CN110079608A - One can recognize that the commercially molecular labeling of bumblebee and its application - Google Patents
One can recognize that the commercially molecular labeling of bumblebee and its application Download PDFInfo
- Publication number
- CN110079608A CN110079608A CN201910338173.7A CN201910338173A CN110079608A CN 110079608 A CN110079608 A CN 110079608A CN 201910338173 A CN201910338173 A CN 201910338173A CN 110079608 A CN110079608 A CN 110079608A
- Authority
- CN
- China
- Prior art keywords
- bumblebee
- sequence
- geodetic
- genotype
- snp site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The molecular labeling that can recognize that the invention discloses one from the commercially bumblebee of European import and its application.The present invention provides the substances of the genotype of the detection ground special SNP site of bumblebee following 1) -6) at least one of or preparation 1) -6) at least one of application in product: 1) identify or assist to identify to which whether geodetic bumblebee is import commercially bumblebee；2) it distinguishes or supplementary globe waits for that geodetic bumblebee is import commercially bumblebee or wild ground bumblebee；3) breeding import commercially bumblebee；4) whether identification tamed to geodetic bumblebee；5) breeding is easy to indoor raising or the strong ground bumblebee of ability that pollinates；6) commercially whether bumblebee has caused biotic intrusion to China for evaluation import；Method provided by the invention detects fast accurate, and not affected by environment, selection target is clear, substantially increases the detector efficiency of import commercially bumblebee.
Description
Technical field
The invention belongs to bumblebee conservation biology and bumblebee Breeding Application field, be related to one can recognize that from Europe into
The molecular labeling of the commercially bumblebee of mouth and its application.
Background technique
Bumblebee is important insect pollinator, to promotion agricultural production and maintains ecosystem balance all extremely important.But it is close
In decades, in the discovery of the country such as Europe and North America, apparent quantity decline phenomenon is all had occurred in the bumblebee of numerous species.Bumblebee
The decline of quantity will lead to plant cannot get enough pollinations service, and then cause the decline of grain yield, bio-diversity
The deterioration of loss and ecological environment.
Bumblebee quantity decline the reason of first is that external bumblebee to introduce ground caused by biotic intrusion.Commercialization now is most
Successful bumblebee comes from the ground bumblebee of certain European company.The said firm is carried out artificial by the wildly bumblebee captured to field
Domestication, selection and breeding form present commercialized ground bumblebee.Commercialized ground bumblebee has many than wild ground bumblebee
Excellent breeding and pollination performance, but also to introducing can cause ecological invasion.For example, due to buy and used from
The commercially bumblebee in Europe has occurred that in countries such as Japan, Australia, New Zealand and Argentina by this commercialization
Biotic intrusion phenomenon caused by ground bumblebee.This ground bumblebee not only grabs food, nest with the Bombus species for introducing ground and matches
It is even, but also external pathogen can be introduced, the ecosystem for introducing ground is damaged.
China began to be mainly used for the northern area of China from this commercialized ground bumblebee of European import from 1996
Chamber crop pollination.But people do not know that this commercially bumblebee causes biotic intrusion either with or without to China at present, even
Do not know this ground bumblebee either with or without fleeing from from greenhouse and nest in outdoor, multiply.The reason of causing this predicament be
There are wild ground bumblebees in China, although commercialized ground bumblebee has excellent reproductive performance than wild ground bumblebee,
People can not distinguish them from the formalness of bumblebee, even with the bar codes technique based on mitochondrial COI gene also area
It is inseparable they.Therefore, it needs to develop a kind of molecular biology method, the wild ground bumblebee with import can be distinguished, into
And assess biotic intrusion status of the commercially bumblebee to China of import.The exploitation of this method is for formulating relevant protection
The ecological safety in measure and then protection China is extremely important.
Summary of the invention
In order to distinguish or supplementary globe waits for that geodetic bumblebee is import commercially bumblebee or wild ground bumblebee, the present invention
It provides the following technical solutions:
A purpose of the invention is to provide the purposes of the substance of the genotype of the detection ground special SNP site of bumblebee.
