CN108849485A - A kind of selection of fragrant rice - Google Patents
A kind of selection of fragrant rice Download PDFInfo
- Publication number
- CN108849485A CN108849485A CN201811052547.0A CN201811052547A CN108849485A CN 108849485 A CN108849485 A CN 108849485A CN 201811052547 A CN201811052547 A CN 201811052547A CN 108849485 A CN108849485 A CN 108849485A
- Authority
- CN
- China
- Prior art keywords
- rice
- strain
- generation
- selection
- seed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to crop genetic breeding technique fields, and in particular to a kind of selection of fragrant rice includes the following steps:1) hybridize:It is female parent with the elongated long-grained nonglutinous rice of seed, is hybridized using odor type japonica rice as male parent, obtain F1 generation strain;2) it is selfed:From F1 generation, per generation strain is selfed to F8 is obtained for strain, and per generation strain requires to be retained according to different screenings;3) retain sizing rice:F8 is planted for strain, select yield be higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, seed > 7mm strain be sizing rice;The present invention, which composes new varieties made of breeding through multigeneration, has the characteristics that rice matter is good, fragrance is good, leaf morphology is good, in good taste.
Description
Technical field
The present invention relates to crop genetic breeding technique fields, and in particular to a kind of selection of fragrant rice.
Background technique
Rice is one of most important cereal crops in the world, and about 25% energy is provided for more than 30 hundred million population of the whole world
Amount.For the resident of south east asia, energy that rice provides for it is up to 35% or more.China about 65% people with
Rice is staple food.As rice yield is continuously improved and continuous improvement of people's living standards, food flavor product of the people to rice
Matter proposes requirements at the higher level.As the fragrant rice in one of rice-cultivating type, not only there is fragrant aroma, rice fragrance, more
There is high nutritive value,《Compendium of Materia Medica》Record, scented rice can " moistening herat and lung and hundred medicines, long term usage make light of one's life by commiting suicide macrobiosis ", be known as " precious in grain
Product " are rich in protein, amino acid, alkaloid, vitamin rich in the microelements such as iron, zinc and various amino acid needed by human
Deng can directly cook pot luck, various eight treasures (choice ingredients of certain special dishes) rice porridge, sweet food cake etc..
Currently, patent No. CN201310334135 discloses a kind of selection of soft rice Fine Quality Hybrid Rice of whole spice type,
It is extensive specifically to filter out the odor type soft rice that the odor type soft rice that genotype is aabb keeps kind I and genotype is aabb
Multiple kind VI, and by odor type soft rice keep kind I and odor type soft rice restore the gene a that fragrance is controlled in kind VI and
The gene b of low Grain Amylose content is directed respectively into holding system and restorer, and is transformation sterile line with obtained holding,
Obtaining the soft rice holding of odor type that genotype is aabb is III, the high-quality restorer VIII of the soft rice of odor type and the high-quality male of the soft rice of odor type
Sterile line V with the high-quality male sterile line V of the soft rice of odor type is maternal and the high-quality restorer VIII of the soft rice of odor type assembles genotype and is
The soft rice Fine Quality Hybrid Rice Z of the whole spice type of aabb.The soft rice Fine Quality Hybrid Rice Z of the educated whole spice type of the technical solution not only yield
Height, every rice is savory, and rice is soft rice, is not brought back to life after rice is cold.
Patent No. CN201410734564 discloses the glutinous purple rice breed breeding method of perfume of a plant purple, is specifically
The purple glutinous rice variety resource of plant purple is collected respectively, and odor type glutinous rice variety resource carries out combining ability test, selects cooperation respectively
The purple glutinous rice variety I and coordinate force of the strong plant purple of power strong odor type glutinous rice variety II;The purple glutinous rice variety I of plant purple
It is middle control purple rice, purple plant channel genes odor type glutinous rice variety II in, obtain polymerization control purple rice, purple plant, fragrance,
The first generation of hybrid III of glutinous rice target gene, the glutinous purple rice strain IV of perfume of plant purple that must be stable through continuous selfed breeding, through product
Than test, multispots trial, the glutinous purple rice kind V of perfume of plant purple is obtained.The perfume for the plant purple that the technical solution is bred as is glutinous
Not only yield is high by purple rice kind V, but also plant and its rice aroma are strong, and rice pericarp is purple, waxy, has dietotherapeutic
Effect, plant seedling stage are purple in addition to root, after kernel grouting, gradually virescence.
Patent No. CN201810125975 discloses a kind of selection of hybrid rice homogeneity red rice restorer, and step is such as
Under:(1) existing wild-abortive cytoplasm restorer (C) is hybridized with the wide affinitive material of existing rice (B1), obtains first familiar generation;
(2) first familiar generation for obtaining step (1) and existing eurytopicity high-yield variety (B2) composite-crossing, obtain and C same cell
Red rice restorer (CB1B2) the MC1F1 generation of matter;(3) in the hybridization MC1F1 generation obtained step (2), is miscellaneous with red rice material (R)
It hands over, obtains red rice restorer (CB1B2R) the MC2F1 generation with C same cell matter;(4) red rice for obtaining step (3) restores
In material (CB1B2R) MC2F1 generation, carries out inbreeding of more generation culture, and offspring continuously utilizes the dominant effect and metaxenia of red rice pigment
Effect mirror choosing has excellent economical character, and brown rice is red, setting percentage >=80% stabilization strain, obtains red rice restorer
(CB1B2R), which is mainly used for the breeding of red rice restorer.
