CN110106161B - Penicillin acylase gene and protein coded by same - Google Patents
Penicillin acylase gene and protein coded by same Download PDFInfo
- Publication number
- CN110106161B CN110106161B CN201910385295.1A CN201910385295A CN110106161B CN 110106161 B CN110106161 B CN 110106161B CN 201910385295 A CN201910385295 A CN 201910385295A CN 110106161 B CN110106161 B CN 110106161B
- Authority
- CN
- China
- Prior art keywords
- ala
- leu
- gly
- arg
- pro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
- C12N9/84—Penicillin amidase (3.5.1.11)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
- C12Y305/01011—Penicillin amidase (3.5.1.11), i.e. penicillin-amidohydrolase
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a penicillin acylase gene and a coding protein thereof, wherein the nucleic acid sequence of the penicillin acylase gene is shown as SEQ ID NO.1, and the coding protein of the penicillin acylase gene has an amino acid sequence shown as SEQ ID NO. 2. The penicillin acylase of the invention has good stability and activity in industrial practical application.
Description
Technical Field
The invention relates to the field of biological genes, in particular to a penicillin acylase gene and a coding protein thereof.
Background
Penicillin and cephamycin belong to the same group of beta-lactam antibiotics and are considered to be the most promising antibiotics. In the field of medicine, the application of beta-lactam antibiotics is very wide, the industrial yield is high, and a great deal of economic value is created. However, due to the problem of antibiotic resistance, there is a continuing need to improve the chemical structure of this type of antibiotic in order to increase its susceptibility to resistant bacteria. One of the most effective ways is to change the side chain groups of this type of antibiotic and thus its antibacterial properties. The modification of the side chain group is usually carried out by chemical or enzymatic methods. The chemical method has serious environmental pollution and high toxicity and is gradually eliminated. The enzyme method is highly efficient and environmentally friendly, and is highly appreciated.
Penicillin acylases, also known as penicillin amidases or penicillin aminohydrolases. The enzyme can catalyze penicillin or cephamycin to hydrolyze to generate 6-aminopenicillanic acid (6-APA) or 7-aminocephalosporanic acid (7-ACA), and can also catalyze penicillin acylation reaction, so that the 6-ACA or 7-ACA can be used for synthesizing novel antibiotics. The enzyme produced by certain microorganisms has been applied on a large scale to the industrial production of key intermediates of beta-lactam antibiotics and to semi-synthetic beta-lactam antibiotics. However, penicillin acylases from different microorganisms have different characteristics in the aspects of catalytic property, efficiency, stability and the like, so that the penicillin acylase is suitable for different application scenes.
Disclosure of Invention
The object of the present invention is to provide a penicillin acylase gene and a protein encoded by the same.
The nucleic acid sequence of the penicillin acylase gene provided by the invention is shown in SEQ ID NO. 1.
The invention also provides a protein coded by the penicillin acylase gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.
The penicillin acylase gene is obtained by extracting metagenomic DNA from 10 dental plaque mixtures on dental surfaces from different sources by using a kit through metagenomic technology and directly carrying out PCR amplification on the extracted DNA.
The penicillin acylase coded by the penicillin acylase gene can maintain higher activity in an environment of 45 ℃, shows good stability in daily storage and transportation, and meets the requirements of industrial practical application.
Drawings
FIG. 1 is an electropherogram of the PCR product in step 1 of example 1.
FIG. 2 is a map of a recombinant plasmid in step 4 of example 1.
Detailed Description
The invention is further illustrated by the following figures and examples. The following experimental methods, in which specific conditions are not specified, were carried out according to the conventional experimental conditions in the art or the conditions recommended by the manufacturers.
The nucleic acid sequence of the penicillin acylase gene is shown as SEQ ID NO. 1.
The amino acid sequence of the coding protein of the penicillin acylase gene is shown as SEQ ID NO. 2.
The penicillin acylase gene source described in this application was prepared from a mixture of 10 dental plaque on the dental surface from different sources, by metagenomic techniques, using a kit (mobilo brand,
DNA Isolation Kit, 14900-50-NF, USA) and directly carrying out PCR amplification on the extracted DNA.