At least one of the present invention provides the substances of the genotype of the detection ground special SNP site of bumblebee following 1) -6)
Or preparation 1) -6) at least one of application in product:
1) it identifies or assists to identify to which whether geodetic bumblebee is import commercially bumblebee；
2) it distinguishes or supplementary globe waits for that geodetic bumblebee is import commercially bumblebee or wild ground bumblebee；
3) breeding import commercially bumblebee；
4) whether identification tamed to geodetic bumblebee；
5) breeding is easy to indoor raising or the strong ground bumblebee of ability that pollinates；
6) commercially whether bumblebee has caused biotic intrusion to China for evaluation import.
The special SNP site is the 2379545th nucleotide that ground bumblebee refers to genome sequence NC_015765.1；
It is also sequence 4 the 25th.
Import commercially bumblebee be domestication after bumblebee, the present embodiment using Dutch section's Bert company commercialization
Ground bumblebee.
In above-mentioned application, the genotype of the special SNP site is TT or CC or TC.
In above-mentioned application, the substance of the genotype of the special SNP site of detection ground bumblebee is following 1) or 2):
1) primer set, primer set single strand dna as shown in sequence 1 in sequence table or derivatives thereof, sequence
In list in single strand dna shown in sequence 2 or derivatives thereof and sequence table single strand dna shown in sequence 3 or its spread out
Biotic component；
2) contain the PCR reagent or kit of the primer set.
Mentioned reagent box may also include KASP reagent.
In above-mentioned application, in the sequence table derivative of single strand dna shown in sequence 1 be it is following 1) or 2):
1) there is phase by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1
The DNA molecular of congenerous；
2) single strand dna shown in sequence 1 or the end 5' 1) connect a kind of fluorescence sequence.
In the sequence table derivative of single strand dna shown in sequence 2 be it is following 3) or 4):
3) there is phase by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2
The DNA molecular of congenerous；
4) single strand dna shown in sequence 2 or the end 5' 1) connect another fluorescence sequence.
The derivative of single strand dna shown in sequence 3 is that sequence 3 is passed through one or several nucleosides in the sequence table
Acid substitution and/or deletion and/or addition and with the DNA molecular with the same function of sequence 3.
Or, the fluorophor sequence is fluorescence sequence FAM or fluorescence sequence HEX.
Another object of the present invention is to provide following method:
It is provided by the invention it is a kind of identify or assist to identify to geodetic bumblebee whether be import commercially bumblebee method,
To the genotype of the special SNP site of geodetic bumblebee it is TT or CC to detect:
It is described to geodetic bumblebee to be or candidate is if the genotype of the special SNP site to geodetic bumblebee is TT
Import commercially bumblebee；
It is described to geodetic bumblebee not to be or candidate if the genotype of the special SNP site to geodetic bumblebee is CC
It is not import commercially bumblebee.
Or, the present invention provide it is a kind of identify or assist to identify to which whether geodetic bumblebee is the method for taming ground bumblebee, be
The genotype for detecting the special SNP site to geodetic bumblebee is TT or CC:
It is described to geodetic bumblebee to be or candidate is if the genotype of the special SNP site to geodetic bumblebee is TT
Tamed ground bumblebee；
It is described to geodetic bumblebee not to be or candidate if the genotype of the special SNP site to geodetic bumblebee is CC
It is not to tame ground bumblebee.
Or, the present invention provides a kind of differentiation or supplementary globe waits for that geodetic bumblebee is import commercially bumblebee or wild type
The method of ground bumblebee to the genotype of the special SNP site of geodetic bumblebee is TT or CC to detect:
It is described to geodetic bumblebee to be or candidate is if the genotype of the special SNP site to geodetic bumblebee is TT
Import commercially bumblebee；
It is described to geodetic bumblebee to be or candidate is if the genotype of the special SNP site to geodetic bumblebee is CC
Wild ground bumblebee.
Or, the present invention provides a kind of breeding import, commercially bumblebee or breeding are easy to indoor raising or ability of pollinating is strong
The method of ground bumblebee to the genotype of the special SNP site of geodetic bumblebee is TT or CC to detect, special SNP described in breeding
The ground bumblebee that the genotype in site is TT is that import commercially bumblebee or is easy to indoor raising or the strong ground bumblebee of ability that pollinates.
In the above method, it is described detection to geodetic bumblebee special SNP site genotype be TT or CC method packet
Include following A) or B):
A) direct Sequencing；
B KASP amplification) is carried out to geodetic bumblebee genomic DNA to described with above-mentioned primer set, KASP amplification is obtained and produces
Object；Detect the fluorescence signal or fluorescence signal value of KASP amplified production:
If the KASP amplified production only the end DNA molecular 5' shown in display sequence 1 connection fluorescence sequence color (FAM),
It is then TT to the genotype of the special SNP site of geodetic bumblebee；If only DNA shown in display sequence 2 points of the KASP amplified production
The color (HEX) of the sub- end 5' connection fluorescence sequence is then CC to the genotype of the special SNP site of geodetic bumblebee；
If or the end DNA molecular 5' shown in fluorescence signal value/sequence 2 of the connection of the end DNA molecular 5' shown in sequence 1 fluorescence sequence
The fluorescence signal value (FAM/HEX) for connecting fluorescence sequence is greater than or equal to 3.5, then gene of the ground bumblebee in special SNP site
Type is TT；Connect if the end DNA molecular 5' shown in sequence 1 connects the end DNA molecular 5' shown in fluorescence signal value/sequence 2 of fluorescence sequence
The fluorescence signal value (FAM/HEX) of fluorescence sequence is connect less than 0.5, then the ground bumblebee is CC in the genotype of special SNP site.
The reaction system of above-mentioned KASP amplification is (10 μ l): template DNA containing 100ng, 0.12 μM of F1,0.12 μM of F2,0.3
μM R, 1XLGC GenomicsKASP reagent, surplus is water.
The response procedures of above-mentioned KASP amplification are as follows: 94 DEG C of initial denaturation 15min；94 DEG C of denaturation 20s, 61 DEG C of -55 DEG C of annealing 45s
(first cycle annealing temperature is 61 DEG C, and a circulation reduces by 0.6 DEG C in each recycle ratio later, the last one cycle annealing
Temperature is 55 DEG C), 10 circulations；94 DEG C of denaturation 20s, 55 DEG C of annealing 45s, 36 recycle；10 DEG C of preservations.
It is a still further object of the present invention to provide a kind of kits.
Kit provided by the invention, including above-mentioned detection the substance of the genotype of the special SNP site of bumblebee.
The experiment proves that: present invention discover that one can distinguish wildly bumblebee and import commercially bumblebee
SNP site, and according to the primer of the site design competition ApoE gene；It is anti-that PCR is carried out using obtained primer
It answers, wild and import commercialized ground bumblebee can be efficiently differentiated open.Method provided by the invention detects fast accurate, no
Affected by environment, selection target is clear, substantially increases the detector efficiency of import commercially bumblebee.Thus, the invention is advantageous
From the commercially bumblebee of European import whether biotic intrusion is caused to China in evaluation, this life for ensureing China
State is extremely important safely.In addition, to be easy to the strong breeding material of indoor raising, pollination ability for screening excellent to carry out by the present invention
The breeding of bumblebee kind also will be helpful.
Detailed description of the invention
Fig. 1 is commercially bumblebee and SNP difference site special in wildly bumblebee genomic DNA.
Fig. 2 is the example results of part bumblebee individual when carrying out genotype detection to the molecular labeling.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.
KASP reagent, that is, KASP Master mix, LGC company, Britain, article No. KBS-1016-017.
The exploitation of embodiment 1, commercially bumblebee specific molecular marker
One, the excavation in specific molecular marker site
By to more wild ground bumblebees (9 countries that sample is collected in Xinjiang of China and Europe and Asia) and more
Bumblebee (purchased from Bert company, Dutch section) carries out genome and resurveys sequence only commercializedly, using bioinformatics method, in bear
1 special SNP site is identified on the genome of bee, which is named as NC015765.On the site NC015765, own
Commercially bumblebee genotype having the same (being TT), all wildly bumblebee genotype having the same (are
CC), and it is commercialized not identical (Fig. 1) as wild ground bumblebee genotype.The SNP site is shown in Fig. 1, only opens up here
The sequence alignment result of part bumblebee individual is shown.
Special SNP site NC015765 is colored background nucleotide position in Fig. 1, which is ground bumblebee with reference to genome
The 2379545th core on sequence linkage group LG B04 (GenBank number: NC_015765.1, on April 25th, 2017 submit)
Thuja acid, genotype of the SNP site in commercially bumblebee are TT, and in wild type the genotype in bumblebee is CC.
In ground bumblebee with reference on genome, the SNP site and flanking sequence are 5 '-
GAAATTAAACACATCATATAAATG (C/T) TATCATGAAATGGCTGAAGCTGTA-3 ' (sequence 4)；The wherein sequence
25 nucleotide are this special SNP sites.
Two, the primer sets design of difference molecular labeling
According to the special SNP site and its two sides DNA sequence dna, it is based on KASP method (Kompetitive Allele
Specific PCR, KASP, competitive ApoE gene) technology, designs KASP amplimer, and further convert
For codominant detection label, referred to as codominant marker NC015765.
Primer sets for detecting codominant marker NC015765 are as follows:
NC015765FAMF1 (sequence 1 of sequence table):
5 '-GAAGGTGACCAAGTTCATGCTTACAGCTTCAGCCATTCATGATAA-3 ' (sequence 5 ' end 21bp be
The corresponding joint sequence of FAM fluorescence probe (thickened portion), the joint sequence can be tried with the KASP of LGC Genomics company
FAM fluorescence probe in agent matches, and under amplification situation, generates FAM fluorescence (blue)；3 ' end 24bp are SNP site T equipotential
The extension increasing sequence of gene specific, the sequence are classified as reverse complemental relationship with reference to genome sequence with corresponding)；
NC015765HEXF2 (sequence 2 of sequence table):
5'-GAAGGTCGGAGTCAACGGATTTACAGCTTCAGCCATTCATGATAG-3'；
(it is the corresponding joint sequence of HEX fluorescence probe that the sequence 5 ', which holds 21bp, which can be with LGC
HEX fluorescence probe in the KASP reagent of Genomics company matches, and under amplification situation, generates HEX fluorescence (red)；3'
Holding 24bp is the extension increasing sequence of SNP site C allele specific, which is classified as reverse complemental with reference to genome sequence with corresponding
Relationship)；
NC015765R (sequence 3 of sequence table): 5 '-GGGATAGCGAGAAATTAAACACATCA-3 '.
Three, the wild foundation with commercialized ground bumblebee method is distinguished
It extracts to geodetic bumblebee chest genomic DNA as template, carries out KASP with above-mentioned two codominance KASP label
Amplification, obtains pcr amplification product.
Above-mentioned KASP amplification system (10 μ l): template DNA containing 100ng, 0.12 μM of NC015765FAMF1,0.12 μM
NC015765HEXF2,0.3 μM of NC015765R, 5 μ L KASP reagents, surplus is water.
KASP amplification program: 94 DEG C of initial denaturation 15min；94 DEG C of denaturation 20s, 61 DEG C of -55 DEG C of annealing 45s (first circulations
Annealing temperature is 61 DEG C, and a circulation reduces by 0.6 DEG C in each recycle ratio later, the last one cycle annealing temperature is 55 DEG C),
10 circulations；94 DEG C of denaturation 20s, 55 DEG C of annealing 45s, 36 recycle；10 DEG C of preservations.
Setting uses isometric water to replace template DNA as no template blank control.
Pcr amplification product is placed in ABI7500 fluorescence quantitative PCR instrument and carries out fluorescence signal detection, by fluorescence quantitative PCR instrument
Be set as Genotyping end-point method read fluorescence mode, 30 DEG C, 30s read fluorescent value, collect FAM fluorescence signal (blue) and
HEX fluorescence signal (red) determines sample genotype according to fluorescence signal color；
If fluorescence signal is displayed in blue fluorescence signal (FAM), which is TT in the genotype of special SNP site,
Then the ground bumblebee is or candidate is import commercially bumblebee；
If fluorescence signal is displayed in red fluorescence signal (HEX), which is CC in the genotype of special SNP site,
Then the ground bumblebee is or candidate is wild ground bumblebee.
Or, determining sample genotype according to fluorescence signal value ratio size:
FAM signal value and HEX signal value are then negative control simultaneously less than 0.6, or think that testing result fails；FAM
Both signal value and HEX signal value one are greater than or equal to 0.6, then calculate the two ratio for determining genotype.
FAM signal value/HEX signal value is greater than or equal to 3.5, then the ground bumblebee is TT in the genotype of special SNP site,
Then the ground bumblebee is or candidate is import commercially bumblebee；FAM signal value/HEX signal value ratio is greater than 0.7, and is less than
3.0, then the ground bumblebee is TC in the genotype of special SNP site；FAM signal value/HEX signal value is less than 0.5, then the ground bumblebee
It is CC in the genotype of special SNP site, then the ground bumblebee is or candidate is wildly bumblebee；Other ratios are gray area, are needed
Re-start detection.
(in some embodiments, VIC substitution HEX specified otherwise: can be used completely.HEX and VIC is a kind of fluorescent base
Group, the two chemical structure is different, but property is substantially similar, can be replaced mutually completely both in practical application.It is answered some
It is detected under environment, such as using the ABI7500 real-time fluorescence quantitative PCR instrument of ABI company, VIC can be used to refer to HEX；?
In addition it once will use HEX under application scenarios and refer to VIC, for example examined using the SNPline instrument of LGC Genomics
It surveys).
Therefore, commercially bumblebee and wildly bumblebee can be distinguished using the genotype of special SNP site, specific method is such as
Under:
Detecting to the special SNP site genotype of geodetic bumblebee is TT or CC；If the genotype of special SNP site is
TT, then the ground bumblebee is or candidate is import commercially bumblebee；If the genotype of special SNP site is CC, the ground bumblebee
For or it is candidate for wildly bumblebee.
Detecting is TT to the special SNP site genotype of geodetic bumblebee or the method for CC is following A) or B):
A) direct Sequencing；
B) geodetic bumblebee genomic DNA is treated with the primer sets of above-mentioned two detection codominant marker NC015765 to carry out
KASP amplified production carries out Genotyping to KASP amplified production.
Methods of genotyping is same as above, after being irradiated using fluorescence microplate reader, according to fluorescence color or fluorescence signal value ratio
It is worth size judgement.
The efficiency assessment of embodiment 2, commercially bumblebee specific molecular marker
With select at random 5, wildly bumblebee (from Xinjiang of China area), 5 commercialized ground bumblebees (are purchased from
Dutch section's Bert company) it is research object.
1, wildly bumblebee and the commercially chest of bumblebee are taken, extracts genomic DNA respectively.
2, with wildly bumblebee genomic DNA, commercially bumblebee genomic DNA and wildly bumblebee genomic DNA
Commercially bumblebee genomic DNA sample mixing (mass ratio 1:1) is template, according to the carry out KASP amplification of embodiment 1.
KASP amplification system (10 μ l): template DNA containing 100ng, 0.12 μM of NC015765FAMF1,0.12 μM
NC015765HEXF2,0.3 μM of NC015765R, 5 μ L KASP reagents, surplus is water.
KASP amplification program: 94 DEG C of initial denaturation 15min；94 DEG C of denaturation 20s, 61 DEG C of -55 DEG C of annealing 45s (first circulations
Annealing temperature is 61 DEG C, and a circulation reduces by 0.6 DEG C in each recycle ratio later, the last one cycle annealing temperature is 55 DEG C),
10 circulations；94 DEG C of denaturation 20s, 55 DEG C of annealing 45s, 36 recycle；10 DEG C of preservations.
Setting uses isometric water to replace template DNA as blank control.
KASP amplified production is placed in ABI7500 fluorescence quantitative PCR instrument and carries out fluorescence signal detection, by quantitative fluorescent PCR
Instrument be set as Genotyping end-point method read fluorescence mode, 30 DEG C, 30s read fluorescent value, collect FAM fluorescence signal (blue) and
HEX fluorescence signal (red) determines sample genotype according to fluorescence signal color；
If fluorescence signal is displayed in blue fluorescence signal (FAM), which is TT in the genotype of special SNP site,
Then the ground bumblebee is or is selected as import commercially bumblebee；
If fluorescence signal is displayed in red fluorescence signal (HEX), which is CC in the genotype of special SNP site,
Then the ground bumblebee is or is selected as wildly bumblebee；
Or, determining sample genotype according to fluorescence signal value ratio size:
FAM signal value/HEX signal value is greater than or equal to 3.5, then the ground bumblebee is TT in the genotype of special SNP site,
Then the ground bumblebee is or is selected as import commercially bumblebee；
FAM signal value/HEX signal value is less than 0.5, then the ground bumblebee is CC in the genotype of special SNP site, then the ground
Bumblebee is or is selected as wildly bumblebee.
As a result as shown in Fig. 2, abscissa indicates to read the fluorescence intensity level of HEX, ordinate indicates the fluorescence of the FAM read
Intensity value, the lower left corner × indicate blank control；The fluorescence detection result of 5 commercially bumblebees is blue, i.e. genotype
For TT；The fluorescence detection result of 5 wildly bumblebees is red, i.e., genotype is CC；3 samples be commercially bumblebee with
Wildly the mixed in equal amounts sample of bumblebee genomic DNA, fluorescence detection result are green, and expression genotype is TC.
In addition, FAM signal value/HEX signal value of 5 commercially bumblebees is all larger than 3.5, i.e. genotype is TT；5 open countries
FAM signal value/HEX signal value of Radix Rehmanniae bumblebee is respectively less than 0.5, i.e. genotype is CC；3 commercially bumblebee and wildly bears
The mixed in equal amounts sample of bee genomic DNA, FAM signal value/HEX signal value is between 0.7-3.0, i.e., genotype is TC.
Therefore, genomic DNA to be measured can be accurately judged that out very much for primer sets designed by the special SNP site
It is derived from commercially bumblebee and is also derived from wildly bumblebee.
SEQUENCE LISTING
<110>China Agriculture Industitute Bee Research Center
<120>one can recognize that the commercially molecular labeling of bumblebee and its application
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 45
<212> DNA
<213> Artificial sequence
<400> 1
gaaggtgaccaagttcatgcttacagcttcagccattcatgataa 45
<210> 2
<211> 45
<212> DNA
<213> Artificial sequence
<400> 2
gaaggtcggagtcaacggatttacagcttcagccattcatgatag 45
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
gggatagcgagaaattaaacacatca 26
<210> 4
<211> 49
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (25)
<223>y=c or t
<400> 4
gaaattaaac acatcatata aatgytatca tgaaatggct gaagctgta 49
Claims (10)
1. the substance of the genotype of the detection ground special SNP site of bumblebee is following 1) -6) at least one of or preparation 1) -6) in extremely
Application in a kind of few product:
1) it identifies or assists to identify to which whether geodetic bumblebee is import commercially bumblebee；
2) it distinguishes or supplementary globe waits for that geodetic bumblebee is import commercially bumblebee or wild type ground bumblebee；
3) breeding import commercially bumblebee；
4) whether identification tamed to geodetic bumblebee；
5) breeding is easy to indoor raising or the strong ground bumblebee of ability that pollinates；
6) commercially whether bumblebee has caused biotic intrusion to China for evaluation import；
The special SNP site is the 2379545th nucleotide that ground bumblebee refers to genome sequence NC_015765.1.
2. application according to claim 1, it is characterised in that: the genotype of the special SNP site is TT or CC or TC.
3. application according to claim 1 or 2, it is characterised in that:
The substance of the genotype of the special SNP site of detection ground bumblebee is following 1) or 2):
1) primer set, primer set single strand dna as shown in sequence 1 in sequence table or derivatives thereof, sequence table
Single strand dna shown in sequence 3 or derivatives thereof in single strand dna shown in middle sequence 2 or derivatives thereof and sequence table
Composition；
2) contain the PCR reagent or kit of the primer set.
4. application according to claim 3, it is characterised in that:
In the sequence table derivative of single strand dna shown in sequence 1 be it is following 1) or 2):
1) sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and had into identical function with sequence 1
The DNA molecular of energy；
2) single strand dna shown in sequence 1 or the end 5' 1) connect a kind of fluorescence sequence；
In the sequence table derivative of single strand dna shown in sequence 2 be it is following 3) or 4):
3) sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and had into identical function with sequence 2
The DNA molecular of energy；
4) single strand dna shown in sequence 2 or the end 5' 1) connect another fluorescence sequence；
The derivative of single strand dna shown in sequence 3 is by sequence 3 by one or several nucleotide in the sequence table
Replace and/or deletion and/or addition and with the DNA molecular with the same function of sequence 3.
5. it is a kind of identify or assist to identify to geodetic bumblebee whether be import commercially bumblebee method, be detection to geodetic bear
The genotype of the special SNP site of bee is TT or CC:
It is described to geodetic bumblebee to be or candidate is import if the genotype of the special SNP site to geodetic bumblebee is TT
Commercially bumblebee；
It is described to geodetic bumblebee not to be or candidate is not if the genotype of the special SNP site to geodetic bumblebee is CC
Import commercially bumblebee.
6. a kind of identify or assist to identify to which whether geodetic bumblebee is the method for taming ground bumblebee, to detect to geodetic bumblebee
The genotype of special SNP site is TT or CC:
It is described to geodetic bumblebee to be or candidate is domestication if the genotype of the special SNP site to geodetic bumblebee is TT
Cross ground bumblebee；
It is described to geodetic bumblebee not to be or candidate is not if the genotype of the special SNP site to geodetic bumblebee is CC
Tamed ground bumblebee.
7. a kind of differentiation or supplementary globe wait for geodetic bumblebee be import commercially bumblebee or wild type bumblebee method, be
The genotype for detecting the special SNP site to geodetic bumblebee is TT or CC:
It is described to geodetic bumblebee to be or candidate is import if the genotype of the special SNP site to geodetic bumblebee is TT
Commercially bumblebee；
It is described to geodetic bumblebee to be or candidate is wild if the genotype of the special SNP site to geodetic bumblebee is CC
Ground bumblebee.
8. a kind of breeding import method that commercially bumblebee or breeding are easy to indoor raising or the strong ground bumblebee of ability that pollinates, is
The genotype for detecting the special SNP site to geodetic bumblebee is TT or CC, and the genotype of special SNP site described in breeding is TT
Ground bumblebee be that import commercially bumblebee or is easy to indoor raising or the strong ground bumblebee of ability that pollinates.
9. according to any method of claim 5-8, it is characterised in that:
The method that the genotype of special SNP site of the detection to geodetic bumblebee is TT or CC includes following A) or B):
A) direct Sequencing；
B KASP amplification) is carried out to geodetic bumblebee genomic DNA to described with the primer set in claim 4, is obtained
KASP amplified production；Detect the fluorescence signal or fluorescence signal value of KASP amplified production:
If the KASP amplified production only the end DNA molecular 5' shown in display sequence 1 connection fluorescence sequence color, to geodetic bear
The genotype of the special SNP site of bee is TT；If only the end DNA molecular 5' shown in display sequence 2 connects the KASP amplified production
The color of fluorescence sequence is then CC to the genotype of the special SNP site of geodetic bumblebee；If the KASP amplified production shows sequence
Column 1 connect the color of fluorescence sequence with DNA molecular 5' end shown in sequence 2, then the genotype to the special SNP site of geodetic bumblebee
For TC；
If or the end DNA molecular 5' connection shown in fluorescence signal value/sequence 2 of the connection of the end DNA molecular 5' shown in sequence 1 fluorescence sequence
The fluorescence signal value of fluorescence sequence is greater than or equal to 3.5, then the ground bumblebee is TT in the genotype of special SNP site；If sequence 1
The end shown DNA molecular 5' connects the glimmering of the connection of the end DNA molecular 5' shown in fluorescence signal value/sequence 2 of fluorescence sequence fluorescence sequence
Optical signal value is less than 0.5, then the ground bumblebee is CC in the genotype of special SNP site.
10. a kind of kit, the base of the special SNP site including the detection ground bumblebee in any application of claim 1-4
Because of the substance of type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910338173.7A CN110079608B (en) | 2019-04-25 | 2019-04-25 | Molecular marker capable of identifying commercial bumblebee and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910338173.7A CN110079608B (en) | 2019-04-25 | 2019-04-25 | Molecular marker capable of identifying commercial bumblebee and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110079608A true CN110079608A (en) | 2019-08-02 |
| CN110079608B CN110079608B (en) | 2022-11-22 |
Family
ID=67416686
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910338173.7A Active CN110079608B (en) | 2019-04-25 | 2019-04-25 | Molecular marker capable of identifying commercial bumblebee and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110079608B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111850142A (en) * | 2020-09-24 | 2020-10-30 | 中国农业科学院蜜蜂研究所 | Difference INDEL between commercial bumblebee and wild bumblebee, molecular marker and application thereof |
| CN111926093A (en) * | 2020-09-17 | 2020-11-13 | 中国农业科学院蜜蜂研究所 | Commercial bumblebee and wild bumblebee differential gene and molecular marker and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820540A (en) * | 2014-01-23 | 2014-05-28 | 中国农业科学院蜜蜂研究所 | Molecular detection method for crithidia bombi |
| CN109234421A (en) * | 2018-11-26 | 2019-01-18 | 福建出入境检验检疫局检验检疫技术中心 | N.bombi real-time fluorescence PCR assay kit and its detection method |
-
2019
- 2019-04-25 CN CN201910338173.7A patent/CN110079608B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820540A (en) * | 2014-01-23 | 2014-05-28 | 中国农业科学院蜜蜂研究所 | Molecular detection method for crithidia bombi |
| CN109234421A (en) * | 2018-11-26 | 2019-01-18 | 福建出入境检验检疫局检验检疫技术中心 | N.bombi real-time fluorescence PCR assay kit and its detection method |
Non-Patent Citations (3)
| Title |
|---|
| XIAOMENG ZHAO等: "Tandem Repeats Contribute to Coding Sequence Variation in Bumblebees (Hymenoptera: Apidae)", 《GENOME BIOL EVOL》 * |
| 耿金虎等: "熊蜂ISSR-PCR体系的建立与优化及其在亲缘关系分析中的应用", 《昆虫学报》 * |
| 苏龙: "基于全基因组重测序研究地熊蜂(Bombus terrestris)的群体遗传结构及适应性演化的分子机制", 《万方学位论文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111926093A (en) * | 2020-09-17 | 2020-11-13 | 中国农业科学院蜜蜂研究所 | Commercial bumblebee and wild bumblebee differential gene and molecular marker and application thereof |
| CN111850142A (en) * | 2020-09-24 | 2020-10-30 | 中国农业科学院蜜蜂研究所 | Difference INDEL between commercial bumblebee and wild bumblebee, molecular marker and application thereof |
| CN111850142B (en) * | 2020-09-24 | 2021-02-23 | 中国农业科学院蜜蜂研究所 | Difference INDEL between commercial bumblebee and wild bumblebee, molecular marker and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110079608B (en) | 2022-11-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109666756B (en) | Method for identifying authenticity of melon variety and special SNP primer combination thereof | |
| CN106480228A (en) | The SNP marker of paddy rice low cadmium-accumulation gene OsHMA3 and its application | |
| CN108374054A (en) | Suitable for one group of rice SSR molecular marker of capillary electrophoresis detection technology and its application | |
| CN109295179B (en) | Method for screening wheat with different zinc content and iron content and special kit thereof | |
| CN110079608A (en) | One can recognize that the commercially molecular labeling of bumblebee and its application | |
| CN114507749B (en) | Primer group, kit and method for accurately detecting transgenic components of corn | |
| CN111961747A (en) | Method for assisting in identifying sugar content of watermelon fruit, SNP marker and KASP marker | |
| CN106521018A (en) | Primer and method for high-flux detection of transgenic maize containing NOS terminator | |
| CN106755519A (en) | Based on homozygous and heterozygous transgenic corn dual anti-12 5 the method for digital pcr identification and application | |
| CN108103220B (en) | High-flux transgenic element screening detection method | |
| CN109628629A (en) | The SNP marker development and application of rice bacterial leaf spot resistant gene xa5 | |
| CN103773867A (en) | LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method | |
| CN109913575A (en) | A kind of KASP molecular labeling, kit and its application for identifying capsicum CMS fertility restorer gene | |
| CN112226433B (en) | SNP (Single nucleotide polymorphism) site primer combination for identifying white bark pine germplasm resources and application | |
| CN115011724A (en) | Xinlium huashanense chromosome specific ND-FISH probe and application and kit thereof | |
| CN114231603A (en) | Primer, reagent, identification method and kit for identifying paeonia rockii | |
| CN114214448A (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| CN112501337A (en) | KASP molecular marker related to sesame drought resistance character and application thereof | |
| CN105063207A (en) | LAMP detection primer group, kit, and detection method of transgenic soybean MON87705 | |
| CN110373489A (en) | KASP label relevant to wheat seed protein content and its application | |
| CN105039526B (en) | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice | |
| CN118006830B (en) | SNP locus related to sesame seed coat color and application thereof | |
| CN111850142B (en) | Difference INDEL between commercial bumblebee and wild bumblebee, molecular marker and application thereof | |
| CN117737296B (en) | SNP marker for identifying purity of Qingzao 510 maize hybrid and application thereof | |
| CN113699273B (en) | SNP locus combination for detecting resistance of tomato root-knot nematode and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |