in any description above method, can specifically judge by the following method " positive amplification ": be detected with fluorescent PCR instrument glimmering
Optical signal is then positive amplification if there is positive amplification curve.The positive amplification curve concretely S type amplification curve.
Any description above is carried out in the reaction system of LAMP amplification using primer combination, each primer in primer combination
Concentration are as follows: 0.5 μM of F3,0.5 μM of B3,2 μM of FIP, 2 μM of BIP, 1uM LF, 1 μM of LB.
Any description above carries out the reaction system of LAMP amplification concretely using primer combination: 1 μ L 10 ×
ThermoPol Buffer, 1.6 μ L 5M glycine betaines, 0.1 μ L 50mg/ml BSA, 0.4 μ L 100mMMgSO4, 0.3 μ L 20 ×
EvaGreen, 0.15 μ L 100mM dNTPs, 0.4 μ L 8u/ml Bst archaeal dna polymerase large fragment, 1 μ L primer mixture (F3,
The mixture of B3, FIP, BIP, LF and LB), template DNA (50pg-50ng, concretely 2ng) uses ddH2O complements to 10 μ L.
Any description above LAMP amplification response procedures concretely: 65 DEG C of constant temperature 50min.
Any description above sample to be tested concretely eye clinical sample culture, ocular fluid body or aspirate.
Any description above fungi to be measured concretely Candida albicans, aspergillus fumigatus, Aspergillus flavus or Candida glabrata.
The present invention provides a kind of for detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid.Institute of the present invention
The LAMP primer composition stated includes outer primer F3 and B3, inner primer FIP and BIP and ring primer LF and LB, can specific recognition
Six isolated areas on target sequence are expanded, and have high specific.It, can be fast using LAMP primer and method of the invention
Speed, accurate detection go out aspergillus fumigatus.
Detailed description of the invention
Fig. 1 is the LAMP amplification curve diagram of embodiment 3.
Fig. 2 is the LAMP amplification curve diagram of embodiment 5.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
Candida albicans: ATCC 90028.
Aspergillus fumigatus: ATCC 10894.
Aspergillus flavus: ATCC 16870.
Candida glabrata: ATCC 2001.
Embodiment 1, design of primers and preparation
It carries out a large amount of sequence analyses, compare several primers obtained for identifying aspergillus fumigatus.Each primer is carried out
Preliminary experiment compares the performances such as sensitivity, specificity, finally obtains the LAMP primer group for identifying aspergillus fumigatus.
For identifying the primer sets of aspergillus fumigatus, including 2 outer primers (F3, B3), 2 inner primers (FIP, BIP) and 2
Ring primer (LF, LB), each primer sequence are (5 ' → 3 ') as follows:
F3 (sequence 1 of sequence table): GCTGACACGAGATTTGACGT；
B3 (sequence 2 of sequence table): CGCATTACAGTGCCCAAT；
FIP (sequence 3 of sequence table): TCGCATGGAAGCCGAAGTAAGGATGGTGATGGTTAGTGAC；
BIP (sequence 4 of sequence table): ACGCCGACTCACAATATCCGGAATCCTTGGTGGTGATCTGG；
LF (sequence 5 of sequence table): CGAGGAGTGGAAAAAGG；
LB (sequence 6 of sequence table): CGTCAGTACTGATAATATCT.
Embodiment 2, detection method are established
1, it extracts the genomic DNA of fungi to be measured or extracts the total DNA of biological sample to be measured.
2, the DNA for taking step 1 to obtain carries out LAMP expansion using the LAMP primer group prepared in embodiment 1 as template
Increase.
The reaction system of LAMP amplification: 1 μ 10 × ThermoPol of L Buffer, 1.6 μ L 5M glycine betaines, 0.1 μ L
50mg/ml BSA, 0.4 μ L 100mM MgSO4, 0.3 μ L 20 × EvaGreen, 0.15 μ L 100mM dNTPs, 0.4 μ L 8U/
Ml Bst archaeal dna polymerase large fragment, 1 μ L primer mixture (mixture of F3, B3, FIP, BIP, LF and LB), 2ng template
DNA uses ddH2O complements to 10 μ L.The concentration of each primer is as follows in reaction system: 0.5 μM of F3,0.5 μM of B3,2 μM of FIP, 2 μ
M BIP、1μM LF、1μM LB。
The response procedures of LAMP amplification: 65 DEG C of constant temperature 50min.In reaction process, using fluorescent PCR instrument detection fluorescence letter
Number.
If using the available positive amplification curve of LAMP primer group, show fungi to be measured be aspergillus fumigatus or to
Test sample originally contains aspergillus fumigatus, if positive amplification curve cannot be obtained, showing fungi to be measured not is aspergillus fumigatus or to be measured
Sample does not contain aspergillus fumigatus.
Embodiment 3, specificity
Bacterium to be measured: Candida albicans, aspergillus fumigatus, Aspergillus flavus and Candida glabrata.
The genomic DNA for extracting bacterium to be measured is detected using the detection method of embodiment 2.Setting is using water as mould
The negative control of plate DNA.
The result is shown in Figure 1.In Fig. 1, abscissa is recurring number, and ordinate is fluorescence signal intensity.The result shows that aspergillus fumigatus
Genomic DNA obtains S type amplification curve, and amplification is the positive, candida albicans gene group DNA, Aspergillus flavus genomic DNA
S type amplification curve is not obtained with Candida glabrata genomic DNA, amplification is feminine gender.
The result shows that LAMP primer group prepared by embodiment 1 has very high specificity.
Embodiment 4, sensitivity
Sample to be tested: aspergillus fumigatus genomic DNA.
1, with 10 times of gradient dilution samples to be tested of sterile water, each dilution is obtained.
2, each dilution for taking step 1 to obtain respectively is detected as template using the detection method of embodiment 2.
Since the dilution of use is different, following different reaction system is formed:
In reaction system 1, the initial content of genomic DNA are as follows: 10000 copies；
In reaction system 2, the initial content of genomic DNA are as follows: 1000 copies；
In reaction system 3, the initial content of genomic DNA are as follows: 500 copies；
In reaction system 4, the initial content of genomic DNA are as follows: 100 copies.
The result shows that aspergillus fumigatus Genome DNA content obtains S type amplification curve when being 500-10000 copy, cigarette is bent
Mould genomic DNA concentration does not obtain S type amplification curve when being 100 copies.
The result shows that LAMP primer group sensitivity with higher prepared by embodiment 1.
Embodiment 5, clinical sample detection
Sample to be tested are as follows: by clinical identification for the eye aspirate sample (sample 1) of the aspergillus fumigatus positive and by facing
There is no the eye aspirate samples (sample 2) of the healthy person of aspergillus fumigatus for bed identification.
The total DNA for extracting sample to be tested, is detected using the detection method of embodiment 2.Setting is using water as template
The negative control of DNA, positive control of the setting using the genomic DNA of aspergillus fumigatus as template.
As a result see Fig. 2.In Fig. 2, abscissa is recurring number, and ordinate is fluorescence signal intensity.The result shows that only sample
1 and positive control obtain S type amplification curve, sample 2 and negative control do not obtain S type amplification curve, with clinical identification result
It is consistent.
The result shows that aspergillus fumigatus identification is carried out using LAMP primer group prepared by embodiment 1, for people's normal gene group
For be not present non-specific amplification, as a result accurately and reliably.
<110>intelligence moral in Beijing is attained and Co., Ltd, medical test institute
<120>for detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid
<160> 6
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
gctgacacga gatttgacgt 20
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
cgcattacag tgcccaat 18
<210> 3
<211> 40
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
tcgcatggaa gccgaagtaa ggatggtgat ggttagtgac 40
<210> 4
<211> 41
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
acgccgactc acaatatccg gaatccttgg tggtgatctg g 41
<210> 5
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 5
cgaggagtgg aaaaagg 17
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 6
cgtcagtact gataatatct 20
Claims (8)
1. primer combines, it is made of primers F 3, primer B3, primers F IP, primer BIP, primer LF and primer LB；
The primers F 3 is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
The primer B3 is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
The primers F IP is following (a5) or (a6):
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) have by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3 identical
The DNA molecular of function；
The primer BIP is following (a7) or (a8):
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) have by sequence 4 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4 identical
The DNA molecular of function；
The primer LF is following (a9) or (a10):
(a9) single strand dna shown in the sequence 5 of sequence table；
(a10) have by sequence 5 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5 identical
The DNA molecular of function；
The primer LB is following (a11) or (a12):
(a11) single strand dna shown in the sequence 6 of sequence table；
(a12) have by sequence 6 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6 identical
The DNA molecular of function.
2. the application of primer combination described in claim 1, for as follows (b1) or (b2) or (b3) or (b4):
(b1) it identifies or assists to identify whether fungi to be measured is aspergillus fumigatus；
(b2) prepare for identify or assist to identify fungi to be measured whether be aspergillus fumigatus kit；
(b3) whether detection sample to be tested has infected aspergillus fumigatus；
(b4) whether preparation has infected the kit of aspergillus fumigatus for detecting sample to be tested.
3. the kit containing primer pair described in claim 1；The purposes of the kit is following (c1) or (c2):
(c1) it identifies or assists to identify whether fungi to be measured is aspergillus fumigatus；
(c2) whether detection sample to be tested has infected aspergillus fumigatus.
4. the preparation method of kit described in claim 4 includes the steps that individually packing each primer.
5. identifying whether fungi to be measured is aspergillus fumigatus method, is included the following steps: using the genomic DNA of fungi to be measured as mould
Plate is combined using primer described in claim 1 and carries out LAMP amplified reaction, if use primer combination may be implemented with
The genomic DNA is the positive amplification of template, fungi to be measured is aspergillus fumigatus, if can not achieve using primer combination
It is non-aspergillus fumigatus by the positive amplification of template, fungi to be measured of the genomic DNA.
6. identify whether fungi to be measured is aspergillus fumigatus method, including the following steps: to detect in the genomic DNA of fungi to be measured is
No there are the target sequences of primer described in claim 1 combination, if there are the targets of primer combination in the genomic DNA
Sequence, fungi to be measured are aspergillus fumigatus, if there is no the target sequences of primer combination, to be measured true in the genomic DNA
Bacterium is non-aspergillus fumigatus.
7. the method whether detection sample to be tested has infected aspergillus fumigatus, includes the following steps: using the total DNA of sample to be tested as mould
Plate is combined using primer described in claim 1 and carries out LAMP amplified reaction, if use primer combination may be implemented with
The total DNA is that positive amplification, the sample to be tested of template have infected aspergillus fumigatus, if can not achieve using primer combination
Aspergillus fumigatus is not infected by the positive amplification of template, sample to be tested of the total DNA.
8. the method whether detection sample to be tested has infected aspergillus fumigatus includes the following steps: to detect in the total DNA of sample to be tested
With the presence or absence of the target sequence of primer described in claim 1 combination, if there are the target sequences of primer combination in the total DNA
Column, sample to be tested have infected aspergillus fumigatus, if there is no the target sequences of primer combination, sample to be tested in the total DNA
Do not infect aspergillus fumigatus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131895.0A CN110129467A (en) | 2018-02-08 | 2018-02-08 | For detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131895.0A CN110129467A (en) | 2018-02-08 | 2018-02-08 | For detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110129467A true CN110129467A (en) | 2019-08-16 |
Family
ID=67567500
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810131895.0A Pending CN110129467A (en) | 2018-02-08 | 2018-02-08 | For detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129467A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999013104A1 (en) * | 1997-09-08 | 1999-03-18 | The Institute Of Ophthalmology | Diagnosis of ocular pathogens |
| EP1132481A1 (en) * | 2000-03-10 | 2001-09-12 | Universiteit Gent | Detection of Aspergillus fumigatus |
| CN105624290A (en) * | 2016-01-12 | 2016-06-01 | 中国人民解放军疾病预防控制所 | Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene) |
| CN105648038A (en) * | 2014-08-21 | 2016-06-08 | 黄耀江 | LAMP (loop-mediated isothermal amplification) universal primer for detecting aspergillus toxin-producing fungi and kit containing primer |
-
2018
- 2018-02-08 CN CN201810131895.0A patent/CN110129467A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999013104A1 (en) * | 1997-09-08 | 1999-03-18 | The Institute Of Ophthalmology | Diagnosis of ocular pathogens |
| EP1132481A1 (en) * | 2000-03-10 | 2001-09-12 | Universiteit Gent | Detection of Aspergillus fumigatus |
| CN105648038A (en) * | 2014-08-21 | 2016-06-08 | 黄耀江 | LAMP (loop-mediated isothermal amplification) universal primer for detecting aspergillus toxin-producing fungi and kit containing primer |
| CN105624290A (en) * | 2016-01-12 | 2016-06-01 | 中国人民解放军疾病预防控制所 | Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene) |
Non-Patent Citations (1)
| Title |
|---|
| 朱超等: "兔眼外源性烟曲霉性眼内炎模型的建立", 《眼科新进展》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| Alanio et al. | Difficulties with molecular diagnostic tests for mould and yeast infections: where do we stand? | |
| CN106987626B (en) | Primer and probe for rapidly detecting various fungi and identifying strains and application thereof | |
| CN106893782B (en) | It is a kind of to detect and identify cryptococcal target gene, primer and probe and kit | |
| CN106319055A (en) | Triple nucleic acid test kit | |
| CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
| CN112410472A (en) | Primer probe combination and detection kit for detecting mycoplasma pneumoniae, chlamydia pneumoniae and adenovirus | |
| CN107988427A (en) | Prawn hepatopancreatic parvovirus（HPV）RAA constant temperature fluorescence detection method and reagent | |
| Kobylak et al. | Real-time PCR approach in dermatophyte detection and Trichophyton rubrum identification | |
| CN109576397A (en) | A kind of human immunodeficiency virus type 1 nucleic acid quantitative determination reagent kit | |
| CN110878381A (en) | Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| WO2024055627A1 (en) | Primer-molecular beacon combination for molecular typing of wild type and mutant type of monkey poxvirus and use thereof | |
| CN112359126A (en) | Method for accurately detecting cryptococcus neoformans | |
| CN108070638B (en) | Recombinase polymerase isothermal amplification method for detecting orientia tsutsutsugamushi, special primer and probe thereof and application | |
| Bieber et al. | DNA chip‐based diagnosis of onychomycosis and tinea pedis | |
| CN115873979A (en) | Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof | |
| CN110129467A (en) | For detecting the LAMP primer composition and application of aspergillus fumigatus in intraocular liquid | |
| CN110129466A (en) | For detecting the LAMP primer composition and application of Candida albicans in intraocular liquid | |
| Wang et al. | Performance of the Real Fungus‐ID kit based on multiplex RT‐PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection | |
| CN108866216A (en) | It is a kind of for identifying the primer combination of probe of mycobacterium abscessus and Marseille mycobacteria | |
| Ahmad et al. | Development of a nested PCR assay for the detection of Fusarium solani DNA and its evaluation in the diagnosis of invasive fusariosis using an experimental mouse model | |
| CN114438238A (en) | Primer for detecting infectious endocarditis pathogen and digital PCR kit | |
| KR102247643B1 (en) | A method for diagonising mycobacterium tuberculosis and non-tuberculosis mycobacterium in 2-step way and the kit thereof | |
| CN106939359A (en) | A kind of LAMP methods detect the primer sets and detection architecture of the common hypotypes of HPV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20191230 Address after: 100020 No. 8 South Road, workers' Stadium, Beijing, Chaoyang District Applicant after: BEIJING CHAO-YANG HOSPITAL, CAPITAL MEDICAL University Address before: The three District 101300 Beijing City Renhe Town, Shunyi District LAN Xiyuan 37 building two layer (innovation function area) Applicant before: BEIJING ZHIDE MEDICAL LABORATORY CO.,LTD. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190816 |