Example 1
Construction of protein expression vector of penicillin acylase gene by molecular cloning technology
1. Directly carrying out PCR amplification (50 mu l system) on the extracted metagenome DNA
Upstream primer GTTAGCAGCCGGATCATGGAGACGACGATGGCGCGA
Downstream primer ATATGCTCGAGGATCCTACCGTGAAAACAAGAGCGTATGTTGGGC
And (3) PCR system:
PCR procedure:
pre-denaturation at 95 ℃ for 2min, (denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 150s) X35 cycles, and final extension at 72 ℃ for 10 min.
The PCR product was identified by agarose gel electrophoresis, and the result is shown in FIG. 1, lane M is Takara 250bp DNA ladder marker, and lane 1 is the target gene.
The PCR product obtained in the step is sequenced by using a sanger method (ABI 3730xl sequencer performs bidirectional sequencing, the sequencing primers are the upstream primer and the downstream primer, and are completed by Yingjun biology company, Guangzhou), so that the nucleic acid sequence of the penicillin acylase gene is obtained, and is shown as SEQ ID NO. 1.
The nucleic acid sequence is translated into a protein sequence according to the triplet codon. The protein sequence is subjected to NCBI Blast alignment search, and the obtained sequence with the highest homology is the protein sequence recorded by Genbank WP-047822973.1 and has 82.71% amino acid homology.
2. Glue recovery
The bands of interest in the PCR product of step 1 were recovered by tapping using an Omega gel recovery kit, cat # D2500-01. The concentration of the PCR product of the gene after gel recovery was adjusted to 50 ng/. mu.l as a substrate for the subsequent in fusion ligation reaction for ligation to an expression vector.
3. Preparation of linearized expression plasmids protein expression vectors were constructed:
selecting pET15b as plasmid vector, first cutting the vector
Keeping the temperature at 37 ℃ for 30min
The cleavage products were identified by agarose gel electrophoresis, and the bands of the cleavage products were recovered using the omega kit described above. The gel recovery product concentration was 27 ng/. mu.l. The above is the prepared linearized plasmid vector for the subsequent In fusion reaction.
4. In-Fusion ligation
And connecting the purified PCR product with a plasmid expression vector to construct an expression vector.
Keeping the temperature at 50 deg.C for 15min, and placing on ice
The recombinant plasmid map is shown in FIG. 2.
5. Transformation of
Adding 10 μ l of ligation product obtained by In-Fusion ligation into Escherichia coli NEB-10beta competent cells, mixing, ice-bath for 30min, heat shock at 42 deg.C for 45s, ice-bath for 2min, coating LB plate (with ampicillin resistance), placing the plate In incubator, and culturing to obtain monoclonal colony.
6. Verification of monoclonals
And (3) selecting the monoclonal colony to 10 mu l of sterile water, blowing and uniformly mixing, taking 1 mu l of sterile water as a template (10, with the number of 1-10) to perform colony PCR, and verifying whether the target gene is connected to a plasmid vector.
And (3) PCR system:
comparison:
PCR procedure: pre-denaturation at 94 ℃ for 10min, (denaturation at 94 ℃ for 30 s; annealing at 55 ℃ for 30 s; extension at 72 ℃ for 2.5min) x 35cycles, and finally extension at 72 ℃ for 10 min. And (5) performing electrophoresis detection on the PCR product, and judging whether the target gene is successfully connected with the vector or not according to the existence and the size of the target band.
7. Sequencing verification and construction of expression strain
And (3) taking a sample bacterium with a target band, inoculating the sample bacterium into a liquid LB culture medium with ampicillin resistance, culturing overnight, sending the bacterium liquid to Guangzhou Yingjun biological company for sequencing verification, and sequencing by using T7 upstream and downstream universal sequencing primers to show that the sequence is correct. Then, plasmid DNA of the sample was extracted, the plasmid DNA was transformed into E.coli ER2566 cells (host bacteria for protein expression), and ER2566 was cultured overnight.