Although being referred to the method for having used hybridization, selfing, breeding in the prior art introduces new merit, this
Field personnel know different fragrant rice quality intermolecular hybrid products obtained therefroms and different screening mode selfing products obtained therefroms, fragrance class
Type and fragrance are strong and weak different, and fragrance separation degree is different, and Cooking Quality is different;Such as:It is maternal extensive with British plain spirits respectively with GHS
Multiple system first extensive 207,9311, Yue Feng account for, safe Huang account for accounted for aromatic rice Guangdong perfume (or spice), Hunan evening Xian 17, beautiful sesame oil account for, sky dragon perfume (or spice) 103,
New ten thousand is fragrant, fragrant No. 5 hybridization of wound obtains F1 cenospecies, plants each combination F1 seed and is selfed to obtain F2 seed, as the result is shown:GHS with
British plain spirits restorer first extensive 207,9311, Yue Feng is accounted for, safe Huang accounts for the F1 brown rice British plain spirits that hybridization obtains.GHS and aromatic rice Guangdong
Perfume (or spice) accounts for, Hunan evening Xian 17 hybridize obtained F1 brown rice also British plain spirits.GHS and aromatic rice jade sesame oil accounts for, sky dragon perfume (or spice) 103, new ten thousand
The F1 brown rice that fragrant, fragrant No. 5 hybridization of wound obtains is savory, but F1 brown rice flavor concentration is different, and GHS/ jade sesame oil accounts for F1 brown rice table
It is now micro-perfume, GHS/ sky dragon perfume (or spice) 103F1 brown rice shows as light perfume (or spice), and new ten thousand perfume of GHS/, the fragrant No. 5 F1 brown rice of GHS/ wound show as dense
It is fragrant.The fragrance of said combination F2 plant leaf is further identified:GHS and Guangdong perfume (or spice) accounts for, No. 17 cross combination F1 plant of Hunan evening Xian
British plain spirits, F2 separation of group go out fragrance plant, and GHS and beautiful sesame oil account for, sky dragon perfume (or spice) 103, new ten thousand perfume, create fragrant No. 5 cross combinations
F1 plant is savory, and there is no fragrance separation for F2 group.
In addition, fragrant rice fragrance is also influenced by ecological environmental condition, including weather conditions, edaphic condition etc., there is research to report
Road:Mature paddy fragrance can weaken under the high temperature conditions, conversely, such as Cold and cool climate during Grain Filling, fragrance is just denseer
(Yan Lijiao, 1995, Chinese rice, 4:27-29).Also studies have reported that:Soil property influences fragrant rice quality, fragrant rice Producing Area Soil
Organic matter, full nitrogen, alkali-hydrolyzable nitrogen, full phosphorus, the micronutrient levels such as available phosphorus contents and iron, manganese, copper, zinc are higher than non-fragrant rice and produce
Ground (Huang Shuzhen, 1990, Agriculture in Hunan science, 4:37-40).
Therefore, fragrant rice has been unable to meet demand of the modern to superior rice the problems such as there is also region limitation is strong, and
The generation of hybrid rice is that the problems such as fragrance separation is big, scent inheritance is limited by ecological environment is also urgently to be resolved.
Summary of the invention
The present invention is in order to solve the above technical problems, the present invention provides a kind of selections of fragrant rice.
Specifically realized according to following technical scheme:
A kind of selection of fragrant rice, includes the following steps:
1) hybridize:It is female parent with the elongated long-grained nonglutinous rice of seed, is hybridized using odor type japonica rice as male parent, obtain F1 generation strain;
2) it is selfed:From F1 generation, per generation strain is selfed to obtaining F8 for strain, per generation strain according to different screenings require into
Row retains;
3) retain sizing rice:F8 is planted for strain, yield is selected to be higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, seed
The strain of grain length > 7mm is sizing rice.
Further preferably, the long-grained nonglutinous rice is long-grained nonglutinous rice mutant γ -194.
Further preferably, the long-grained nonglutinous rice is Nanjing jade Xian.
Further preferably, the japonica rice is big grain perfume (or spice) rice.
Further preferably, the big grain perfume (or spice) rice is granule, meter Zhi Da national standard three-level.
Further preferably, the sizing rice contains the strain of odor type gene, big grain gene.
Further preferably, the sizing rice, setting percentage >=80%, chalky grain rate≤30%, chalkiness degree≤3%.
Further preferably, the F8 is the strain containing odor type gene, big grain gene for strain.
Further preferably, the selection of the fragrant rice specifically comprises the following steps:
The long-grained nonglutinous rice female parent and odor type japonica rice strain that S1 selects seed elongated are male parent progress, obtain F1 generation strain;
S2 kind plants F1 generation strain, and the strain of setting percentage >=80% is selected to make F2 generation;
S3 kind plants F2 for strain, and after grouting, selection plant height is 95-100cm, and the single plant of the long > 7mm of seed carries out fragrance inspection
It surveys, will have dulcet strain and carry out appearance quality detection, the strain for selecting chalkness ratio transparent lower than 30%, seed makees F3 generation;
S4 kind plants F3 for strain, and after fragrance detection and BADH2 genetic test, selection contains odor type BADH2 gene strain
Make F4 generation;
S5 kind plants F4 for strain, selects that plant and leaf shape is compact, single plant of the long > 7mm of seed carries out odor type genetic test, selection
Strain containing odor type gene makees F5 generation;
S6 kind plants F5 for strain, and the single plant of good leaf morphology, long > 7mm of seed, mass of 1000 kernel > 30g is selected to carry out appearance product
Quality detection selects the seed of chalky grain rate≤30%, chalkiness degree≤3% through odor type genetic test, selection containing odor type gene and
The strain of big grain gene makees F6 generation;
S7 kind plants F6 for strain, and after rice quality detection, selecting rice matter, good strain makees F7 generation;
S8 kind plants F7 for strain, by strain group stability, consistency and the good seed of yielding ability through rice quality detection, selection
The good strain of rice matter makees F8 generation;
S9 kind plants F8 for strain, and yield is selected to be higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, the long > 7mm of seed strain
System is sizing rice.
Further, the F5 is compact on behalf of plant type, mass of 1000 kernel > 30g, the strain of savory BADH2 gene.
Further, the rice quality detection is according to milled quality, exterior quality, Cooking Quality, nutritional quality four directions
It detected, identified in face.
Still further, the good standard of the rice matter is:1) milled quality:Coarse Rice Rate>80%, polished rice rate > 70%;2)
Exterior quality:It is chalkiness degree according to GB/T17891-1999 measurement result<2%, chalky grain rate<15%;3) Cooking Quality:According to
GB/T15682-2008 measurement result is that comprehensive score > 80 divides;4) nutritional quality:According to GB/T15683-1995 measurement result
For amylose content < 20%.
It is well put goods on the market utilization using the product cultivated of the present invention, following proof information is provided:
1.1 product characteristics
In recent years the fine quality rice variety " big grain fragrant " of Guizhou Research Institute of Rice's breeding, grain are grown up nearly ellipse, bran point and
Grain is stalk yellow, reaches 1 grade of high quality paddy standard of national standard, and expert thinks that the kind is the current top quality rice of China's long-grained nonglutinous rice
Kind, the Moli rice that quality completely can be famous with Thailand match in excellence or beauty, and are the high-end superior rice raw materials of Guizhou Mao Gong meter Ye company,
It is deep to be liked by customers inside and outside the province.
1.2 honorary titles obtained
(Huaian) the fine quality rice fair of 2002-2004 China is processed with the grain quality rice strain " big grain is fragrant " of self-fertile
" the top perfume (or spice) of thatch tribute rice " obtains gold medal.
2003-2007 " the big grain of Mao Gong is fragrant " continuous 5 acquisitions " the big gold medal rice of Chinese rice fair ten ";
Obtain within 2010 national geography sign protection product;
Obtain " Famous Chinese Brand " within 2011;
" the big grain of Mao Gong is fragrant " obtains the 11st international agriculture fair gold medal within 2013;
National rice industry conference Nobel prize is obtained in northeast Jilin within 2014 -- the very best rice prize;To obtain " China first
The good reputation of rice ".
1.3 the description of product
For big grain scented rice rich in various trace elements such as selenium, zinc, iron, the kind particle is big, is twice of general paddy, mouthfeel
It is splendid, be a kind of currently the only rice varieties, at home and uniquely a standardization, large-scale planting enterprise, should
Base soil property, water, weather are unique, and once the rice cultivation between Ming Dynasty's Jiaqing year just pays tribute imperial court as tribute rice to soil property, it
So the product 2003-2007 years unique continuous five acquisitions " Chinese ten big gold medal rice ".
The big grain scented rice grain of rice is big and Aspect Ratio is coordinated, unique outlook;This meter of bright in color, it is sparkling and crystal-clear full;It cooks juice
Such as cream, the glossy viscous profit of rice, natural faint scent, entrance is soft, flexible.Aftertaste is fragrant and sweet long, and all eaters are profuse in praise, and is
The nutraceutical that people keep fit;It is the advantages of integrating long-grained nonglutinous rice and polished rice, it is full of nutrition.
The beneficial effects of the present invention are:
The present invention selects long-grained nonglutinous rice mutant as female parent, and big grain perfume (or spice) rice is composed new made of breeding as male parent through multigeneration
Kind has the characteristics that rice matter is good, fragrance is good, leaf morphology is good, stabilization characteristics of genetics, in good taste.
Hybrid rice of the invention has the characteristic of fragrance, big grain, detects in conjunction with fragrance, appearance quality detection, gene mark
Note, stability, consistency and yielding ability have carried out advantage identification, have improved yield, quality, annidation of rice strain etc.
Character.
The present invention carries out the rice containing odor type gene, big grain gene to be selfed rice strain's annidation produced
It is good, the not interference of climate condition, edaphic condition, and the rice strain's grouting selected is fast, quality is excellent, fragrance separation is small.
Detailed description of the invention
Fig. 1:The BADH2 genetic test figure of sizing rice, wherein 1 indicates the rich B of non-odor type control vibration;2 indicate odor type control
The rich B in Guangdong;3-10 indicates the sizing rice big grain perfume (or spice) plant that the application randomly selected cultivates;Qualification result shows that the application trains
The genotype of the sizing rice big grain perfume (or spice) plant educated is odor type;
Fig. 2:The big grain gene of sizing rice detects figure, wherein 1 indicates that granule compares river 7;2 indicate that big grain is extensive to illuminating
63;3-10 indicates the sizing rice big grain perfume (or spice) plant that the application randomly selected cultivates;Qualification result shows what the application cultivated
The genotype of sizing rice big grain perfume (or spice) plant is big grain;
Fig. 3:BADH2 genetic test figure in screening process, wherein a is shown to be heterozygote;B shows that material is non-odor type
's;C shows that material is odor type;
Fig. 4:Product appearance quality figure.
Specific embodiment
Specific embodiments of the present invention will be described in further detail below, but the invention is not limited to these realities
Mode is applied, it is claimed to still fall within the claims in the present invention for any improvement or replacement on the present embodiment essence spirit
Range.
Embodiment 1
A kind of selection of fragrant rice, includes the following steps:
Nanjing jade Xian mutant γ -194 that S1 selects seed elongated is the maternal big grain perfume (or spice) rice with meter Zhi Da national standard three-level
Hybridized for male parent, obtains F1 generation strain;
S2 kind plants 20 plants of F1 generation strains, selects 80% or more setting percentage, and total 11 plants carry out mixed receipts, makees F2 generation;
S3 kind plants 5000 plants of F2 for single plant, and after grouting, selection plant height is 95-100cm, and the single plant of the long > 7mm of seed carries out
The detection of KOH method fragrance detects 300 plants of dulcet single plants of tool altogether, will have dulcet single plant and carry out appearance quality detection, choosing
The transparent strain of chalkness ratio≤30%, seed is selected, 104 plants of single plant is amounted to, 4 plants of ripe phases excessively partially late strain is eliminated when sowing,
Make F3 generation;If directlying adopt KOH method after grouting carries out fragrance detection, 4982 plants of dulcet single plants of tool are detected altogether;
S4 kind plants F3 generation into 100 strains, carries out the detection of KOH method fragrance and SSR molecular marker BADH2 genetic test, choosing
It selects containing savory BADH2 gene strain, amounts to 42 plants, make F4 generation;It directlys adopt KOH method and carries out fragrance detection, amount to 100 strains
System has fragrance;
S5 kind is planted F4 generation, and each strain plants 100 plants, selects that plant and leaf shape is compact, single plant of the long > 7mm of seed carries out SSR
Molecular labeling BADH2 genetic test selects the strain containing odor type BADH2 gene to make F5 generation, amounts to 36 strains;It directlys adopt
The detection of KOH method fragrance, amounting to 96 strains has fragrance;SSR molecular marker BADH2 gene is directlyed adopt, 95 strains are amounted to
With BADH2 gene;
S6 kind plants F5 generation, and the single plant of good leaf morphology, long > 7mm of seed, mass of 1000 kernel > 30g is selected to carry out single receipts, seed
After Appearance Quality of Paddy Rice detects, the seed of chalky grain rate≤30%, chalkiness degree≤3% is selected to identify through SSR molecular marker, selected
It selects the strain containing odor type gene and big grain gene and makees F6 generation, amount to 19 strains;The detection of KOH method fragrance is directlyed adopt, is amounted to
32 strains have fragrance;SSR molecular marker BADH2 gene is directlyed adopt, amounting to 32 strains has BADH2 gene;
S7 kind plants F6 generation, carries out the mixed receipts of seed, and by mixed sowing through rice quality detection, selecting rice matter, good strain makees F7 generation,
Amount to 16 strains;The detection of KOH method fragrance is directlyed adopt, amounting to 19 strains has fragrance;Directly adopt SSR molecular marker
BADH2 gene, amounting to 17 strains has BADH2 gene;
S8 kind is planted F7 generation, 200 plants of each strain, is carried out strain group stability, consistency and yielding ability detection, is mixed sowing
Son, by mixed sowing through rice quality detection, selecting rice matter, good strain makees F8 generation, amounts to 12 strains;Directly adopt KOH method fragrance
Detection, amounting to 16 strains has fragrance;SSR molecular marker BADH2 gene is directlyed adopt, amounting to 16 strains has BADH2
Gene;
S9 kind plant F8 generation, select yield higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, the long > 7mm of seed strain for
Sizing rice, amounts to 5 strains;The detection of KOH method fragrance is directlyed adopt, amounting to 12 strains has fragrance;Directly adopt SSR points
Son label BADH2 gene, amounting to 12 strains has BADH2 gene;
Further, the F5 is compact on behalf of plant type, mass of 1000 kernel > 30g, there is the strain of odor type gene;
Further, the sizing rice is the strain containing odor type gene, big grain gene.
The sizing rice of the present embodiment breeding is subjected to following detection, it is as a result as follows:
1.1 fragrance detection methods:
Green blade 2g is taken to shred, the KOH solution for the use of 10ml mass concentration being 1.7% impregnates the blade shredded, sealing
It impregnates, whether savory hears ten minutes later.The experiment is using British plain spirits parent Nanjing jade Xian as negative control, to have the parent of fragrance
Positive control, for the accuracy for ensuring data, each sample hears taste by 5 people, and 3 people or more think dulcet sample, fixed
Justice is savory;2 people and following think that dulcet sample identity is that fragrance is weak or nothing.
1.2 testing result:The sizing rice strain of breeding all has fragrance.
2.1 meters of quality detections:
Appearance quality detection method:GB/T17891-1999
Cooking Quality detection method:GB/T15682-2008
Nutritional quality detection method:GB/T15683-1995
2.2 testing result:
2.2.1 the results are shown in Table 1 for the analysis of sizing Qualities Qf Ricr:
Table 1
2.2.2 the performance of sizing rice yield is as shown in table 2:
Table 2
The identification method of 3.1 odor type genes:
3.1.1 the DNA of rice is extracted using CTAB method:
After A takes 0.5g blade liquid nitrogen grinding, 500 μ L CTAB extracting solutions, 65 DEG C of water-bath 30min are added;
After B is cooling, isometric chloroform (500 μ L) is added, stands 5min after being mixed by inversion;
C 12000rpm is centrifuged 10min, takes 300 μ L of supernatant into new centrifuge tube;
D is added isometric isopropanol (300 μ L) and is mixed by inversion, and is placed at room temperature for 30min;
E 12000rpm is centrifuged 10min, abandons supernatant, and the rinsing of 1ml70% ethyl alcohol is added twice;
F, after drying, 50 μ LddH2O is added to dissolve;
3.1.2 design of primers
In the website NCBI (http://www.ncbi.nlm.nih.gov) search for sequence letter near known odor type gene
Then breath passes through the website Gramen (http://www.gramene.org/gramene/Searches/ssrtool) search it is micro-
Satellite sequence utilizes 5.0 design primer of software primer premier.Forward primer sequence is:GT TA GGTT GCAT T
TACT GGGA G, reverse primer sequences are:GAA T GA T GC TCAAA GTGTC T, odor type primer size 201bp, non-perfume (or spice)
Type gene size is 209bp;
3.1.3 PCR reaction and electrophoresis detection
PCR reaction system and response procedures are as follows:
PCR reaction system (10 μ L) configures as follows
DNA profiling (50ng/ μ L) | 1.0μL |
Primer(2pmol/μL) | 1.3μL |
10xBuffer(Mg+) | 1.3μL |
dNTPs(2.5mM) | 1.0μL |
ddH2O | 5.3μL |
rTaq(5U/μL) | 0.1μL |
PCR response procedures:
PCR product 8% non-denaturing polyacrylamide gel (PAGE) electrophoresis detection.
3.2 grain lengths and grain weight gene molecule marker detection
3.2.1 DNA extraction method is same as above 3.1.1 method (i.e. CTAB method)
3.2.2 design of primers
According to the main effect QTL information for having reported control seed length and grain weight, the master of discovery GS09 label and control grain weight
Effect QTL compact linkage, therefore select GS09 (forward primer:GCAACCAAGTCCACGCTAAT, reverse primer:
TAGCCGAAGATCAGCCTCCT) as detection label, using big grain kind bright extensive 63 as positive control, with granule kind river 7
As negative control, the offspring for matching combined is detected, selects amplified fragments and bright extensive 63 consistent single plant.
3.2.3 PCR reaction and electrophoresis detection
PCR reaction system (10 μ L) configures as follows
DNA profiling (50ng/ μ L) | 1.0μL |
Primer(2pmol/μL) | 1.3μL |
10xBuffer(Mg+) | 1.3μL |
dNTPs(2.5mM) | 1.0μL |
ddH2O | 5.3μL |
rTaq(5U/μL) | 0.1μL |
PCR response procedures:
Embodiment 2
A kind of selection of fragrant rice, includes the following steps:
It is maternal and meter Zhi Da national standard three that S1, which selects Jinyou 402 (deriving from Hua Zhong Agriculture University's Botany science institute),
The big grain perfume (or spice) rice of grade is that male parent is hybridized, and obtains F1 generation strain;
S2 kind plants 20 plants of F1 generation strains, selects 80% or more setting percentage, and total 11 plants carry out mixed receipts, makees F2 generation;
S3 kind plants 5000 plants of F2 for single plant, and after grouting, selection plant height is 95-100cm, and the single plant of the long > 7mm of seed carries out
The detection of KOH method fragrance detects 300 plants of dulcet single plants of tool altogether, will have dulcet single plant and carry out appearance quality detection, choosing
The transparent strain of chalkness ratio≤30%, seed is selected, 104 plants of single plant is amounted to, 4 plants of ripe phases excessively partially late strain is eliminated when sowing,
Make F3 generation;If directlying adopt KOH method after grouting carries out fragrance detection, 4976 plants of dulcet single plants of tool are detected altogether;
S4 kind plants F3 generation into 100 strains, carries out the detection of KOH method fragrance and SSR molecular marker BADH2 gene, selection contain
There are odor type gene and BADH2 gene strain, amounts to 42 plants, make F4 generation;It directlys adopt KOH method and carries out fragrance detection, amount to 99
Strain has fragrance;
S5 kind is planted F4 generation, and each strain plants 100 plants, selects that plant and leaf shape is compact, single plant of the long > 7mm of seed carries out SSR
Molecular labeling BADH2 genetic test selects the strain containing odor type BADH2 gene to make F5 generation, amounts to 36 strains;It directlys adopt
The detection of KOH method fragrance, amounting to 96 strains has fragrance;Using SSR molecular marker BADH2 gene, total 94 strains have
BADH2 gene;
S6 kind plants F5 generation, and the single plant of good leaf morphology, long > 7mm of seed, mass of 1000 kernel > 30g is selected to carry out single receipts, seed
After Appearance Quality of Paddy Rice detects, the seed of chalky grain rate≤30%, chalkiness degree≤3% is selected to identify through SSR molecular marker, selected
It selects the strain containing odor type gene and big grain gene and makees F6 generation, amount to 19 strains;The detection of KOH method fragrance is directlyed adopt, is amounted to
30 strains have fragrance;Using SSR molecular marker BADH2 gene, amounting to 30 strains has BADH2 gene;
S7 kind plants F6 generation, carries out the mixed receipts of seed, and by mixed sowing through rice quality detection, selecting rice matter, good strain makees F7 generation,
Amount to 16 strains;The detection of KOH method fragrance is directlyed adopt, amounting to 19 strains has fragrance;Utilize SSR molecular marker BADH2
Gene, amounting to 19 strains has BADH2 gene;
S8 kind is planted F7 generation, 200 plants of each strain, is carried out strain group stability, consistency and yielding ability detection, is mixed sowing
Son, by mixed sowing through rice quality detection, selecting rice matter, good strain makees F8 generation, amounts to 12 strains;Directly adopt KOH method fragrance
Detection, amounting to 15 strains has fragrance;Using SSR molecular marker BADH2 gene, amounting to 14 strains has BADH2 gene;
S9 kind plant F8 generation, select yield higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, the long > 7mm of seed strain for
Sizing rice, amounts to 5 strains;The detection of KOH method fragrance is directlyed adopt, amounting to 12 strains has fragrance;Utilize SSR molecule mark
Remember BADH2 gene, amounting to 12 strains has BADH2 gene;
Further, the F5 is compact on behalf of plant type, mass of 1000 kernel > 30g, there is the strain of odor type gene;
Further, the sizing rice is the strain containing odor type gene, big grain gene.
The sizing rice of the present embodiment breeding is subjected to following detection, it is as a result as follows:
1.1 fragrance detection methods:
Green blade 2g is taken to shred, the KOH solution for the use of 10ml mass concentration being 1.7% impregnates the blade shredded, sealing
It impregnates, whether savory hears ten minutes later.The experiment is using British plain spirits parent Nanjing jade Xian as negative control, to have the parent of fragrance
Positive control, for the accuracy for ensuring data, each sample hears taste by 5 people, and 3 people or more think dulcet sample, fixed
Justice is savory;2 people and following think that dulcet sample identity is that fragrance is weak or nothing.
1.2 testing result:The sizing rice strain of breeding all has fragrance.
2.1 meters of quality detections:
Appearance quality detection method:GB/T17891-1999
Cooking Quality detection method:GB/T15682-2008
Nutritional quality detection method:GB/T15683-1995
2.2 testing result:
2.2.1 the results are shown in Table 3 for the analysis of sizing Qualities Qf Ricr:Table 3
2.2.2 the performance of sizing rice yield is as shown in table 4:
Table 4
Project | |
Yield (kg/667m2) | 467.5 |
Plant height (cm) | 122.7 |
Effective fringe/fringe | 17.5 |
Grain number per spike (grain) | 160.0 |
Setting percentage (%) | 82.6 |
Mass of 1000 kernel (g) | 41.4 |
Embodiment 3
Yellow soil, red soil, mountain meadow soil, terra rossa, black is respectively adopted in the resulting sizing rice of embodiment 1
Colored stone dirt, admaic earth, bog soil, rice soil are planted, and every piece of plantation ground area is identical, and planting number is identical, plantation one
Nian Hou carries out fragrance detection and rice quality detection using KOH method, as a result respectively as shown in table 5 and table 6:
5 fragrance testing result of table
6 meters of quality detection results of table
As shown in Table 5:Yellow soil, red soil, mountain meadow soil, terra rossa, black stone is respectively adopted in sizing rice
Dirt, admaic earth, bog soil, rice soil are planted, and fragrance separation is smaller;As shown in Table 6:Rice of being formed uses different soil
The plantation of earth type, Cooking Quality are all larger than 80 points;It can thus be appreciated that:Edaphic condition is low to the perturbed force of sizing rice, life
State adaptability is preferable.
Embodiment 4
By the resulting sizing rice of embodiment 1 respectively in Chongqing, Guizhou, Guangdong, Hunan, Guangxi, Jiangxi, Wuhan each department
Planted, each department plant ground area it is identical, planting number is identical, plantation 1 year after, use KOH method carry out fragrance detection with
And rice quality detection, as a result respectively as shown in table 7 and table 8:
7 fragrance testing result of table
Planting area | Plant strain number/strain | There is fragrant strain number/strain | Without fragrant strain number/strain |
Chongqing | 500 | 495 | 5 |
Guizhou | 500 | 498 | 2 |
Guangdong | 500 | 489 | 11 |
Hunan | 500 | 487 | 13 |
Guangxi | 500 | 488 | 12 |
Jiangxi | 500 | 490 | 10 |
Wuhan | 500 | 488 | 12 |
8 meters of quality detection results of table
As shown in Table 7:Rice of being formed is carried out in Chongqing, Guizhou, Guangdong, Hunan, Guangxi, Jiangxi, Wuhan each department respectively
Plantation, fragrance separation are smaller;As shown in Table 8:Rice be formed respectively in Chongqing, Guizhou, Guangdong, Hunan, Guangxi, Jiangxi, force
Chinese each department are planted, and Cooking Quality is all larger than 80 points;It can thus be appreciated that:Rice of being formed is poor in the plantation situation of different zones
Seldom, annidation is preferable.
Claims (8)
1. a kind of selection of fragrant rice, which is characterized in that include the following steps:
1) hybridize:It is female parent with the elongated long-grained nonglutinous rice of seed, is hybridized using odor type japonica rice as male parent, obtain F1 generation strain;
2) it is selfed:From F1 generation, per generation strain is selfed to F8 is obtained for strain, and per generation strain requires to be protected according to different screenings
It stays;
3) retain sizing rice:F8 is planted for strain, selection yield is higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, seed is long
The strain of > 7mm is sizing rice;
The long-grained nonglutinous rice is long-grained nonglutinous rice mutant γ -194;
The japonica rice is the big grain perfume (or spice) rice of meter Zhi Da national standard three-level.
2. the selection of fragrant rice as described in claim 1, which is characterized in that the long-grained nonglutinous rice is Nanjing jade Xian.
3. the selection of fragrant rice as described in claim 1, which is characterized in that the sizing rice contains odor type base
Cause, the strain of big grain gene.
4. the selection of fragrant rice as described in claim 1, which is characterized in that the sizing rice, setting percentage >=
80%, chalky grain rate≤30%, chalkiness degree≤3%.
5. the selection of fragrant rice as described in claim 1, which is characterized in that the F8 is to contain odor type base for strain
Cause, the strain of big grain gene.
6. the selection of fragrant rice as described in claim 1, which is characterized in that specifically comprise the following steps:
The long-grained nonglutinous rice female parent and odor type japonica rice strain that S1 selects seed elongated are male parent progress, obtain F1 generation strain;
S2 kind plants F1 generation strain, and the strain of setting percentage >=80% is selected to make F2 generation;
S3 kind plants F2 for strain, and after grouting, selection plant height is 95-100cm, and the single plant of the long > 7mm of seed carries out fragrance detection, will
Have dulcet strain and carry out appearance quality detection, the strain for selecting chalkness ratio transparent lower than 30%, seed makees F3 generation;
S4 kind plants F3 and selects the strain containing odor type BADH2 gene to make after fragrance detection and BADH2 genetic test for strain
F4 generation;
S5 kind plants F4 for strain, selects that plant and leaf shape is compact, single plant of the long > 7mm of seed carries out fragrance detection, and selection is containing savory
Strain make F5 generation;
S6 kind plants F5 for strain, and the single plant of good leaf morphology, long > 7mm of seed, mass of 1000 kernel > 30g is selected to carry out exterior quality inspection
It surveys, selects the seed of chalky grain rate≤30%, chalkiness degree≤3% through odor type genetic test, selection contains odor type gene and big grain
The strain of gene makees F6 generation;
S7 kind plants F6 for strain, and after rice quality detection, selecting rice matter, good strain makees F7 generation;
S8 kind plants F7 for strain, by strain group stability, consistency and the good seed of yielding ability through rice quality detection, selects rice matter
Good strain makees F8 generation;
S9 kind plants F8 for strain, select yield higher than 400Kg/ mus, mass of 1000 kernel > 30g, transparent, the long > 7mm of seed strain for
Sizing rice.
7. the selection of fragrant rice as described in claim 1, which is characterized in that the F5 is compact on behalf of plant type, thousand
Weight > 30g, there is the strain of odor type BADH2 gene.
8. the selection of fragrant rice as described in claim 1, which is characterized in that the good standard of the rice matter is:1) it grinds
Grind quality:Coarse Rice Rate>80%, polished rice rate > 70%;2) exterior quality:It is chalkiness degree according to GB/T17891-1999 measurement result
<2%, chalky grain rate<15%;3) Cooking Quality:It is that comprehensive score > 80 divides according to GB/T15682-2008 measurement result;4) it seeks
Support quality:It is amylose content < 20% according to GB/T15683-1995 measurement result.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811052547.0A CN108849485A (en) | 2018-09-10 | 2018-09-10 | A kind of selection of fragrant rice |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811052547.0A CN108849485A (en) | 2018-09-10 | 2018-09-10 | A kind of selection of fragrant rice |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108849485A true CN108849485A (en) | 2018-11-23 |
Family
ID=64323803
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811052547.0A Pending CN108849485A (en) | 2018-09-10 | 2018-09-10 | A kind of selection of fragrant rice |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108849485A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113661917A (en) * | 2021-06-29 | 2021-11-19 | 高邮周邶墩农业发展有限公司 | Method for breeding granular indica-japonica intermediate type wide-compatibility restorer line |
CN114667926A (en) * | 2022-04-24 | 2022-06-28 | 安徽真金彩种业有限责任公司 | Method for cultivating new aromatic rice variety |
CN115152618A (en) * | 2022-07-25 | 2022-10-11 | 安徽袁粮水稻产业有限公司 | Method for genetic improvement of rice aroma quality |
CN116420615A (en) * | 2023-03-18 | 2023-07-14 | 江苏沿海地区农业科学研究所 | Breeding method for screening conventional indica rice or indica rice restorer line with fragrance |
-
2018
- 2018-09-10 CN CN201811052547.0A patent/CN108849485A/en active Pending
Non-Patent Citations (1)
Title |
---|
蒋志谦: "优质水稻新品系大粒香的选育及应用", 《贵州农业科学》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113661917A (en) * | 2021-06-29 | 2021-11-19 | 高邮周邶墩农业发展有限公司 | Method for breeding granular indica-japonica intermediate type wide-compatibility restorer line |
CN114667926A (en) * | 2022-04-24 | 2022-06-28 | 安徽真金彩种业有限责任公司 | Method for cultivating new aromatic rice variety |
CN115152618A (en) * | 2022-07-25 | 2022-10-11 | 安徽袁粮水稻产业有限公司 | Method for genetic improvement of rice aroma quality |
CN116420615A (en) * | 2023-03-18 | 2023-07-14 | 江苏沿海地区农业科学研究所 | Breeding method for screening conventional indica rice or indica rice restorer line with fragrance |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108849485A (en) | A kind of selection of fragrant rice | |
CN111264380B (en) | Breeding method of colored rice two-line hybrid rice | |
CN103740711B (en) | Indel marker linked with yellow flesh gene yf of cucmis sativus L. and application of Indel marker | |
Naz et al. | Assessment of genetic diversity within germplasm accessions in tomato using morphological and molecular markers. | |
LI et al. | Genetic diversity within a jackfruit (Artocarpus heterophyllus Lam.) germplasm collection in China using AFLP markers | |
CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
CN107083333A (en) | Climb No. 1 ganoderma lucidum new strains of sesame and its propagation method | |
CN104928396A (en) | Method for rapidly identifying hot pepper species and golden pepper purity degree by using EST-SSR molecular markers | |
CN108377901B (en) | Continuous multi-generation bud mutation seed selection and method for continuously improving apple red character by combining with crossbreeding | |
CN104004749A (en) | SSR marked primer linked to cucumis sativus black fruit thorn gene B and application thereof | |
CN109852725A (en) | A kind of method of fruit resistant storage properties that identifying apple plants and its primer pair that uses | |
CN112813180B (en) | Molecular marker and primer pair for identifying cabbage leaf wax powder character and application thereof | |
Deka et al. | Taxonomic distinction of Calamus nambariensis Becc., in Northeast India based on morphological and molecular markers. | |
CN109392695A (en) | A kind of big grain odor type high-grade rice high-efficient method for cultivating | |
Nwankwo et al. | X-ray Induced Genetic Variability in Amaranthus hybridus L. and Analysis of Variants Using Morphological and Random Amplified Polymorphic DNA Data | |
Zheng et al. | Assessment of genetic diversity of sweet sorghum collection using phenotypic variation and ssr markers | |
CN114431134B (en) | Breeding method of hybrid color rice | |
フオンファム TM et al. | Genetic variation of shallot (Allium cepa L. Aggregatum Group) in Vietnam | |
CN108148928A (en) | The molecular labeling and its screening technique of QTL close linkages related to rice meal taste | |
CN114931093B (en) | Breeding method of high-efficiency, large-spike, long-and-thin-grain, low-chalkiness and high-quality conventional fragrant rice and application thereof | |
CN115336510B (en) | Polymerization breeding method of special multi-resistance wheat variety for white spirit starter propagation | |
CN113812340B (en) | Cucumber with white peel and its use | |
CN117016377A (en) | Breeding method of high-yield and high-quality fragrant blood glutinous No. 2 | |
Mohammed et al. | Effect of Crossability in Improving Some Selected Cowpea (Vigna Unguiculata [L.,] Walp) Varieties |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |