CN110106282A - A kind of primer of quick detection sh2sh2 genotype corn and its application - Google Patents
A kind of primer of quick detection sh2sh2 genotype corn and its application Download PDFInfo
- Publication number
- CN110106282A CN110106282A CN201910536009.7A CN201910536009A CN110106282A CN 110106282 A CN110106282 A CN 110106282A CN 201910536009 A CN201910536009 A CN 201910536009A CN 110106282 A CN110106282 A CN 110106282A
- Authority
- CN
- China
- Prior art keywords
- corn
- primer
- sh2sh2
- dna
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer of quickly detection sh2sh2 genotype corn and its applications, can be quickly by the transformation of conventional corn self-mating system at super-sweet corn self-mating system using the primer.Specific primer of the invention includes nucleotide sequence upstream primer as shown in SEQ ID No.1 and the downstream primer as shown in SEQ ID No.2.Illustrated by test: the method for molecular marking supplementary breeding inbred line of sweet corn provided by the present invention can directly Rapid identification goes out the plant containing recessive gene sh2 in seedling stage, eliminate other genotype, save a large amount of unnecessary selfing identifications, improve breeding efficiency, breeding cycle is shortened, the new technology of quickly accurate transformation corn is realized.
Description
Technical field
The present invention relates to breeding of sweet fields more particularly to a kind of for quickly detecting sh2sh2 genotype corn
Primer and its application.
Background technique
Corn is a subspecies of Zea, originate from American continent, be it is a kind of integrate grain, fruit and vegetable, feeding warp
Ji type crop.Corn is a kind of fresh edible maize full of nutrition, unique in taste, is loved by consumers.With people's lives
Horizontal continuous improvement, the dietary structure of people are also changing to the consumption idea of nutrition, health, green, environmental protection.In China
Under the overall background of supply side reform, urban and rural residents are increasing to the demand of fresh edible maize.Constantly cultivate excellent corn product
Kind, more preferably high-quality fresh edible maizes are provided, are compeling for agri-scientific research constantly to meet the growing consumption demand of people
Cut one of task.
One or more related genes that corn is converted by control endosperm carbohydrate occur recessive mutation and are formed, and are
Recessive endosperm mutant.The U.S. is to carry out breeding of sweet in the world to study earliest country, and research of the China to corn
It starts late.Since China is not the centre of origin of corn, many materials are depended on from the U.S., Thailand etc. and are abroad introduced, sweet tea
The affiliation of corn is closer, and type is more single, to seriously affect the further development of China's breeding of sweet.How
Quickly shorten breeding of sweet process, cultivating new type becomes particularly important.
Currently used inbred line breeding method has a backcross transformation, the method for backcross transformation, such as plain edition corn from
Friendship is A (SH2SH2), and transformation is first beautiful with self-mating system A (SH2SH2) and some super sweet tea at super-sweet corn self-mating system A (sh2sh2)
Rice (sh2/sh2) hybridization obtains F1, and F1 is returned with self-mating system A again.In view of super-sweet corn is Recessive genes heredity, so
It is once selfed in backcross progeny, to isolate the phenotype of super-sweet corn.Then second and third time are carried out again
Backcrossing.Row selfing again after third time is returned, separates super-sweet corn phenotype, as super-sweet corn self-mating system A.Transformation one in this way
Self-mating system at least wanted for 6 generations.The method of this routine transformation needs the time long.
Summary of the invention
In order to solve the above technical problems, the present invention adopts the following technical scheme:
A kind of primer of quick detection sh2sh2 genotype corn, which is characterized in that the primer is according to sh2 sequence
Mutational site characteristic Design, the primer includes upstream primer sequence P1 and downstream primer sequence P2, wherein the upstream is drawn
The nucleotide sequence P1 of object is 5 ' GGCAAAGTAATAACATAAATGGT 3 ', as shown in SEQ ID No.1, the downstream primer
Nucleotide sequence P2 be 5 ' GGTAAGAAGAAAAAGAAGAAGGA 3 ', as shown in SEQ ID No.2.
The primer of quick detection sh2sh2 genotype corn of the invention is beautiful in conventional corn self-mating system transformation Cheng Chaotian
Application in the cultivating process of rice self-mating system, comprising the following steps:
S1The DNA of corn is extracted；
S2It is examined using downstream primer shown in upstream primer shown in SEQ ID No.1 and SEQ ID No.2 by PCR
Survey method is from step S1Sh2sh2 genotype corn is filtered out in the DNA of extraction as donor parents；
S3Back cross breeding is assisted, using conventional corn SH2SH2 as receptor parent and step S2The donor parents filtered out
Hybridized, offspring and receptor parent are returned, and obtain BC3F2 group until being most selfed afterwards through a generation, fold is selected in BC3F2
Seed to get arrive corn sh2sh2 self-mating system.
Preferably, the step S1Extract corn DNA method the following steps are included:
S1-1.65 DEG C preheating CTAB buffer；
S1-2·The fresh blade 0.2g of corn is taken to be placed in 1mL step S1-1It grinds, is transferred in CTAB buffer after preheating
In 2mL centrifuge tube；
S1-3The centrifuge tube equipped with lapping liquid is placed in 65 DEG C of water-baths, heats 30min, and jog centrifuge tube frequently；
S1-4It after being cooled to room temperature, is added with the isometric chloroform of lapping liquid and isoamyl alcohol mixed liquor, chlorine in the mixed liquor
The imitative volume ratio with isoamyl alcohol is 24: 1, jog test tube 10min；
S1-5Centrifugation 10min is carried out under the revolving speed of 10000rpm, and supernatant is gone into another 1.5mL centrifuge tube later
In；
S1-6500 μ L ethyl alcohol finally are added in the centrifuge tube equipped with supernatant, are placed in -20 DEG C of jogs and mix to generation wadding
Shape precipitating, using centrifuge separation, gained precipitating using ethyl alcohol cleaning, dry after obtain DNA product.
It is further preferred that in the CTAB buffer containing 1.17mM NaCl, 0.0016mM EDTA pH=8.0,
0.835mM Ttis-HCl pH=7.5,1.6%CTAB, 1% β-dredge base ethyl alcohol.
Preferably, the S2Middle PCR detection method the following steps are included:
S2-1.PCR it expands, will extract corn DNA is template, carries out PCR expansion using primer sequence as claimed in claim 1
Increase, response procedures are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 52 DEG C of 45 s of annealing, 72 DEG C of extension 1min, 35 recycle；
Last 72 DEG C of extensions 10min, 4 DEG C of heat preservations；
S2-210 μ L step S are taken2-1The pcr amplification product of acquisition is detected with 1% agarose gel electrophoresis, is chosen purposeful
The corn of band is as donor parents.
It is further preferred that step S2-2The purpose band length of selection is 694bp.
Preferably, step S3The auxiliary back cross breeding the following steps are included:
S3-1Conventional corn receptor parent SH2SH2 and step S is utilized2The corn donor parents sh2sh2 of screening is miscellaneous
It hands over, gained F1It is returned to obtain BC1F1 with conventional corn receptor parent；
S3-2By BC1F1Seed sowing, seedling stage screen the plant containing recessive sh2 gene using PCR detection method；
S3-3The plant containing recessive sh2 gene continues to be returned with conventional corn receptor parent；
S3-4It continues with the screening technique and screens the corn containing recessive sh2 gene in backcross generations until BC3F1, finally
It is selfed through a generation and obtains BC3F2Group, in BC3F2In select fold seed to get corn sh2sh2 self-mating system.
It is further preferred that step S3-2The PCR detection method is will to extract corn DNA as template, utilizes such as right
It is required that 1 primer sequence carries out PCR amplification, response procedures are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 52 DEG C of annealing
45s, 72 DEG C of extension 1min, 35 circulations；10 min of last 72 DEG C of extensions, 4 DEG C of heat preservations；Take 10 μ L step S2-1The PCR of acquisition expands
Volume increase object is detected with 1% agarose gel electrophoresis, screens the plant containing recessive sh2 gene.
Compared with prior art, advantageous effects of the invention: compared with traditional breeding technology, quick standard of the invention
True breeding inbred line of sweet corn method is detected by specific primer, can accurately and efficiently screen containing recessive gene sh2
Body significantly improves the Breeding Efficiency of inbred line of sweet corn by the M8003 line in backcross generations, solves the traditional breeding method period
Long problem.
Detailed description of the invention
The present invention will be further described for explanation with reference to the accompanying drawing.
Fig. 1 be the present invention relates to specific primer site design drawing；
Fig. 2 be the present invention relates to molecular labeling figure；
Fig. 3 be the present invention relates to rapid transfer flow chart.
Specific embodiment
A kind of primer of quick detection sh2sh2 genotype corn, the primer are special according to the mutational site of sh2 sequence
Sign design is as shown in Figure 1, the primer includes upstream primer sequence P1 and downstream primer sequence P2, wherein the upstream primer
Nucleotide sequence P1 is 5 ' GGCAAAGTAATAACATAAATGGT 3 ', as shown in SEQ ID No.1, the core of the downstream primer
Nucleotide sequence P2 is 5 ' GGTAAGAAGAAAAAGAAGAAGGA 3 ', as shown in SEQ ID No.2.
As shown in Figure 1-3, a kind of quick and precisely breeding inbred line of sweet corn method, includes the following steps:
S1The DNA of corn is extracted, the specific steps are as follows:
S1-1DEG C .65 preheating CTAB buffer contains 1.17mM NaCl, 0.0016mM EDTA pH=in CTAB buffer
8.0,0.835mM Ttis-HCl pH=7.5,1.6%CTAB, 1% β-dredge base ethyl alcohol；
S1-2The fresh blade 0.2g of corn is taken to be placed in 1mL step S1-1It grinds, is transferred in CTAB buffer after preheating
In 2mL centrifuge tube；
S1-3The centrifuge tube equipped with lapping liquid is placed in 65 DEG C of water-baths, heats 30min, and jog centrifuge tube frequently；
S1-4It after being cooled to room temperature, is added with the isometric chloroform of lapping liquid and isoamyl alcohol mixed liquor, chlorine in the mixed liquor
The imitative volume ratio with isoamyl alcohol is 24: 1, jog test tube 10min；
S1-5Centrifugation 10min is carried out under the revolving speed of 10000rpm, and supernatant is gone into another 1.5mL centrifuge tube later
In；
S1-6500 μ L ethyl alcohol finally are added in the centrifuge tube equipped with supernatant, are placed in -20 DEG C of jogs and mix to generation wadding
Shape precipitating, using centrifuge separation, gained precipitating using ethyl alcohol cleaning, dry after obtain DNA product.(it will add in the DNA dried
Enter ddH2O dissolves and is diluted to 50ng/ μ L, carries out PCR detection, obtains the DNA of corn)
S2It is examined using downstream primer shown in upstream primer shown in SEQ ID No.1 and SEQ ID No.2 by PCR
Survey method is from step S1It includes following that sh2sh2 genotype corn is filtered out in the DNA of extraction as donor parents institute PCR detection
Step:
S2-1.PCR it expands, will extract corn DNA is template, carries out PCR expansion using primer sequence as claimed in claim 1
Increase, response procedures are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 52 DEG C of 45 s of annealing, 72 DEG C of extension 1min, 35 recycle；
Last 72 DEG C of extensions 10min, 4 DEG C of heat preservations；
S2-210 μ L step S are taken2-1The pcr amplification product of acquisition is detected with 1% agarose gel electrophoresis, is chosen purposeful
The corn of band is as donor parents (band length 694bp), as shown in Figure 2.
S3Back cross breeding is assisted, using conventional corn SH2SH2 as receptor parent and step S2The donor parents filtered out
Hybridized, offspring and receptor parent are returned, and obtain BC3F2 group until being most selfed afterwards through a generation, fold is selected in BC3F2
Seed to get arrive corn sh2sh2 self-mating system, the specific steps are as follows:
S3-1Conventional corn receptor parent SH2SH2 and step S is utilized2The corn donor parents sh2/sh2 of screening is miscellaneous
It hands over, gained F1It is returned to obtain BC1F1 with conventional corn receptor parent；
S3-2By BC1F1Seed sowing, seedling stage screen the plant containing recessive sh2 gene using PCR detection method；
S3-3The plant containing recessive sh2 gene continues to be returned with conventional corn receptor parent；
S3-4It continues with the screening technique and screens the corn containing recessive sh2 gene in backcross generations until BC3F1, finally
It is selfed through a generation and obtains BC3F2Group, in BC3F2In select fold seed to get corn sh2sh2 self-mating system.
Embodiment described above is only preferred embodiment of the invention to be described, but protection scope of the present invention is unlimited
In above embodiments.All within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done should all wrap
Containing within protection scope of the present invention.
Sequence table
<110>Agricultural University Of Hebei
<120>a kind of primer of quickly detection sh2sh2 genotype corn and its application
<130> 2019
<141> 2019-06-20
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>artificial sequence ()
<400> 1
ggcaaagtaa taacataaat ggt 23
<210> 2
<211> 23
<212> DNA
<213>artificial sequence ()
<400> 2
ggtaagaaga aaaagaagaa gga 23
Claims (9)
1. a kind of primer of quickly detection sh2sh2 genotype corn, which is characterized in that the primer is according to the prominent of sh2 sequence
Point feature design is conjugated, the primer includes upstream primer sequence P1 and downstream primer sequence P2, wherein the upstream primer
Nucleotide sequence is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2.
2. the primer of quick detection sh2sh2 genotype corn according to claim 1 is in conventional corn self-mating system transformation
At the application in the cultivating process of super-sweet corn self-mating system.
3. application according to claim 2, which comprises the following steps:
S1The DNA of corn is extracted；
S2Using downstream primer shown in upstream primer shown in SEQ ID No.1 and SEQ ID No.2 by PCR detection method from
Step S1Sh2sh2 genotype corn is filtered out in the DNA of extraction as donor parents；
S3Back cross breeding is assisted, using conventional corn SH2SH2 as receptor parent and step S2The donor parents filtered out carry out
Hybridization, offspring and receptor parent are returned, and obtain BC3F2 group until being most selfed afterwards through a generation, fold seed is selected in BC3F2
Grain to get arrive corn sh2sh2 self-mating system.
4. application according to claim 3, which is characterized in that the step S1The method for extracting corn DNA includes following
Step:
S1-1.65 DEG C preheating CTAB buffer；
S1-2The fresh blade 0.2g of corn is taken to be placed in 1mL step S1-1Ground in CTAB buffer after preheating, be transferred to 2mL from
In heart pipe；
S1-3The centrifuge tube equipped with lapping liquid is placed in 65 DEG C of water-baths, heats 30min, and jog centrifuge tube frequently；
S1-4After being cooled to room temperature, be added with the isometric chloroform of lapping liquid and isoamyl alcohol mixed liquor, in the mixed liquor chloroform with
The volume ratio of isoamyl alcohol is 24: 1, jog test tube 10min；
S1-5Centrifugation 10min is carried out under the revolving speed of 10000rpm, later goes to supernatant in another 1.5mL centrifuge tube；
S1-6500 μ L ethyl alcohol finally are added in the centrifuge tube equipped with supernatant, be placed in -20 DEG C of jogs mix it is cotton-shaped heavy to generating
Form sediment, using centrifuge separation, gained precipitating using ethyl alcohol cleaning, dry after obtain DNA product.
5. application according to claim 4, which is characterized in that in the CTAB buffer containing 1.17mM NaCl,
0.0016mM EDTA pH=8.0,0.835mM Ttis-HCl pH=7.5,1.6%CTAB, 1% β-dredge base ethyl alcohol.
6. application according to claim 3, which is characterized in that the S2Middle PCR detection method the following steps are included:
S2-1.PCR it expands, will extract corn DNA is template, carries out PCR amplification using primer sequence as claimed in claim 1, instead
Answer program are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 52 DEG C of annealing 45s, 72 DEG C of extension 1min, 35 recycle；Last 72
DEG C extend 10min, 4 DEG C heat preservation；
S2-210 μ L step S are taken2-1The pcr amplification product of acquisition is detected with 1% agarose gel electrophoresis, and selection has purpose band
Corn as donor parents.
7. application according to claim 6, which is characterized in that step S2-2The purpose band length of selection is 694bp.
8. application according to claim 3, which is characterized in that step S3The auxiliary back cross breeding the following steps are included:
S3-1Conventional corn receptor parent SH2SH2 and step S is utilized2The corn donor parents sh2sh2 of screening hybridizes, gained
F1It is returned to obtain BC1F1 with conventional corn receptor parent；
S3-2By BC1F1Seed sowing, seedling stage screen the plant containing recessive sh2 gene using PCR detection method；
S3-3The plant containing recessive sh2 gene continues to be returned with conventional corn receptor parent；
S3-4It continues with the screening technique and screens the corn containing recessive sh2 gene in backcross generations until BC3F1, most afterwards through one
Generation selfing obtains BC3F2Group, in BC3F2In select fold seed to get corn sh2sh2 self-mating system.
9. application according to claim 8, which is characterized in that step S3-2The PCR detection method is will to extract corn
DNA is template, carries out PCR amplification, response procedures are as follows: 95 DEG C of initial denaturation 5min using primer sequence as claimed in claim 1；95℃
It is denaturalized 30s, 52 DEG C of annealing 45s, 72 DEG C of extension 1min, 35 recycle；Last 72 DEG C of extensions 10min, 4 DEG C of heat preservations；10 μ L are taken to walk
Rapid S2-1The pcr amplification product of acquisition is detected with 1% agarose gel electrophoresis, screens the plant containing recessive sh2 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910536009.7A CN110106282A (en) | 2019-06-20 | 2019-06-20 | A kind of primer of quick detection sh2sh2 genotype corn and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910536009.7A CN110106282A (en) | 2019-06-20 | 2019-06-20 | A kind of primer of quick detection sh2sh2 genotype corn and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110106282A true CN110106282A (en) | 2019-08-09 |
Family
ID=67495527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910536009.7A Pending CN110106282A (en) | 2019-06-20 | 2019-06-20 | A kind of primer of quick detection sh2sh2 genotype corn and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110106282A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3971161A (en) * | 1975-05-27 | 1976-07-27 | Northrup, King & Co. | Production of hybrid sweet corn |
| CN105075856A (en) * | 2015-09-25 | 2015-11-25 | 云南省农业科学院粮食作物研究所 | Method for breeding double recessive homozygous sweet-waxy maize hybrid through sh2 gene type super-sweet maize mutant with high starch content |
| CN106212266A (en) * | 2016-07-30 | 2016-12-14 | 南京市蔬菜科学研究所 | A kind of selection of the double-colored super-sweet corn of HUANGBAI(sic) |
| CN106868190A (en) * | 2017-04-12 | 2017-06-20 | 广东省农业科学院作物研究所 | One kind detection sh2‑iThe primer and kit of genotype corn and application |
| CN108812298A (en) * | 2018-07-16 | 2018-11-16 | 河北农业大学 | A kind of quick and precisely glutinous double recessive corn inbred line method of breeding sweet tea |
-
2019
- 2019-06-20 CN CN201910536009.7A patent/CN110106282A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3971161A (en) * | 1975-05-27 | 1976-07-27 | Northrup, King & Co. | Production of hybrid sweet corn |
| CN105075856A (en) * | 2015-09-25 | 2015-11-25 | 云南省农业科学院粮食作物研究所 | Method for breeding double recessive homozygous sweet-waxy maize hybrid through sh2 gene type super-sweet maize mutant with high starch content |
| CN106212266A (en) * | 2016-07-30 | 2016-12-14 | 南京市蔬菜科学研究所 | A kind of selection of the double-colored super-sweet corn of HUANGBAI(sic) |
| CN106868190A (en) * | 2017-04-12 | 2017-06-20 | 广东省农业科学院作物研究所 | One kind detection sh2‑iThe primer and kit of genotype corn and application |
| CN108812298A (en) * | 2018-07-16 | 2018-11-16 | 河北农业大学 | A kind of quick and precisely glutinous double recessive corn inbred line method of breeding sweet tea |
Non-Patent Citations (1)
| Title |
|---|
| 姚文华 等: ""我国甜玉米育种研究现状与发展对策"", 《中国农业科技导报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103740711B (en) | Indel marker linked with yellow flesh gene yf of cucmis sativus L. and application of Indel marker | |
| CN104521742A (en) | Method for rapidly creating sweet-waxy recessive maize inbred line | |
| CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
| CN111394508B (en) | Molecular marker linked with capsicum frutescens gene and application thereof | |
| CN107190092A (en) | For identify cabbage bloom the morning and evening molecular labeling, primer pair and molecule labelling method and application | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN101643784B (en) | Molecule marking method for identifying paddy low glutelin gene Lgcl | |
| CN105613255A (en) | Pyramiding breeding method for rice blast resisting rice variety with excellent taste | |
| CN110463599B (en) | Breeding method of direct-seeding rice | |
| CN108849485A (en) | A kind of selection of fragrant rice | |
| CN106191231A (en) | With common head cabbage wax powder-free viride nitens gene cgl 4 closely linked molecular marker and application thereof | |
| CN108531645B (en) | Functional marker of low amylose content gene wx-C39 and application thereof | |
| CN112602589B (en) | Method for rapid and accurate breeding of semi-waxy japonica rice restorer | |
| CN105875400A (en) | Method for improving gel consistency of rice with high straight-chain starch content | |
| CN109392698A (en) | A kind of Black Rice selection | |
| CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
| CN104293906A (en) | SSR molecular mark for identification of self-incompatibility of brassica campestris ssp. chinensis Makino, and application thereof | |
| CN110106282A (en) | A kind of primer of quick detection sh2sh2 genotype corn and its application | |
| CN106399498A (en) | Molecular marker assisted selection method for cauliflower flower ball pedicel length | |
| CN103931483B (en) | The selection of high resistant starch content Japonica Hybrid CMS line and restorer and application | |
| CN109287475A (en) | A kind of long grain Japonica Hybrid selection of two systems | |
| CN104756876B (en) | A kind of breeding method utilizing many small ears kind matter NAU422 improvement wheat yield | |
| Huang | Systematics and genetic variation of Actinidia | |
| CN108085404A (en) | Giant pumpkin female trait molecular marker and the primer pair of identification giant pumpkin female character by force by force | |
| CN103131755A (en) | Method for rapidly detecting brassica oleracea var. italic hybrid purity by using SRAP mark |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190809 |