Example 2
Protein expression part:
1. inducible expression
1) 300. mu.L of the overnight-cultured bacterial suspension obtained in step 7 of example 1 was added to 30mL of LB, and ampicillin was added thereto, and the mixture was cultured at 37 ℃ and 200 rpm.
2) After about 2 hours, the OD was measured, and when the OD reached 0.5 (0.3-0.5), IPTG was added to a final concentration of 0.1mM, followed by culturing at 20 ℃ and 200rpm for 12 hours.
2. Cell lysis by enzyme method (30mL bacterial liquid)
1) The cells were collected by centrifugation at 4000g for 10min, and the supernatant was removed and washed once with high purity water (the supernatant was removed by centrifugation after resuspending the pellet with high purity water).
2) The pellet corresponding to each 30mL of inoculum was resuspended in 1.2mL of cell lysis buffer (pH 8.5), which was required to ensure the addition of PMSF.
3) Adding lysozyme powder to a final concentration of 1mg/mL, mixing well, and performing ice bath for 30 min.
4) The tube was transferred to a shaker, the lid was tightened, placed at 45 ℃ tilt, 230rpm, 25 ℃ and shaken for 10 min.
5) Triton X-10012. mu.L (final concentration: 1%), DNase 0.5. mu.L and RNase 1. mu.L (final concentration: 5. mu.g/mL) were added, and the mixture was shaken at 230rpm and 25 ℃ for 15 min.
6) Centrifugation was carried out at 12000g for 15min at 4 ℃ to obtain a supernatant as a soluble protein fraction and a precipitate as a cell debris and an insoluble protein fraction. The supernatant was used for subsequent experiments.
The protein sequence of the penicillin acylase expressed by genetic engineering recombination in the supernatant is shown as SEQ ID NO. 2.
3. Activity detection
According to the method of the literature (construction of engineering bacteria producing penicillin G acylase [ J ]. proceedings of Ministry of agriculture in Gansu, 2016,51(01): 132-one 137) of Shaowan, Wuzhuoying, Zhang Yongling, Yang Fumin, Gentianqing), the activity of penicillin acylase in the supernatant is determined, and can reach 56U/mL.
Protein expression was also performed using the protein sequence of WP _047822973.1 recorded in Genbank, as described above. The penicillin acylase of the invention and the enzyme WP _047822973.1, each taking 100U total, were carried out in parallel as follows: the protein was retained by filtration through a 10kDa ultrafiltration membrane, and the protein retained by the membrane was resuspended in an equal volume of purified water having a pH of 7.0. The temperature is kept at 45 ℃ for 72 hours. Before and after incubation, each sample was assayed for enzyme activity. The enzyme protein of the invention still has 84% of enzyme activity after 72 hours. The enzyme protein derived from the WP _047822973.1 sequence retained only 67% of the enzyme activity. The above results show that the enzyme protein of the present invention has better stability and activity compared to WP _ 047822973.1.
When penicillin acylases are used in the daily industrial sector, logistics and storage are generally required for transporting the enzyme preparation from the enzyme plant to the antibiotic manufacturer. In some cases, the enzyme activity is easily reduced due to the influence of adverse factors such as high air temperature, long transportation time, long storage time in a warehouse and the like, thereby causing economic loss. The enzyme stability determination method simulates the daily storage and transportation of enzyme products, and shows that the penicillin acylase of the invention has better stability in industrial practical application.
Sequence listing
<110> Fujian medical university affiliated oral hospital
<120> penicillin acylase gene and protein encoded thereby
<130> 2019
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2421
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
atggagacga cgatggcgcg acgggcatgg ctgatctggg gacggcgtac gctgctgctg 60
atcctggccc tggtgttgct ggccgtgctg ggtgtctggc tgttcctgcg tgccagcctg 120
gcgcagctcg acggcaaggt cgtgtcgccg cagctgagcg gttccgtgac cgtcacgcgc 180
gacgccaacg gcgtgccgac gatcagcggc gccgaccgga tcgacctggc ctatgccgcc 240
ggctacgtgc acgcccagga gcgcttcttc cagatggacc tgctgcgccg cagcgccgcc 300
ggcgagctgg ccgagctgtt cgggccgaag gcgctgccgc tcgaccgcgc gcatcgcctg 360
caccgcttcc gcgcccgtgc gctcgaggcg ctggcgcgcc tgagcccgga gcagcgccgc 420
ttcgtcgagc gctatgccgc cggcgtcaac gacggcctga atgcgctcgg cgcacggccc 480
ttcgaatatg cgctgaccgg cgccagaccg cggccctgga ccgcagccga ttcgctgctg 540
acggtgtggg ccatgtacat cgatttgcag ggcaaccagg aggcacgcga cctggcgcgc 600
ggctggctgg caagccacac cacgcctgag cagcgcgcct tcctgatgcc cgaagccagc 660
cgctgggatg cgccgctcga cgcccccggc gtggatgtgg ccgcggcggc cgtgcccgcc 720
gcgccgcccg catggtggca ccgcaaggat gcgctgccgg cgcgccaggt ggccggcatc 780
gatttcaccg acgcggtcgg cagcaacaac tatgcggtgg ccggcacgcg caccgccagc 840
ggggcggcga tcgtctcgga cgacatgcac ctcggcctgc agttgccgaa tacctggtac 900
cggctggcgc tgcgctttcc cgacgcgcaa ggcgggcagc ggcgcgtggt cggcgtaagc 960
ctgccgggcg cgccgccgct ggtgatcgtc ggcagcaatg gccatgtggc ctgggccttc 1020
accaacagct atgccgacac gctcgacctg gtccgcctgg gcaccgaccg cgcacgcgcc 1080
gggcaggtac ggacgccggc cggctgggag acgccgctgg aaaaggtcga gacgattttg 1140
gtgaaaggcc agccggccga acgcgtgctc gtgcgcgaga ccagcctggg accgatccgc 1200
gaagccggcg gcgaactcta tgcgatccac tggatcgcgc atgcgccgca ggcggtcaac 1260
ctcgaacacc tgcgcatgga aaccgcgacc acgctggacg acgcgatggc ggtggcggcc 1320
gtcgacggta tcccggcgca gaacatcctg atcggcgacg agcgcggcaa tatcggctgg 1380
accgtcgccg gcatcctgcc gcaccgtccc gcggccggcc gcgggctggc cgtgtccttc 1440
ccgctggacg cgagcggcag cgttccggcc tgggacggcg tgctggcgcc ggccgactat 1500
ccgcatgtgg tgaatccgcc gggtgggcaa ctggtgaccg ccaacaaccg ccagctggcc 1560
ggaccgaacg cgcaagtgct cggcgacggc ggcttcgacc tcggcgcgcg tgcgcgccag 1620
ctgggcgagg gcgtgcgcag cctgggcgac aagaccgacg tgccggccac cttccgcgcg 1680
gcgctcgacg atcgcgcgct gttcgtgcag gagtggcgcg agcgcgccct ggcggcgctc 1740
gacgacgcgg ccgtcgccgg ccatccggag cgtgcggagt tccgccgcct gctgaaggaa 1800
agctgggatg gccatgccag caccggctcg gtcggctacc gcctggcgca gcagttccgc 1860
tggtcgctgt acgagctggt gttcgccggc gcgaatgccg agatggccag gctcgatccg 1920
aaggccagca tgcagagcgc cagctcgcgc tggtcggcgg tgctggcgcg cctgctggac 1980
gagcgcccgg cggcctggct gccgtccggc tatgccagct ggcaggacct gcagctggcc 2040
gcggtcgacc gcacgatccg cgatgtcacc aaggacggca cgccgctggc ccgggccacc 2100
tggggcgcgc gcaacacggc ggcgatcgcg catccgatca gcatggcgct gcctttcctg 2160
aagcgttggc tgggcgcgcc gcccgaccag ctgccgggcg acgccaacat gccgcgcgtg 2220
gcagggccga agttcggcca gtcggagcgc ctgacggtgt cgccggggcg ggaagaagag 2280
gggctgttcg acatgcccgg cgggcagagc gggcatccgc tgtcgccctg gttcctgggc 2340
gggcatgcgg actgggtgcg cgggaagccg accccgctgc tgccggggcc ggcccaacat 2400
acgctcttgt tttcacggta g 2421
<210> 2
<211> 806
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 2
Met Glu Thr Thr Met Ala Arg Arg Ala Trp Leu Ile Trp Gly Arg Arg
1 5 10 15
Thr Leu Leu Leu Ile Leu Ala Leu Val Leu Leu Ala Val Leu Gly Val
20 25 30
Trp Leu Phe Leu Arg Ala Ser Leu Ala Gln Leu Asp Gly Lys Val Val
35 40 45
Ser Pro Gln Leu Ser Gly Ser Val Thr Val Thr Arg Asp Ala Asn Gly
50 55 60
Val Pro Thr Ile Ser Gly Ala Asp Arg Ile Asp Leu Ala Tyr Ala Ala
65 70 75 80
Gly Tyr Val His Ala Gln Glu Arg Phe Phe Gln Met Asp Leu Leu Arg
85 90 95
Arg Ser Ala Ala Gly Glu Leu Ala Glu Leu Phe Gly Pro Lys Ala Leu
100 105 110
Pro Leu Asp Arg Ala His Arg Leu His Arg Phe Arg Ala Arg Ala Leu
115 120 125
Glu Ala Leu Ala Arg Leu Ser Pro Glu Gln Arg Arg Phe Val Glu Arg
130 135 140
Tyr Ala Ala Gly Val Asn Asp Gly Leu Asn Ala Leu Gly Ala Arg Pro
145 150 155 160
Phe Glu Tyr Ala Leu Thr Gly Ala Arg Pro Arg Pro Trp Thr Ala Ala
165 170 175
Asp Ser Leu Leu Thr Val Trp Ala Met Tyr Ile Asp Leu Gln Gly Asn
180 185 190
Gln Glu Ala Arg Asp Leu Ala Arg Gly Trp Leu Ala Ser His Thr Thr
195 200 205
Pro Glu Gln Arg Ala Phe Leu Met Pro Glu Ala Ser Arg Trp Asp Ala
210 215 220
Pro Leu Asp Ala Pro Gly Val Asp Val Ala Ala Ala Ala Val Pro Ala
225 230 235 240
Ala Pro Pro Ala Trp Trp His Arg Lys Asp Ala Leu Pro Ala Arg Gln
245 250 255
Val Ala Gly Ile Asp Phe Thr Asp Ala Val Gly Ser Asn Asn Tyr Ala
260 265 270
Val Ala Gly Thr Arg Thr Ala Ser Gly Ala Ala Ile Val Ser Asp Asp
275 280 285
Met His Leu Gly Leu Gln Leu Pro Asn Thr Trp Tyr Arg Leu Ala Leu
290 295 300
Arg Phe Pro Asp Ala Gln Gly Gly Gln Arg Arg Val Val Gly Val Ser
305 310 315 320
Leu Pro Gly Ala Pro Pro Leu Val Ile Val Gly Ser Asn Gly His Val
325 330 335
Ala Trp Ala Phe Thr Asn Ser Tyr Ala Asp Thr Leu Asp Leu Val Arg
340 345 350
Leu Gly Thr Asp Arg Ala Arg Ala Gly Gln Val Arg Thr Pro Ala Gly
355 360 365
Trp Glu Thr Pro Leu Glu Lys Val Glu Thr Ile Leu Val Lys Gly Gln
370 375 380
Pro Ala Glu Arg Val Leu Val Arg Glu Thr Ser Leu Gly Pro Ile Arg
385 390 395 400
Glu Ala Gly Gly Glu Leu Tyr Ala Ile His Trp Ile Ala His Ala Pro
405 410 415
Gln Ala Val Asn Leu Glu His Leu Arg Met Glu Thr Ala Thr Thr Leu
420 425 430
Asp Asp Ala Met Ala Val Ala Ala Val Asp Gly Ile Pro Ala Gln Asn
435 440 445
Ile Leu Ile Gly Asp Glu Arg Gly Asn Ile Gly Trp Thr Val Ala Gly
450 455 460
Ile Leu Pro His Arg Pro Ala Ala Gly Arg Gly Leu Ala Val Ser Phe
465 470 475 480
Pro Leu Asp Ala Ser Gly Ser Val Pro Ala Trp Asp Gly Val Leu Ala
485 490 495
Pro Ala Asp Tyr Pro His Val Val Asn Pro Pro Gly Gly Gln Leu Val
500 505 510
Thr Ala Asn Asn Arg Gln Leu Ala Gly Pro Asn Ala Gln Val Leu Gly
515 520 525
Asp Gly Gly Phe Asp Leu Gly Ala Arg Ala Arg Gln Leu Gly Glu Gly
530 535 540
Val Arg Ser Leu Gly Asp Lys Thr Asp Val Pro Ala Thr Phe Arg Ala
545 550 555 560
Ala Leu Asp Asp Arg Ala Leu Phe Val Gln Glu Trp Arg Glu Arg Ala
565 570 575
Leu Ala Ala Leu Asp Asp Ala Ala Val Ala Gly His Pro Glu Arg Ala
580 585 590
Glu Phe Arg Arg Leu Leu Lys Glu Ser Trp Asp Gly His Ala Ser Thr
595 600 605
Gly Ser Val Gly Tyr Arg Leu Ala Gln Gln Phe Arg Trp Ser Leu Tyr
610 615 620
Glu Leu Val Phe Ala Gly Ala Asn Ala Glu Met Ala Arg Leu Asp Pro
625 630 635 640
Lys Ala Ser Met Gln Ser Ala Ser Ser Arg Trp Ser Ala Val Leu Ala
645 650 655
Arg Leu Leu Asp Glu Arg Pro Ala Ala Trp Leu Pro Ser Gly Tyr Ala
660 665 670
Ser Trp Gln Asp Leu Gln Leu Ala Ala Val Asp Arg Thr Ile Arg Asp
675 680 685
Val Thr Lys Asp Gly Thr Pro Leu Ala Arg Ala Thr Trp Gly Ala Arg
690 695 700
Asn Thr Ala Ala Ile Ala His Pro Ile Ser Met Ala Leu Pro Phe Leu
705 710 715 720
Lys Arg Trp Leu Gly Ala Pro Pro Asp Gln Leu Pro Gly Asp Ala Asn
725 730 735
Met Pro Arg Val Ala Gly Pro Lys Phe Gly Gln Ser Glu Arg Leu Thr
740 745 750
Val Ser Pro Gly Arg Glu Glu Glu Gly Leu Phe Asp Met Pro Gly Gly
755 760 765
Gln Ser Gly His Pro Leu Ser Pro Trp Phe Leu Gly Gly His Ala Asp
770 775 780
Trp Val Arg Gly Lys Pro Thr Pro Leu Leu Pro Gly Pro Ala Gln His
785 790 795 800
Thr Leu Leu Phe Ser Arg
805
Claims (2)
1. Penicillin acylase gene, characterized in that: the nucleic acid sequence of the gene is shown in SEQ ID NO. 1.
2. The protein encoded by the penicillin acylase gene of claim 1 wherein: the amino acid sequence of the protein is shown as SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910385295.1A CN110106161B (en) | 2019-05-09 | 2019-05-09 | Penicillin acylase gene and protein coded by same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910385295.1A CN110106161B (en) | 2019-05-09 | 2019-05-09 | Penicillin acylase gene and protein coded by same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110106161A CN110106161A (en) | 2019-08-09 |
| CN110106161B true CN110106161B (en) | 2022-03-22 |
Family
ID=67489121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910385295.1A Active CN110106161B (en) | 2019-05-09 | 2019-05-09 | Penicillin acylase gene and protein coded by same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110106161B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008093351A1 (en) * | 2007-01-31 | 2008-08-07 | Fermenta Biotech Limited | Dna sequence encoding penicillin acylase, novel recombinant dna constructs and recombinant microorganisms carrying this sequence |
| CN104789510A (en) * | 2015-05-06 | 2015-07-22 | 南京工业大学 | Penicillin acylase as well as encoding gene, producing strain and application thereof |
-
2019
- 2019-05-09 CN CN201910385295.1A patent/CN110106161B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008093351A1 (en) * | 2007-01-31 | 2008-08-07 | Fermenta Biotech Limited | Dna sequence encoding penicillin acylase, novel recombinant dna constructs and recombinant microorganisms carrying this sequence |
| CN104789510A (en) * | 2015-05-06 | 2015-07-22 | 南京工业大学 | Penicillin acylase as well as encoding gene, producing strain and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Cloning, overexpression, and characterization of a novel thermostable penicillin g acylase from Achromobacter xylosoxidans: Probing the molecular basis for its high thermostability;Cai, G等;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;20140501;第70卷(第5期);第2764-2770页，参见全文 * |
| Expression and characterization of a thermostable penicillin G acylase from an environmental metagenomic library;Zhang, Q等;《BIOTECHNOLOGY LETTERS》;20131211;第36卷(第3期);第617-625页，参见全文 * |
| 产青霉素G酰化酶工程菌的构建;邵威平等;《甘肃农业大学学报》;20160215;第51卷(第01期);第132-137页，参见全文 * |
| 成都平原蜘蛛内生菌宏基因组文库构建及新型青霉素酰化酶的初步筛选;谢超颖等;《基因组学与应用生物学》;20170125;第36卷(第01期);第259-265页，参见全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110106161A (en) | 2019-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | A simple and effective strategy for solving the problem of inclusion bodies in recombinant protein technology: His-tag deletions enhance soluble expression | |
| CN111808837A (en) | Staphylococcus aureus bacteriophage lyase and preparation method and application thereof | |
| CN113151270A (en) | Promoter for efficiently expressing alkaline protease and application thereof | |
| CN115029333B (en) | Endonuclease and purification method and application thereof | |
| CN110106161B (en) | Penicillin acylase gene and protein coded by same | |
| CN110078791B (en) | Method for realizing protein crosslinking based on amino acid specificity recognition | |
| CN110283797B (en) | Tyrosinase, gene, engineering bacterium and preparation method thereof | |
| Suzuki et al. | Gene cloning, overproduction, and characterization of thermolabile alkaline phosphatase from a psychrotrophic bacterium | |
| US8017356B2 (en) | Endoribonuclease | |
| CN112481286B (en) | Amino acid sequence for improving heterologous expression efficiency of recombinant milk protein | |
| US11807883B2 (en) | Polypeptide tag, highly soluble recombinant nitrilase and application thereof in synthesis of pharmaceutical chemicals | |
| CN115948363A (en) | Tn5 transposase mutant and preparation method and application thereof | |
| CN111117980B (en) | Esterase derived from Antarctic soil, and coding gene and application thereof | |
| CN113817758A (en) | Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof | |
| CN112592929A (en) | Preparation method and application of halogenase recombinant expression vector | |
| CN107619832B (en) | Chloronitrophenol compound oxidoreductase gene cluster cnpAB and application thereof | |
| CN110698554A (en) | Acanthopanax migratorius FKBP52 protein and coding gene and application thereof | |
| CN110066814B (en) | beta-D-glucosidase gene and encoding protein thereof | |
| EP1921138A1 (en) | Novel endoribonuclease | |
| AU2021100409A4 (en) | Recombinant low-temperature catalase, recombinant vector and engineered strain thereof | |
| CN114164223B (en) | Antarctic soil-derived esterase and encoding gene and application thereof | |
| CN114561386B (en) | Gene element with intramolecular chaperone characteristic and application thereof | |
| KR102667373B1 (en) | A novel fusion tag system promising soluble expression and purification in Escherichia coli using CBM66 and levan, and their applications | |
| CN113151227B (en) | Protease gene and heterologous expression thereof | |
| CN116875582B (en) | Nucleoside hydrolase mutant, gene, expression vector, cell and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |