CN110075289A - A kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine and its application - Google Patents

Abstract

The present invention relates to veterinary biologics technical fields, more particularly to a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine, the Actinobacillus pleuropneumoniae bacterial strain HNAPP1 antigen of haemophilus parasuis bacterial strain HNHPS1 serotype antigen, the haemophilus parasuis bacterial strain HN1570 serotype antigen of inactivation, the pig streptococcus bacterial strain HNSS1 serotype antigen of inactivation, inactivation including inactivation；Four plants of bacterial strains have good immunogenicity, the vaccine prepared with this four plants of bacterial strain inactivation antigens, it can be very good to prevent the infection of clinical haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae type, the vaccine preparation simple process simultaneously, and safety is good, good immune effect, duration of immunity are long, and it is anti-mostly sick to can be simultaneously reached a needle, reduce cost, reduce stress purpose.

Description

A kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae three inactivate Vaccine and its application

Technical field:

The invention belongs to veterinary biologics technical fields, and in particular to a kind of 4 type of haemophilus parasuis serum, 5 types, pig hammer 2 type of bacterium and 1 type triple inactivated vaccine of Actinobacillus pleuropneumoniae are prepared and are applied.

Background technique:

Haemophilus parasuis (Haemophilus parasuis, HPS) be Pasteurella section a kind of Gram-negative it is polymorphic Dialister bacterium is the pathogen of pig Haemophilus parasuis, mainly causes polyserositis, arthritis and the meningitis of pig.This Disease is widely present in worldwide, and German scholar Glsser was reported first in 1910, also known as leather Laplace disease (Glsser's disease).Haemophilus parasuis can infect the pig of various age brackets, occur mainly in wean after and child care In the stage, the pig of 2 week old of main infection to 4 monthly ages, disease incidence is generally 10%~15%, and the death rate, should up to 50% when serious One of the main reason for disease has become wean in recent years, child care piglet is dead, is one of the main pathogen of clinical mixed infection, gives Pig breeding industry causes biggish economic loss, seriously affects the sound development of pig breeding industry.

Haemophilus parasuis clinical serum type is more, and standard parting has 15 serotypes, and clinically there are also 20% or more no Separable bacterial strain, the cause of disease are in worldwide distribution, and various regions epidemic link serotype is different, lacks immunological cross between each serotype Protective capability.Vaccine immunization is the optimal path of prevention and control Haemophilus parasuis, should be according to popular serotype selection pair The unit price answered or polyvaccine.Domestic 4 type of haemophilus parasuis serum, 5 types are the most popular serotype of report.

Streptococcus suis (Streptococcus Suis, SS) be national regulation two class animal epidemic of one kind, it is a kind of Acute, the hot communicable disease of infecting both domestic animals and human is the main pathogen for causing Streptococcus suis, mainly cause pig meningitis with And the epidemic diseases such as septicemia.It can be divided into 35 serotypes, i.e. 1~34 type and 1/2 according to the capsular polysaccharide antigen of Streptococcus suis Type.It is pathogenic to pig it is stronger be 1 type, 2 types, 1/2 type, 7 types and 9 types.Wherein streptococcus suis 2-type is popular most wide, pathogenic Strongest serotype, followed by 9 types, 7 types, 1 type.In recent years, Streptococcus suis caused by 2 type streptococcus of pig became in rising Gesture.For the disease based on acute sepsis, morbidity is anxious, dead fast, causes huge economic loss, and 2 type chain of pig to pig breeding industry Coccus can cause the infection and death of people.In addition, the disease often with pig circular ring virus, porcine reproductive and respiratory syndrome, pig Eperythrozoonosis and non-typical swine fever mixed infection, so this disease, which once occurs, would become hard to control, to give raiser Great economy property loss is caused, brings huge difficulty to the development of China's pig breeding industry.Therefore the research of the disease is to animal husbandry And it is significant in public health industry.

Actinobacillus pleuropneumoniae (Actinobacillus Pleuropneumoniae, APP) and it is to cause pig The cause of disease of contagious pleuropneumonia (Porcine infection Pleuropneumonia), is the high degree in contact of a boar Infectious respiratory disease is mainly shown as Outbreak, characterized by cellulosic, hemorrhagic, necrotizing pneumonia, morbidity Rate is between 8.5% ~ 100%, and the death rate is between 0.4% ~ 100%, one of the main reason for being current growing and fattening pigs and dead boar. Therefore the prevention and treatment of actinobacillus pleuropneumoniae is of great significance for the sound development of pig breeding industry.

Up to 15 kinds of Actinobacillus pleuropneumoniae serotype, and the Clinical isolation that also cannot be much formed at present, Lack effective Cross immunogenicity between each serotype, the predominant serotype of country variant, area and pig farm prevalence is again not to the utmost Identical, therefore, the separation identification of APP and parting are particularly important in the prevention and treatment of the disease.Domestic popular serotype is mainly 1, 2,3,5,7 types, APP exotoxin cause a disease be immunized in play an important role, APP mono- shares 4 kinds of exotoxins, i.e. toxin Apx I, Apx II, Apx III and Apx IV, and toxin Apx I and Apx II play key effect in terms of APP virulence.Different serotypes point The exotoxin secreted is different.Serum 1 type can excrete poison Apx I, Apx II and Apx IV simultaneously, be all serotype strains poisonings The strain that power is most strong, immunogenicity is best, while being also a kind of predominant serotype strain of China's prevalence.

Clinically haemophilus parasuis and Streptococcus suis, the frequent mixed infection of Actinobacillus pleuropneumoniae or secondary sense Dye, a few person's symptoms are similar, and medication effect is bad, therefore, need a kind of new with good more of safety, immunogenicity The vaccine of valence bacterial strain preparation prevents and treats haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae disease.

Summary of the invention:

For current haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae mixed infection, lacks between each serotype and exempt from The problem of epidemic disease cross protection, the present invention provide a kind of haemophilus parasuis serum, Streptococcus suis and Actinobacillus pleuropneumoniae Triple inactivated vaccine.

The present invention solves scheme used by its technical problem: a kind of haemophilus parasuis, Streptococcus suis and pleuropneumonia are put Line bar bacterium triple inactivated vaccine, the haemophilus parasuis bacterial strain HNHPS1 serotype antigen including inactivation, the secondary pig of inactivation are bloodthirsty Bacillus strain HN1570 serotype antigen, the pig streptococcus bacterial strain HNSS1 serotype antigen of inactivation, inactivation pleuropneumonia unwrapping wire Bacillus strain HNAPP1 antigen.

Above-mentioned a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine, the bacterium Strain HNHPS1 is 4 type haemophilus parasuis of serum (Haemophilus parasuis), is preserved on November 22nd, 2016 State's Microbiological Culture Collection administration committee common micro-organisms center, address are Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Deposit number is CGMCC NO:13335；The bacterial strain HN1570 is Serotype 5 haemophilus parasuis (Haemophilus Parasuis), China Committee for Culture Collection of Microorganisms's common micro-organisms center, ground are preserved on November 09th, 2018 Location is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, and deposit number is CGMCC NO:16802；The bacterial strain HNSS1 is 2 types Streptococcus suis (Streptococcus suis) is preserved in Chinese microorganism strain preservation conservator on November 22nd, 2016 Meeting common micro-organisms center, address are Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, and deposit number is CGMCC NO:13334； The bacterial strain HNAPP1 was 1 type Actinobacillus pleuropneumoniae (Actinobacilus pleuropneumoniae), in 2016 It was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on November 22, address is Chaoyang District, Beijing City north The institute 3 of occasion West Road 1, deposit number are CGMCC NO:13333.

Above-mentioned a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine, the bacterium Strain HNHPS1 serotype antigen, bacterial strain HN1570 serotype antigen, bacterial strain HNSS1 serotype antigen, bacterial strain HNAPP1 antigen Ratio is 1: 1: 1: 1.

The present invention also provides a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccines Preparation method, comprising the following steps:

A. it is proliferated: by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type and pleuropneumonia HNAPP1 plants of 1 type of Actinobacillus breeds culture respectively, obtains haemophilus parasuis HNHPS1 plants, HN1570 plants, Streptococcus suis HNSS1 plants and Actinobacillus pleuropneumoniae HNAPP1 plants of bacterium solution, and count plate is carried out respectively；

B. inactivate: HNHPS1 plants of the haemophilus parasuis obtained respectively into step a, HN1570 plants, HNSS1 plants of Streptococcus suis and Formalin is added according to the 0.2% of bacterium solution volume in HNAPP1 plants of bacterium solutions of Actinobacillus pleuropneumoniae, for 24 hours in 37 DEG C of inactivations；

C. be concentrated: using ultrafiltration apparatus respectively be concentrated inactivation after examine qualification HNHPS1 plants of haemophilus parasuis, HN1570 plants, HNSS1 plants of Streptococcus suis are used sterile physiological according to the count plate before inactivation with Actinobacillus pleuropneumoniae HNAPP1 plants of bacterium solution Salt water adjustment concentration final concentration of 1.0 × 10¹⁰CFU/mL；

D. vaccine is prepared:

(1) preparation of oily phase: taking in the oily phase tank of 92 parts of additions of injection white oil by volume, 1 part of aluminum stearate be added into tank, It is stirring while adding to add 6 parts of Si Ben -80,116 DEG C of high pressure sterilization 40min until fully transparent, after being cooled to room temperature again plus Enter vitamin A and each 0.5 part of vitamin E, be uniformly mixed obtain oil it is mutually spare；

(2) preparation of water phase: by HNHPS1 plants of the haemophilus parasuis obtained after concentration, HN1570 plants, HNSS1 plants of Streptococcus suis With HNAPP1 plants of antigen liquids of Actinobacillus pleuropneumoniae, it is configured to antigen liquid according to 1: 1: 1: 1 ratio mixing, by volume ratio 95 parts of antigen liquid is taken, 5 parts of Tween-80 after sterilizing is added are sufficiently stirred up to being completely dissolved, it is spare to obtain water phase；

(3) it emulsifies: water phase and oil being mutually added in emulsion tank according to the ratio of 2:1, the mixing and emulsifying at 1000-1500rpm, cream Packing bottling after the completion of changing.

The preparation side of above-mentioned a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine Method breeds the operating procedure of culture in the step a are as follows:

(1) first order seed is bred: by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type It is inoculated on TSA plate respectively with Actinobacillus pleuropneumoniae HNAPP1 plants of freeze-drying lactobacillus of 1 type, 37 DEG C are cultivated 18 ~ 24 hours, are chosen Take satisfactory colonies typical, respectively passage be inoculated on TSA plate, in 37 DEG C cultivate 24 hours, after the assay was approved, as First order seed；The NAD of newborn bovine serum and final concentration 0.01% in the TSA plate added with final concentration 5%；

(2) secondary seed is bred: by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type It is inoculated into TSB fluid nutrient medium respectively with Actinobacillus pleuropneumoniae HNAPP1 plants of first order seeds of 1 type, in 37 DEG C, 5%CO₂It shakes Bed shaken cultivation 18 ~ 24 hours carries out purely after the assay was approved, as secondary seed；It is added in the TSB fluid nutrient medium The newborn bovine serum of final concentration 5% and the NAD of final concentration 0.01%；

(3) by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type and pleuropneumonia unwrapping wire The secondary seed of 1 HNAPP1 plants of bacterial strains of type of bacillus is inoculated in TSB fluid nutrient medium respectively by 1%, in 37 DEG C, 5%CO₂Shaking table Shaken cultivation harvested bacterium solution after 18~24 hours；In the TSB fluid nutrient medium added with final concentration 5% newborn bovine serum and The NAD of final concentration 0.01%.

A kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine are in preparation prevention and control Treat haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae related diseases drug in application.

Beneficial effects of the present invention: 1, the present invention filters out advantage epidemic link haemophilus parasuis from clinical separation strain HPS1 plants of 4 type HN of serum, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type, HNAPP1 plants of 1 type of Actinobacillus pleuropneumoniae, Wherein bacterial strain HNHPS1 plants, HN1570 plants, HNSS1 plants and HNAPP1 plants have stronger pathogenicity to child care piglet, cause to protect It is dead to educate pig morbidity；It is found by experiment that this four plants of bacterial strains have good immunogenicity.

2, HNHPS1 plants of 4 type of haemophilus parasuis serum, HN1570 plants of 5 type, streptococcus suis 2-type in the present invention are utilized HNSS1 plants, HNAPP1 plants of 1 type of the Actinobacillus pleuropneumoniae inactivated vaccines as strain antigens preparation, can be very good to prevent The infection of clinical haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae type, while the vaccine preparation simple process, and Safety is good, and good immune effect, duration of immunity are long, and it is anti-mostly sick to can be simultaneously reached a needle, reduces cost, reduce stress purpose.

Detailed description of the invention:

Fig. 1 is bacterial strain HNHPS1 colonial morphology；

Fig. 2 is form under bacterial strain HNHPS1 thallus 100 × microscope of Gram's staining；

The PCR identification and serotype PCR qualification result that Fig. 3 is bacterial strain HNHPS1, the Marker in figure is 2000 bp of DL, from upper 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp are followed successively by under；Swimming lane 1 is primer HPS3, and HPS4 is to 4 The amplification of type haemophilus parasuis type strain；Swimming lane 2 is primer HPS3, amplification of the HPS4 to bacterial strain HNHPS1；Swimming Road 3 is primer HPS1, amplification of the HPS2 to 4 type haemophilus parasuis type strains；Swimming lane 4 is primer HPS1, and HPS2 is to bacterium The amplification of strain HNHPS1；Swimming lane 5 is negative control；

Fig. 4 is bacterial strain HN1570 colonial morphology；

Fig. 5 is form under bacterial strain HN1570 thallus 100 × microscope of Gram's staining；

The PCR identification and serotype PCR qualification result that Fig. 6 is bacterial strain HN1570, the Marker in figure is 2000 bp of DL, from upper 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp are followed successively by under；Swimming lane 1 is primer HPS1, HPS2 expansion Increase HN1570 plants of 16S rRNA genetic results；Swimming lane 2 is that primer HPS5, HPS6 expand HN1570 plants of wciP genetic results；Swimming lane 3 For negative control；

Fig. 7 is bacterial strain HN SS1 colonial morphology；

Fig. 8 is form under bacterial strain HN SS1 thallus 100 × microscope of Gram's staining；

The PCR identification and serotype PCR qualification result that Fig. 9 is bacterial strain HN SS1, the Marker in figure is 2000 bp of DL, from upper 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp are followed successively by under；Swimming lane 1 is primer SS1, SS2 amplification Gdh genetic results；Swimming lane 2 is primer SS3, and SS4 expands cps2J genetic results；Swimming lane 3 is primer mrp1, and mrp2 expands mrp base Because of result；Swimming lane 4 is primer sly1, and sly2 expands sly genetic results；5 be primer epf1, and epf2 expands epf genetic results；

Figure 10 is bacterial strain HN APP1 colonial morphology；

Figure 11 is form under bacterial strain HN APP1 thallus 100 × microscope of Gram's staining；

The PCR that Figure 12 is bacterial strain HN APP1 is identified and serotype PCR qualification result, and the Marker in figure is 2000 bp of DL, from Top to bottm is followed successively by 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp；Swimming lane 1,4 is negative control；Swimming Road 2 is primer APP3, and for APP4 to the amplification of 1 type actinobacillus pleuropneumoniae type strain, swimming lane 3 is primer The amplification of APP3, APP4 to bacterial strain HNAPP1；Swimming lane 5 is primer APP1, and APP2 is to 1 type contagious pleuropneumonia unwrapping wire bar The amplification of bacterium type strain；6 be primer APP1, amplification of the APP2 to bacterial strain HNAPP1.

Specific embodiment:

Present invention will be further explained below with reference to the attached drawings and examples.

Embodiment 1: the separation and identification of bacterial strain HNHPS1

The acquisition of 1.1 pathological material of diseases

On Henan Province, large-scale pig farm, Ruyang County severe pneumonia expiratory dyspnea and nerve occur for pathological material of disease from November, 2016 The 2 monthly ages child care pig of symptom death.

The preparation of 1.2 culture mediums

TSB fluid nutrient medium: by TSB gravy powder (Tryptic Soy broth, pancreas peptone soybean broth) 30g, it is dissolved in 1000 In mL ultrapure water, 115 DEG C of 15 min of sterilizing add 50 mL of fetal calf serum, sterile 1%NAD(Nicotinamide adenine Dinucleotide, nicotinamide adenine dinucleotide, cozymase) 1 mL；

TSA solid medium: TSA agar powder (Tryptic Soy Agar, tryptose soya agar) 40g is dissolved in In 1000mL ultrapure water, 115 DEG C of sterilizing 15min add fetal calf serum 50mL, sterile 1%NAD 1mL, save backup in 4 DEG C.

1.3 bacteriums are separately cultured

The brain tissue of aseptic collection sick pig is inoculated on the TSA solid medium containing NAD, cultivates 36 in 37 DEG C of constant incubators H grows consistent tip-like size, colorless and transparent, smooth, wet, the bacterium colony (see figure 1) that diameter is 1~2 millimeter. It purifies and is inoculated on the TSA solid medium without NAD, cannot be grown on the TSA culture medium without NAD.Gram dye Color, the bacterium are Gram-negative bacteria (see figure 2), have a variety of different forms, Filamentous from single coccobacillus to elongated cause Thallus is named as bacterial strain HNHPS1.

The identification of 1.4 bacterial strains

1.4.1 design primer

Expansion according to sequence design a pair of universal primer of haemophilus parasuis 16S rRNA gene, for haemophilus parasuis Increase, primer sequence is as follows:

HPS1:5 '-GTGATGAGGAAGGGTGGTGT -3 ' (SEQ ID NO.1)

HPS2:5 '-GGCTTCGTCACCCTCTGT -3 ' (SEQ ID NO.2)

Amplified fragments size is 822bp.

Simultaneously according to the specific primer of 4 type of sequence design a pair of haemophilus parasuis of haemophilus parasuis wciP, use In the amplification of 4 type of haemophilus parasuis, primer sequence is as follows:

HPS3:5 '-GGTTAAGAGGTAGAGCTAAGAATAGAGG -3 ' (SEQ ID NO.3)

HPS4:5 '-CTTTCCACAACAGCTCTAGAAACC-3 ' (SEQ ID NO.4)

Amplified fragments size is 349bp.

1.4.2 PCR is identified

The DNA of bacterial strain HNHPS1 is extracted according to the operating procedure of DNA extraction kit, spectrophotometric determination concentration is 100ug/mL carries out PCR identification.Meanwhile it is positive control that 4 type haemophilus parasuis type strains, which are arranged, and streptococcus suis 2-type is arranged Type strain is negative control.

Pcr amplification reaction system is 25 μ L:10 × buffer, 2.5 μ L, 2.5mM dNTPs, 0.5 μ L, and 10 μM/L is general to be drawn DdH is added in each 1 μ L, 100ug/mL DNA profiling of 1 μ L, 5U/ μ L rTaq, 1 μ L of object HPS1, HPS2₂O to 25 μ L.

Reaction condition: 95 DEG C of initial denaturation 5min, into circulation: 95 DEG C of 1 min, 57 DEG C of 1 min, 72 DEG C of 30 s, totally 35 A circulation, last 72 DEG C of extensions 10min, 4 DEG C of PCR product preservations.

Amplified production carries out electrophoresis respectively, and every hole is loaded 10 μ L, 1% agarose gel electrophoresis, observes result under ultraviolet light (see figure 3).As a result amplify 822bp segment, sequencing with haemophilus parasuis SH0165 plants (GenBank NO:CP001321), ZJ0906 plants (GenBank NO:CP005384), KL0318 plants of (GenBank NO:CP009237) 100% it is homologous, with SC1401 Strain (GenBank NO:CP015099) 99.6% is homologous, and sequencing result is as follows, it was demonstrated that bacterial strain HNHPS1 is haemophilus parasuis (Haemophilus parasuis).

GTGATGAGGAAGGGTGGTGTTTTAATAGAGCATTACATTGACGTTAGTCACAGAAGAAGCACCGGCTA ACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATGACTGGGCGTAAAGGGCACGCAGG CGGTGACTTAAGTGAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATTTCATACTGGGTTGCTAGAGTATTT TAGGGAGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGAAGGCGAAGGCAGCCC CTTGGGAAAATACTGACGCTCATGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGT AAACGCTGTCGATTTGGGGATTGGGCTTTATGTTTGGTGCCCGTAGCTAACGTGATAAATCGACCGCCTGGGGAGT ACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGC AACGCGAAGAACCTTACCTACTCTTGACATCCTAAGAAGCTTTCAGAGATGAGAGTGTGCCTTCGGGAACTTAGAG ACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATC CTTTGTTGCCAGCGATTCGGTCGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGACGTC AAGTCATCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGTGCATACAG AGGGTGACGAAGCC(SEQ ID NO.5).

1.4.3 Serotype Identification

349 bp are as a result amplified with specific primer HPS3, the HPS4 amplification of 4 type of haemophilus parasuis referring to 1.4.2 method , card homologous with SW124 plants of (GenBank NO:KC795356) 100% of 4 type haemophilus parasuis is sequenced in size segment (see figure 3) Bright bacterial strain HNHPS1 is 4 type haemophilus parasuis.

GGTTAAGAGGTAGAGCTAAGAATAGAGGATATATCACTCCAAGTGAATTAGGATGTACGTTAAGTCAT TTTTCCGTGTATCGTGATTTTTTAAATAGTGATAAGGAATGGTTATTAGTTCTAGAAGATGATGTAACTATAAATA GTAATTTATTTTTTCTATTGGAGAGTATTATTAATCAAAATTATAGTGACTATATTAATATTCTGGGGGGACAGGA GGGGTTGAAAAGACCTAGAGTGCTAGAGTTTCTTTTTCGAGAAAATATAAAAATTCTTAATTCCCCTTTTTATGGA TTCTTTTTATATCGAACGTGTAGTTATTTGGTTTCTAGAGCTGTTGGTGGAAAG(S EQ ID NO.6).

Embodiment 2: HN1570 plants of bacterial strain of separation and identification

The preparation of 2.1 culture mediums

Referring to the method preparation TSB fluid nutrient medium and TSA solid medium in embodiment 1.

2.2 HN1570 plants of bacterial strains are separately cultured

Applicant's painstaking effort that aseptically the child care pig of typical polyserositis occurred for acquisition in 2017, which are inoculated in, to be contained Have on the TSA solid medium of NAD, 36 h is cultivated in 37 DEG C of constant incubators, the doubtful bacterium colony of picking carries out passage purifying, then trains Support 24~48 hours after observe haemophilus parasuis colonial morphology, grow consistent tip-like size, it is colorless and transparent, smooth, Wet, the bacterium colony (see figure 4) that diameter is 1~2 millimeter；While purifying and it is inoculated in the TSA solid culture without NAD On base, it cannot be grown on the TSA culture medium without NAD；

The single bacterium colony of picking purifying carries out gram stain microscopy, and observation morphological features are Gram-negative bacteria, has A variety of different forms cause Filamentous thallus (see figure 5) from single coccobacillus to elongated.From bacterial strain HN1570 morphology and life The measurement result for changing characteristic tentatively judges that bacterial strain HN1570 belongs to haemophilus parasuis Pseudomonas.

The identification of 2.3 bacterial strain HN1570

2.3.1 design of primers

The universal primer of haemophilus parasuis designs same HNHPS1.

According to the specific primer of 5 type of sequence design a pair of haemophilus parasuis of haemophilus parasuis wciP, for pair The amplification of 5 type of haemophilus suis, primer sequence are as follows:

HPS5:5 '-CCACTGGATAGAGAGTGGCAGG -3 ' (SEQ ID NO.7)

HPS6:5 '-CCATACATCTGAATTCCTAAGC-3 ' (SEQ ID NO.8)

Amplified fragments size is 450bp.

2.3.2 PCR is identified

The DNA of bacterial strain HN1570 is extracted according to the operating procedure of DNA extraction kit, referring to PCR amplification method in embodiment 1 PCR amplification is carried out to bacterial strain HN1570.

Amplified production is subjected to electrophoresis, every hole is loaded 10 μ L, 1% agarose gel electrophoresis, observed under ultraviolet light result (see Fig. 6).As seen from the figure, the present embodiment strain to be tested, that is, bacterial strain HN1570 is equally amplified with haemophilus parasuis reference culture 822bp segment, bacterial strain HN1570 sequencing and haemophilus parasuis CLSH0104 plants (GenBank NO:CP024412), 29755 plants (GenBank NO:CP021644), KL0318 plants of (GenBank NO:CP009237) 99% are homologous；Prove that bacterial strain HN1570 is pair Haemophilus suis (Haemophilus parasuis).

2.3.3 Serotype Identification

Referring to 1.4.2 method, is expanded with specific primer HPS5, HPS6 of 5 type of haemophilus parasuis, as a result amplify 450bp Size segment (see figure 6), sequencing result is as follows, sequencing with KL0318 plants of 5 type haemophilus parasuis (GenBank NO: CP009237) 99% is homologous, it was demonstrated that bacterial strain HN1570 is 5 type haemophilus parasuis.

CCTCCATACATTCGAATTCCTAAGCCAAAAATATATTTTATTTCTAGGGAACCAGCCATGACTTAAAA AATCAACTGGTTTATCATGAAAGAAAAAGCGCTCTTTATTGACACCCCTCATAATAATCACATCATCATTTAAATA TACAAAATTTTCAGATAGAGCATCTATATTACCCAAATTCATTTCAATTGAACTGGAATTAAAAATAGGAAGGTGT TCTTTCTCATAATAAAGCTGATTATGTGTAATTAAAAATATTTTTTCATTATTTATATCTAACCATTCAGGAAAGT GTCCCTCAGTAATTAAATATATTCTATTATACCAAGGGCAGTTTTTTTCTATAGATCTTAGAACATATCTTAGAGT TCCCATATCTCTATATCTTGATTCAGAATTTGAACTAGTTTCTTTTAAATTTATATTACTATAGAAACTTTTTTTT GCCTGCCACTCTCTTATCCAGTGGA(SEQ ID NO.9).

Embodiment 3: the separation and identification of bacterial strain HNSS1

The preparation of 3.1 culture mediums

Referring to method preparation TSB fluid nutrient medium and TSA solid medium in embodiment 1.

3.2 bacterial strain HNSS1's is separately cultured

On Henan Province, large-scale pig farm, Xunxian severe pneumonia expiratory dyspnea and neurosis occur for pathological material of disease from November, 2016 The 2 monthly ages child care pig of shape death, the brain tissue of aseptic collection sick pig are inoculated on the TSA solid medium containing NAD, 37 DEG C of perseverances It is cultivated in warm incubator for 24 hours, grows that consistent tip-like size, 0.5~1 mm of single bacterium colony, canescence are semi-transparent on blood plate Bright, round, smooth, neat in edge is in α haemolysis (see figure 7).After purifying inoculation, Gram's staining is carried out, which is gram Positive bacteria, round or oval, catenation or in pairs, the (see figure 8) different in size of chain are named as bacterial strain HNSS1.

The identification of 3.3 bacterial strains

3.3.1 design primer

According to sequence design a pair of universal primer of Streptococcus suis gdh gene, for the amplification of Streptococcus suis, primer sequence is such as Under:

SS1:5 '-GCAGCGTATTCTGTCAAACG-3 ' (SEQ ID NO.10)

SS2:5 '-CCATGGACAGATAAAGATGG -3 ' (SEQ ID NO.11)

Amplified fragments size is 689bp.

According to the specific primer of sequence design a pair of streptococcus suis 2-type of Streptococcus suis cps2J gene, it to be used for pig hammer The amplification of 2 type of bacterium, primer sequence are as follows:

SS3:5 '-TGATAGTGATTTGTCGGGAGGG-3 ' (SEQ ID NO.12)

SS4:5 '-GAGTATCTAAAGAATGCCTATTG -3 ' (SEQ ID NO.13)

Amplified fragments size is 557bp.

According to the sequence design pair of primers of Streptococcus suis extracellular factor (epf) gene, it to be used for Streptococcus suis extracellular factor (epf) amplification of gene, primer sequence are as follows:

Epf1:5 '-GCTACGACGGCCTCAGAAATC-3 ' (SEQ ID NO.14)

Epf2:5 '-TGGATCAACCACTGGTGTTAC-3 ' (SEQ ID NO.15)

Amplified fragments size is 626 bp.

According to the sequence design pair of primers of Streptococcus suis muramidase-released protein (mrp) gene, it to be used for pig hammer bacteriolyze The amplification of enzyme r e lease albumen (mrp) gene, primer sequence are as follows:

Mrp1:5 '-ATCAGAATCACCACTTTTGG-3 ' (SEQ ID NO.16)

Mrp2:5 '-TCATACCCA GTAAATACACG-3 ' (SEQ ID NO.17)

Amplified fragments size is 885 bp.

According to the sequence design pair of primers of Hemolysin (sly) gene, it to be used for pig hammer hemolysin (sly) base The amplification of cause, primer sequence are as follows:

Sly1:5 '-ATGAGAAAAAGTTCGCACTTGATT-3 ' (SEQ ID NO.18)

Sly2:5 '-TTGCCAGATTACTCTATCA-3 ' (SEQ ID NO.19)

Amplified fragments size is 1502 bp.

3.3.2 PCR is identified

The DNA of bacterial strain HNSS1 is extracted according to the operating procedure of DNA extraction kit, spectrophotometric determination concentration is 100ug/mL carries out PCR identification.

Pcr amplification reaction system is 25 μ L:10 × buffer, 2.5 μ L, 2.5mM dNTPs, 0.5 μ L, and 10 μM/L is general to be drawn DdH is added in each 1 μ L, 100ug/mL DNA profiling of 1 μ L, 5U/ μ L rTaq, 1 μ L of object SS1, SS2₂O to 25 μ L.

Reaction condition: 95 DEG C of initial denaturation 5min, into circulation: 95 DEG C of 1 min, 57 DEG C of 1 min, 72 DEG C of 30 s, totally 35 A circulation, last 72 DEG C of extensions 10min, 4 DEG C of PCR product preservations.

Amplified production carries out electrophoresis respectively, and every hole is loaded 10 μ L, 1% agarose gel electrophoresis, observes result under ultraviolet light (see figure 9).As a result 689bp segment is amplified, sequencing is same with Streptococcus suis SS2-1 plants (GenBank NO:CP018908) 100% Source, sequencing result are as follows, it was demonstrated that bacterial strain HNSS1 be Streptococcus suis (Streptococcus suis).

GCAGCGTATTCTGTCAAACGAGCGCGGCGTTTTTCTTTGATGTCCACCAAGAGGTCGAAGTCGATACC AGTTTCGTCAATGATGTAACCATTTGAGTCTGAAACAGAAATAACTTTTGCACCAAGTTCAGTCGCTTTTTGAACA GCATATTGGGCAACGTTACCAGAACCTGAGATAAGGACAGTTTGGTCTTTGAAGGATTTACCGTTTGCTGCCAACA TGTTATCAGTGAAGTAAACCAAACCGTAACCAGTTGCTTCTGGGCGGATCAATGAACCACCGAAGCCAAGAGGTTT ACCAGTCAAGACACCTGCATCAAACTGGCGGAGGCGTTTGTATTGACCGTACATGTAACCGATCTCACGACCACCG ACACCGATGTCACCAGCAGGGACGTCAAGTGAAGGTCCGATGTGTTTTTGCAATTCAGTCATGAAGCTTTGGCAGA AGCGCATGATTTCAGCATCAGTTTTTCCTTTAGGATCAAAGTCTGAACCACCTTTACCACCGCCGATTGGAAGACC AGTCAAGACGTTTTTGAAGATTTGCTCAAAACCGAGGAACTTCAAGATGGATTGGTTTACAGTTGGGTGGAAGCGA AGACCGCCTTTATAAGGACCTACAGCTGAGTTGAACTGAACACGGTAGCCACGGTTGACTTGAACATTTCCATCTT TATCTGTCCATGG(SEQ ID NO.20).

3.3.3 Serotype Identification

557 bp big or small slices are as a result amplified with specific primer SS3, the SS4 amplification of streptococcus suis 2-type referring to 3.3.2 method Section (see figure 9), is sequenced homologous with SS2-1 plants of (GenBank NO:CP018908) 100% of Streptococcus suis, it was demonstrated that bacterial strain HNSS1 is 2 type Streptococcus suis.

TGATAGTGATTTGTCGGGAGGGTTACTTGCTACTTTTGATGGAAATTATCAAGAATCTGAGCTGCAAA AGTGTCAAATTGATTTGGAAGAGATAAAAGAGGTGCGAGACTTAGGAAATGAAAATTTTCCAAATCATTATATGAG CGGTATCTTTAATAGCCCTTGTTGCAAACTTTATAAGAATATATATATAAACAAAGGTTTTGACACTGAACAGTGG TTAGGAGAGGACTTATTATTTAATCTAAATTATTTAAAGAATATAAAAAAAGTCAGCTATGTAAACAGAAATCTTT ATTTTGCTAGAAGAGGTATACAAAGTACTACAAATACGTTTAAAAAAGATGTTTTTATTCAATTAGAAAATTTAGA AGAAAAAACTTTTGATTTGTTTGTTAAAATATTTGGTGGACAATATGAATTTTCTGTTTTTAAAGAGACGCTACAG TGGCATATTATTTATTATAGCTTATTAATGTTCAAAAATGGAGATGAATCGCTTCCAAAGAAATTGCATATATTTA AGTATTTATACAATAGGCATTCTTTAGATACTC (SEQ ID NO.21).

3.3.4 virulence factor is identified

Referring to 3.3.2 method, with Streptococcus suis Streptococcus suis extracellular factor (epf) gene, muramidase-released protein (mrp) base Cause, the amplification of hemolysin (sly) gene primer, as a result amplify 626 bp, 885 bp, 1502 bp size segments (see figure respectively 9) it, is sequenced homologous with SS2-1 plants of (GenBank NO:CP018908) 100% of Streptococcus suis, it was demonstrated that 2 separated type Streptococcus suis Virulence factor genotype be sly⁺ mrp⁺ epf⁺。

Embodiment 4: the separation and identification of bacterial strain HNAPP1

The acquisition of 4.1 pathological material of diseases

Pathological material of disease is acute dead in the large-scale pig farm generation severe pneumonia expiratory dyspnea in Ruzhou City, Henan Province from November, 2016 The 5 monthly ages growing and fattening pigs died.

The preparation of 4.2 culture mediums

Referring to the method preparation TSB fluid nutrient medium and TSA solid medium in embodiment 1.

4.3 bacteriums are separately cultured

The painstaking effort of aseptic collection sick pig are inoculated on the TSA solid medium containing NAD, cultivate 24 in 37 DEG C of constant incubators H grows consistent circular protrusions, translucent, smooth, wet, the bacterium colony that diameter is 1~1.5 millimeter, 45 ° of refraction light Lower observation has apparent golden red band blue-fluorescence (see figure 10).It purifies and is inoculated on the TSA solid medium without NAD. It cannot be grown on the TSA culture medium without NAD.Gram's staining (see Figure 11), the bacterium be Gram-negative bacteria, coccobacillus, Dialister bacterium, part form Filamentous thallus, are named as bacterial strain HNAPP1.

The identification of 4.4 bacterial strains

4.4.1 design primer

According to sequence design a pair of universal primer of Actinobacillus pleuropneumoniae ApxIV gene, it to be used for Actinobacillus pleuropneumoniae Amplification, primer sequence is as follows:

APP1:5 '-GCTCACCAACGTTTGCTCAT-3 ' (SEQ ID NO.22)

APP2:5 '-GGGGACGTAACTCGGTGATT -3 ' (SEQ ID NO.23)

Amplified fragments size is 377 bp.

Simultaneously according to sequence design a pair of Actinobacillus pleuropneumoniae 1 of Actinobacillus pleuropneumoniae pod membrane CPS1B gene The specific primer of type, for the amplification of 1 type of Actinobacillus pleuropneumoniae, primer sequence is as follows:

APP3:5 '-CTGGAGTAATTACGGCGACTATTCC-3 ' (SEQ ID NO.24)

APP4:5 '-AGGAGAAGCTAGTAGTACTTGCATTTTC -3 ' (SEQ ID NO.25)

Amplified fragments size is 959 bp.

4.4.2 PCR is identified

The DNA of bacterial strain HNAPP1 is extracted according to the operating procedure of DNA extraction kit, spectrophotometric determination concentration is 100ug/mL carries out PCR identification.Meanwhile it is positive control that 1 type Actinobacillus pleuropneumoniae type strain, which is arranged, and it is thermophilic that secondary pig is arranged 4 type type strain of blood bacillus is negative control.

Pcr amplification reaction system is 25 μ L:10 × buffer, 2.5 μ L, 2.5mM dNTPs, 0.5 μ L, and 10 μM/L is general to be drawn DdH is added in each 1 μ L, 100ug/mL DNA profiling of 1 μ L, 5U/ μ L rTaq, 1 μ L of object APP1, APP2₂O to 25 μ L.

Reaction condition: 95 DEG C of initial denaturation 5min, into circulation: 95 DEG C of 1 min, 57 DEG C of 1 min, 72 DEG C of 30 s, totally 35 A circulation, last 72 DEG C of extensions 10min, 4 DEG C of PCR product preservations.

Amplified production carries out electrophoresis respectively, and every hole is loaded 10 μ L, 1% agarose gel electrophoresis, observes result under ultraviolet light. As a result it amplifies 377bp segment (see Figure 12), sequencing and 8392 plants of ApxIVA gene (GenBank of Actinobacillus pleuropneumoniae NO:AF188867) 100% is homologous, and sequencing result is as follows, it was demonstrated that bacterial strain HNAPP1 is Actinobacillus pleuropneumoniae (Actinobacillus pleuropneumoniae).

GGGGACGTAACTCGGTGATTGATGCCGGTGCGGGTAATGATACGGTTAATGGCGGTAATGGCGATGAC ACCCTCATCGGCGGCAAAGGTAATGATATTCTAAGAGGTGGCTACGGTGCGGACACCTATATCTTTAGCAAAGGAC ACGGACAGGATATCGTTTATGAAGATACCAATAATGATAACCGCGCAAGAGATATCGACACCTTAAAATTTACTGA TATTAATTTATCCGAACTTTGGTTTAGCCGAGAAAATAACGATTTGATTATTAAATCATTATTAAGTGAGGATAAA GTCACGGTTCAAAATTGGTATTCACACCAAGATCATAAAATAGAAAATATTCGTTTATCGAATGAGCAAACGTTGG TGAGC(SEQ ID NO.26).

4.4.3 Serotype Identification

It is as a result amplified referring to 4.4.2 method with specific primer APP3, the APP4 amplification of 1 type of Actinobacillus pleuropneumoniae 959 bp size segments (see Figure 12) are sequenced and S4074 plants of 1 type Actinobacillus pleuropneumoniae (GenBank NO:AF518558) 100% is homologous, it was demonstrated that bacterial strain HNAPP1 is 1 type Actinobacillus pleuropneumoniae.

CTGGAGTAATTACGGCGACTATTCCTGAATATAACTCAATAGTAGAAGAACTAAATAAATATAAAATT GGTAAAAAGGAAACATTTTTAACAGGATTTCCTCGCCATGATAAATTACTATCTGGAAATATAAAAGGAGCTAAGA CAATTCTCATCGTACCTACATGGCGACATTATATTATGGGGACTCAAATTGGAAAAGGAGCCAATACACGCGAGCT AAATAAAGCCTTTATGACAACAAATTATGCTAAAGCTTGGTATAATTTATTACATAGTCAGGAATTAAAAAATTTA ATTAAAAATTTAGGATATAAAGTTATTTTTGCACCACACCCTAATATTGAACCATATTTAAATGAGTTTAACATCC CCCAATATATTGATGTGTGGAAAAGTGCAATATCAAGAGAAAGTATGCAAAGTTTATTCCAACAATCAAATCTATT GATTACGGACTATTCATCTATTGCATTTGAAATGGCATTTCTAGGAAAACAAACAATCTATTACCAATTTGATAAA GAGGAATTTAGATCTGGAATTCATACATATCAACAAGGATACTTTGAATACGAGAAAGATGGATTTGGTCCTGTAG CTGAAACATTAGATGATTTATTTATTCACCTAGATAAATTCGTAAACGGTGAAAATGATTACATAAATATTTATCA ATCTCGTATACAAAAAACATTTAAATATCGGGATACGAATAATTGCCAACGTGTTTATGAAGCTATTATTAACTTA GATATGCCGGATAAAGATATTAATAAAAATATTATCTTAAATGCTTTAGAATCTGCTTACAAAGCTCAAGACTGGA ATTTAGTTATCTCTCGTGCTGAAGCTTTATTAGCAGAAATACCTAATCATTCATTTGCTAAGAGTGTGTTATTGAA GCAGTGATAGCTTCAAACAATAAAGAGAAAATGCAAGTACTACTAGCTTCTCCT(S EQ ID NO.27).

Embodiment 5: virulence test

The virulence test of 5.1 haemophilus parasuis

Child care pig 12 for choosing 9 ~ 10 week old wean health are experimental animal.Experimental animal is randomly divided into 4 groups, control group 4 Head, test 1 group 4, test 2 groups 4.By HNHPS1 plants, the HN1570 plants inoculation TSB liquid trainings respectively of haemophilus parasuis bacterial strain Base is supported, after 37 DEG C of 24 h of shaking table culture, measures cell concentration, continuous 10 times of dilution spread solid plates, viable bacteria meter under low power lens Number calculates stoste cell concentration, adjusts to 10⁸CFU/mL；1,2 group of animal of test passes through Intratracheal inoculation 3 respectively MLHNHPS1, HN1570 haemophilus parasuis liquid culture, control animals pass through the TSB liquid of 3 mL of Intratracheal inoculation sterilizing Body culture medium.Situations such as being observed continuously after injection 2 weeks, observing and recording its morbidity number and death toll.

Observation discovery: 1 and 2 group of test shows the symptoms such as breathe, have difficulty in breathing in inoculation haemophilus parasuis afterwards for 24 hours, Body temperature increases, ear, abdomen and buttocks cyanosis, and turn-takes.1 group is tested after 2 days dead 2 after dead 1,3 days；Test 2 groups after 2 days dead 2 after dead 2,3 days.Control animals body temperature between experimental period is normal and without apparent respiratory tract disease Shape.

It cuts open after the test and kills test group animal, while cuing open and killing 4 control animals, acquire pathological material of disease, carry out bacterium separation. 1,2 group of dissect lung of test has a large amount of fine plain sample exudations, with pleaural adhesion, hydropericardium, cor villosum, cerebral haemorrhage；Control group cuts open Apparent pathological change does not occur for inspection, and 4 parts of pathological material of diseases of control group are not separated to haemophilus parasuis, tests 4 parts of 1,2 group Haemophilus parasuis is separated in pathological material of disease, PCR qualification result is consistent with bacterial strain HNHPS1, HN1570.

Haemophilus suis strain HNHPS1, HN1570 are shown as the strongest bacterial strain of virulence as a result, determining by comprehensive virulence test.

The virulence test of Streptococcus suis HNSS1

Experimental animal is child care pig 8 of 4 ~ 7 week old wean health.Experimental animal is divided into two groups, and control group 4, test group 4 Only.HNSS1 is inoculated with TSB fluid nutrient medium, after 37 DEG C of 18 h of shaking table culture, measures cell concentration, continuous 10 times of dilution spreads Solid plate, count plate under low power lens calculate stoste cell concentration, adjust to 10⁸CFU/mL, test group animal pass through neck Portion's intramuscular injection is inoculated with 3 mL Streptococcus suis liquid cultures, and control animals pass through 3 mL of musculi colli injection inoculation sterilizing TSB fluid nutrient medium.Situations such as being observed continuously after injection 2 weeks, observing and recording its morbidity number and death toll.

Test group animal shows obvious high fever, swollen joint, opisthotonos, four limbs after being inoculated with 24 h of Streptococcus suis and draws Water, expiratory dyspnea, nostril such as are bled at the symptoms, all dead in 3 days.Control animals body temperature between experimental period is normal and without obvious Respiratory symptom.It cuts open after the test and kills test group animal, while cuing open and killing 4 control animals.Pathological material of disease is acquired, pig chain is carried out Coccus separation.Test group dissect empsyxis enlargement, hydrops articuli, cerebral haemorrhage.Apparent pathology does not occur for control group dissect Variation, 4 parts of pathological material of diseases of control group are not separated to Streptococcus suis, are separated to Streptococcus suis, PCR in 4 parts of pathological material of diseases of test group Qualification result is consistent with HNSS1.

The virulence test of Actinobacillus pleuropneumoniae HNAPP1

Experimental animal is child care pig 8 of 2 monthly ages wean health.Experimental animal is divided into two groups, control group 4, test group 4. HNAPP1 is inoculated with TSB fluid nutrient medium, after 37 DEG C of 18 h of shaking table culture, measures cell concentration, continuous 10 times of dilution spreads are solid Body plate, count plate under low power lens calculate stoste cell concentration, adjust to 10⁸CFU/mL, test group animal pass through collunarium 3mL Actinobacillus pleuropneumoniae liquid culture is infected, control animals are trained by the TSB liquid that Intratracheal inoculation 3mL sterilizes Support base.Situations such as being observed continuously after injection 2 weeks, observing and recording its morbidity number and death toll.

Test group animal shows the symptoms such as expiratory dyspnea after being inoculated with 12 h of Actinobacillus pleuropneumoniae, and body temperature increases, Ear, abdomen and buttocks cyanosis, the ground that finally crouches do not rise, jerk, death by suffocation, and dead preceding mouth and nose flow out the blood with foam. 2nd day dead 1, dead 3 after 2 days.Control animals appetite, spirit, body temperature during test is normal.After the test It cuts open and kills test group animal, while cuing open and killing 4 control animals.Pathological material of disease is acquired, Actinobacillus pleuropneumoniae separation is carried out.Test group The exudation of dissect cardiopulmonary fibre disposition, pericardiosymphysis, lung aubergine, section succulence, the outflow of color liquid, trachea-bronchial epithelial cell is full of bubble Foam shape, hemorrhagic mucus.Apparent pathological change does not occur for control group dissect, and 4 parts of pathological material of diseases of control group are not separated to pleura Actinobacillus is separated to Actinobacillus pleuropneumoniae, PCR qualification result and HNAPP1 mono- in 4 parts of pathological material of diseases of test group It causes.

Embodiment 6: preparation, safety and the potency test of vaccine

The preparation of 6.1 vaccines

6.1.1 strain and culture propagation

First order seed breeding

By HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type and pleuropneumonia unwrapping wire bar Bacterium HNAPP1 plants of freeze-drying lactobacillus of 1 type are inoculated in the TSA containing newborn bovine serum (final concentration 5%) and NAD (final concentration 0.01%) respectively On plate, 37 DEG C of cultures 18 ~ for 24 hours, the satisfactory colonies typical of picking, passage is inoculated with the (final concentration containing newborn bovine serum respectively 5%) with the TSA plate of NAD (final concentration 0.01%), 37 DEG C are cultivated for 24 hours, after the assay was approved, as first order seed.

Secondary seed breeding

Each strain first order seed is inoculated in the TSB liquid containing newborn bovine serum (final concentration 5%) and NAD (final concentration 0.01%) respectively In body culture medium, 37 DEG C, 5%CO₂Shaking table shaken cultivation 18 ~ for 24 hours, it carries out purely after the assay was approved, as secondary seed.

6.1.2 antigen bacterium solution culture

The secondary seed of two kinds of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae bacterial strain is inoculated with respectively by 1% In the TSB fluid nutrient medium containing newborn bovine serum (final concentration 5%) and NAD (final concentration 0.01%), respectively at 37 DEG C, 5%CO₂ Shaking table shaken cultivation 18~harvest bacterium solution afterwards for 24 hours.

6.1.3 count plate

By existing " Chinese veterinary pharmacopoeia " annex method, using be suitable for the growth of this bacterium containing 5% newborn bovine serum and 0.01%NAD TSA culture medium carry out count plate.Using shaking flask culture, count plate concentration, four kinds of strain culturing viable bacteria contents are 1.0 ×10⁹CFU/mL or more.

6.1.4 bacterium solution inactivates

Volume total amount is added to the culture solution of two kinds of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae bacterial strain respectively 0.2% formalin, 37 DEG C inactivation for 24 hours.

6.1.5 inactivation is examined

The inactivated bacterial liquid 0.2mL of two kinds of haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae bacterial strain is taken to be inoculated in respectively TSA plate (containing 5% newborn bovine serum and 0.01%NAD), sets 37 DEG C of culture 48h, and no bacterial growth is qualification.

6.1.6 the concentration of antigen

Four kinds of qualified antigen bacterium solutions are examined to pass through ultrafiltration system device concentration bacterium solution respectively inactivation.According to viable bacteria meter before inactivating Number is as a result, adjusted four kinds of somatic antigen concentration to 1.0 × 10 using sterile saline¹⁰CFU/mL, and by four kinds of antigen liquids It is uniformly mixed in the ratio of 1:1:1:1 (volume ratio).

6.1.7 vaccine preparation

(1) oil is mutually prepared: being taken in the oily phase tank of 92 parts of additions of injection white oil, into tank, 1 part of aluminum stearate of addition, stirring while adding Until fully transparent, add 6 parts of Si Ben -80,116 DEG C of high pressure sterilization 40min, added after being cooled to room temperature vitamin A and Each 0.5 part of vitamin E, be uniformly mixed obtain oil it is mutually spare；

(2) water phase prepare: by HNHPS1 plants of the haemophilus parasuis obtained after concentration, HN1570 plants, HNSS1 plants of Streptococcus suis and HNAPP1 plants of antigen liquids of Actinobacillus pleuropneumoniae are configured to antigen liquid according to 1: 1: 1: 1 ratio mixing, take by volume ratio 95 parts of antigen liquid, is sufficiently stirred up to being completely dissolved, it is spare to obtain water phase by 5 parts of Tween-80 after sterilizing is added；

(3) it emulsifies: according to the ratio of water phase and oily phase 1: 2, oily phase is added, into emulsion tank first with the revolving speed of 3000-4000rpm Stirring, then water phase is added into emulsion tank and continues to be stirred emulsification, packing bottling after the completion of emulsification.

Or the aluminum hydroxide adjuvant of the antigen liquid addition 10% mixed by volume to concentration, stirring are mixed well, are dispensed Obtain haemophilus parasuis, Streptococcus suis, the Actinobacillus pleuropneumoniae triple inactivated vaccine of aluminium hydroxide gel adjuvant.

The safety testing of 6.2 vaccines

14 age in days sodium selenite 10 is chosen, is divided into 2 groups, every group 5.

Vaccine group: 4 mL this vaccine of musculi colli injection；

Control group: musculi colli injects 4mL sterile saline.Animal heat is measured, clinical manifestation is observed, is observed 2 weeks altogether.

The child care pig of the vaccine group that makes discovery from observation and control group breathing, appetite, state of mind during entire observation is all normal, As can be seen from Table 1, mean body temperature, which increases, is no more than 1 DEG C, illustrates inactivated vaccine safety of the invention.

The Immunization of 6.3 vaccines is tested

15 age in days sodium selenite 100 is chosen, is haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae ELISA anti- Body is negative.Vaccine immunity challenge test sets up HNHPS1 plants of challenge test groups of haemophilus parasuis, haemophilus parasuis HN1570 Strain challenge test group, HNSS1 plants of Streptococcus suis and 4 big groups of challenge test group of HNAPP1 plants of Actinobacillus pleuropneumoniae.Per big group Test chooses piglet 25, is divided into 5 groups, every group 5.Specific grouping are as follows: 1 group of vaccine, 2 groups of vaccine, 3 groups of vaccine, vaccine 4 Group, every group of vaccine group is injected the vaccine 0.5ml, 1ml, 1.5ml, 2ml respectively；5th group is control group, injects 2 mL sterile physiologicals Salt water.Vaccine group and two exempt to inject the same dose of vaccines or sterile saline after control group 3 weeks.Two exempt from each group examination in latter 14 days It tests respectively with 10⁹Haemophilus parasuis HNHPS1, HN1570, Streptococcus suis HNSS1 and the Actinobacillus pleuropneumoniae of CFU HNAPP1 bacterial strain bacterium solution takes collunarium to attack poison, observes the clinical manifestation of each group piglet, measures body temperature daily, observes 2 weeks altogether；It calculates The morbidity and mortality of entire observation cycle experimental piglet, measure body temperature, carry out bacterium separation to organs such as dead pig lungs Culture.

Observation discovery: vaccine group and non-immune group have apparent difference, and two kinds of haemophilus parasuis attack after poison the 2nd day, not The piglet 2d of immune group starts clinical symptoms occur, and body temperature increases, and expiratory dyspnea is turn-taked, and starts death occur after 2d, and 2 weeks It is dead 5 total afterwards；There is hydrops in the non-immune group death pig thoracic cavity of dissect and abdominal cavity, and have fibrinous exudate, hydropericardium, the heart Wrap it is intracavitary have fibrinous exudate, pericardiosymphysis, lungs enlargement, two sides lobe of the lung extravasated blood or a bleeding, the exudation of surface fiber disposition Object, meninx is congested, and cerebrospinal fluid increases；And in vaccine group, there is 1 clinical symptoms and disease occur in 5 piglets of 0.5ml vaccine group Example variation；5 piglets of 1ml, 1.5ml and 2ml vaccine group do not fall ill；

Streptococcus suis vaccine group and non-immune group have apparent difference, attack after poison the 2nd day, non-immune group starts to face for second day Bed symptom, body temperature raising, expiratory dyspnea, opisthotonos start to occur dead, 5 all death in 1 week on the 2nd day；Dissect is dead Pig lungs enlargement extravasated blood or bleeding, hydrops articuli, meningorrhagia；And in vaccine group, there is 1 in 5 piglets of 0.5ml vaccine group There are clinical symptoms and case variation；5 piglets of 1ml, 1.5ml, 2ml vaccine group do not fall ill；

Actinobacillus pleuropneumoniae vaccine group and non-immune group have apparent difference, attack after poison second day, the piglet of non-immune group Start within second day clinical symptoms occur, body temperature raising, expiratory dyspnea starts death occur on the 2nd day, and dead preceding mouth and nose are bled, in 3 days Dead 5 altogether；There is hydrops in the non-immune group death pig thoracic cavity of dissect and abdominal cavity, and have fibrinous exudate, pericardiosymphysis, lungs Enlargement bleeding, tracheae are full of hemorrhagic foam object；And in vaccine group, there are 2 clinical condition occur in 5 piglets of 0.5ml vaccine group Shape and case variation；5 piglets of 1ml, 1.5ml and 2ml vaccine group do not fall ill.

HNHPS1 plants of haemophilus parasuis, HN1570 plants, HNSS1 plants of Streptococcus suis and HNAPP1 plants of Actinobacillus pleuropneumoniae Immunization result be shown in Table 2, table 3, table 4, table 5 respectively.

This vaccine 1ml immunizing dose is immunized that can to resist secondary pig thermophilic twice it can be seen from above-mentioned Immunization test result The infection of 4 type of blood bacillus serum, 1 type of 5 types, streptococcus suis 2-type and Actinobacillus pleuropneumoniae, illustrates inactivated vaccine of the invention With good protecting effect.

The foregoing is merely the optimal embodiments of the present invention, and for those skilled in the art, the present invention can have Various modifications and variations.All within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done, should all It is included within protection scope of the present invention.

Sequence table

<110>Animal Busbandry &. Veterinary Medicine Inst., Henan Prov. Academy of Agriculture

<120>a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine and its application

<141> 2019-04-19

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Haemophilus parasuis

<400> 1

gtgatgagga agggtggtgt 20

<210> 3

<211> 18

<212> DNA

<213> Haemophilus parasuis

<400> 3

ggcttcgtca ccctctgt 18

<210> 3

<211> 28

<212> DNA

<213> Haemophilus parasuis

<400> 3

ggttaagagg tagagctaag aatagagg 28

<210> 4

<211> 24

<212> DNA

<213> Haemophilus parasuis

<400> 4

ctttccacaa cagctctaga aacc 24

<210> 5

<211> 822

<212> DNA

<213> Haemophilus parasuis

<400> 5

gtgatgagga agggtggtgt tttaatagag cattacattg acgttagtca cagaagaagc 60

accggctaac tccgtgccag cagccgcggt aatacggagg gtgcgagcgt taatcggaat 120

gactgggcgt aaagggcacg caggcggtga cttaagtgag atgtgaaagc cccgagctta 180

acttgggaat tgcatttcat actgggttgc tagagtattt tagggagggg tagaattcca 240

cgtgtagcgg tgaaatgcgt agagatgtgg aggaataccg aaggcgaagg cagccccttg 300

ggaaaatact gacgctcatg tgcgaaagcg tggggagcaa acaggattag ataccctggt 360

agtccacgct gtaaacgctg tcgatttggg gattgggctt tatgtttggt gcccgtagct 420

aacgtgataa atcgaccgcc tggggagtac ggccgcaagg ttaaaactca aatgaattga 480

cgggggcccg cacaagcggt ggagcatgtg gtttaattcg atgcaacgcg aagaacctta 540

cctactcttg acatcctaag aagctttcag agatgagagt gtgccttcgg gaacttagag 600

acaggtgctg catggctgtc gtcagctcgt gttgtgaaat gttgggttaa gtcccgcaac 660

gagcgcaacc cttatccttt gttgccagcg attcggtcgg gaactcaaag gagactgcca 720

gtgataaact ggaggaaggt ggggatgacg tcaagtcatc atggccctta cgagtagggc 780

tacacacgtg ctacaatggt gcatacagag ggtgacgaag cc 822

<210> 6

<211> 350

<212> DNA

<213> Haemophilus parasuis

<400> 6

ggttaagagg tagagctaag aatagaggat atatcactcc aagtgaatta ggatgtacgt 60

taagtcattt ttccgtgtat cgtgattttt taaatagtga taaggaatgg ttattagttc 120

tagaagatga tgtaactata aatagtaatt tattttttct attggagagt attattaatc 180

aaaattatag tgactatatt aatattctgg ggggacagga ggggttgaaa agacctagag 240

tgctagagtt tctttttcga gaaaatataa aaattcttaa ttcccctttt tatggattct 300

ttttatatcg aacgtgtagt tatttggttt ctagagctgt tggtggaaag 350

<210> 7

<211> 22

<212> DNA

<213> Haemophilus parasuis

<400> 7

ccactggata gagagtggca gg 22

<210> 8

<211> 22

<212> DNA

<213> Haemophilus parasuis

<400> 8

ccatacatct gaattcctaa gc 22

<210> 9

<211> 473

<212> DNA

<213> Haemophilus parasuis

<400> 9

cctccataca ttcgaattcc taagccaaaa atatatttta tttctaggga accagccatg 60

acttaaaaaa tcaactggtt tatcatgaaa gaaaaagcgc tctttattga cacccctcat 120

aataatcaca tcatcattta aatatacaaa attttcagat agagcatcta tattacccaa 180

attcatttca attgaactgg aattaaaaat aggaaggtgt tctttctcat aataaagctg 240

attatgtgta attaaaaata ttttttcatt atttatatct aaccattcag gaaagtgtcc 300

ctcagtaatt aaatatattc tattatacca agggcagttt ttttctatag atcttagaac 360

atatcttaga gttcccatat ctctatatct tgattcagaa tttgaactag tttcttttaa 420

atttatatta ctatagaaac ttttttttgc ctgccactct cttatccagt gga 473

<210> 10

<211> 20

<212> DNA

<213> Streptococcus suis

<400> 10

gcagcgtatt ctgtcaaacg 20

<210> 11

<211> 20

<212> DNA

<213> Streptococcus suis

<400> 11

ccatggacag ataaagatgg 20

<210> 12

<211> 22

<212> DNA

<213> Streptococcus suis

<400> 12

tgatagtgat ttgtcgggag gg 22

<210> 13

<211> 23

<212> DNA

<213> Streptococcus suis

<400> 13

gagtatctaa agaatgccta ttg 23

<210> 14

<211> 21

<212> DNA

<213> Streptococcus suis

<400> 14

gctacgacgg cctcagaaat c 21

<210> 15

<211> 21

<212> DNA

<213> Streptococcus suis

<400> 15

tggatcaacc actggtgtta c 21

<210> 16

<211> 20

<212> DNA

<213> Streptococcus suis

<400> 16

atcagaatca ccacttttgg 20

<210> 17

<211> 20

<212> DNA

<213> Streptococcus suis

<400> 17

tcatacccag taaatacacg 20

<210> 18

<211> 24

<212> DNA

<213> Streptococcus suis

<400> 18

atgagaaaaa gttcgcactt gatt 24

<210> 19

<211> 19

<212> DNA

<213> Streptococcus suis

<400> 19

ttgccagatt actctatca 19

<210> 20

<211> 689

<212> DNA

<213> Streptococcus suis

<400> 20

gcagcgtatt ctgtcaaacg agcgcggcgt ttttctttga tgtccaccaa gaggtcgaag 60

tcgataccag tttcgtcaat gatgtaacca tttgagtctg aaacagaaat aacttttgca 120

ccaagttcag tcgctttttg aacagcatat tgggcaacgt taccagaacc tgagataagg 180

acagtttggt ctttgaagga tttaccgttt gctgccaaca tgttatcagt gaagtaaacc 240

aaaccgtaac cagttgcttc tgggcggatc aatgaaccac cgaagccaag aggtttacca 300

gtcaagacac ctgcatcaaa ctggcggagg cgtttgtatt gaccgtacat gtaaccgatc 360

tcacgaccac cgacaccgat gtcaccagca gggacgtcaa gtgaaggtcc gatgtgtttt 420

tgcaattcag tcatgaagct ttggcagaag cgcatgattt cagcatcagt ttttccttta 480

ggatcaaagt ctgaaccacc tttaccaccg ccgattggaa gaccagtcaa gacgtttttg 540

aagatttgct caaaaccgag gaacttcaag atggattggt ttacagttgg gtggaagcga 600

agaccgcctt tataaggacc tacagctgag ttgaactgaa cacggtagcc acggttgact 660

tgaacatttc catctttatc tgtccatgg 689

<210> 21

<211> 557

<212> DNA

<213> Streptococcus suis

<400> 21

tgatagtgat ttgtcgggag ggttacttgc tacttttgat ggaaattatc aagaatctga 60

gctgcaaaag tgtcaaattg atttggaaga gataaaagag gtgcgagact taggaaatga 120

aaattttcca aatcattata tgagcggtat ctttaatagc ccttgttgca aactttataa 180

gaatatatat ataaacaaag gttttgacac tgaacagtgg ttaggagagg acttattatt 240

taatctaaat tatttaaaga atataaaaaa agtcagctat gtaaacagaa atctttattt 300

tgctagaaga ggtatacaaa gtactacaaa tacgtttaaa aaagatgttt ttattcaatt 360

agaaaattta gaagaaaaaa cttttgattt gtttgttaaa atatttggtg gacaatatga 420

attttctgtt tttaaagaga cgctacagtg gcatattatt tattatagct tattaatgtt 480

caaaaatgga gatgaatcgc ttccaaagaa attgcatata tttaagtatt tatacaatag 540

gcattcttta gatactc 557

<210> 22

<211> 20

<212> DNA

<213> Actinobacillus pleuropneumoniae

<400> 22

gctcaccaac gtttgctcat 20

<210> 23

<211> 20

<212> DNA

<213> Actinobacillus pleuropneumoniae

<400> 23

ggggacgtaa ctcggtgatt 20

<210> 24

<211> 25

<212> DNA

<213> Actinobacillus pleuropneumoniae

<400> 24

ctggagtaat tacggcgact attcc 25

<210> 25

<211> 28

<212> DNA

<213> Actinobacillus pleuropneumoniae

<400> 25

aggagaagct agtagtactt gcattttc 28

<210> 26

<211> 377

<212> DNA

<213> Actinobacillus pleuropneumoniae

<400> 26

ggggacgtaa ctcggtgatt gatgccggtg cgggtaatga tacggttaat ggcggtaatg 60

gcgatgacac cctcatcggc ggcaaaggta atgatattct aagaggtggc tacggtgcgg 120

acacctatat ctttagcaaa ggacacggac aggatatcgt ttatgaagat accaataatg 180

ataaccgcgc aagagatatc gacaccttaa aatttactga tattaattta tccgaacttt 240

ggtttagccg agaaaataac gatttgatta ttaaatcatt attaagtgag gataaagtca 300

cggttcaaaa ttggtattca caccaagatc ataaaataga aaatattcgt ttatcgaatg 360

agcaaacgtt ggtgagc 377

<210> 27

<211> 958

<212> DNA

<213> Actinobacillus pleuropneumoniae

<400> 27

ctggagtaat tacggcgact attcctgaat ataactcaat agtagaagaa ctaaataaat 60

ataaaattgg taaaaaggaa acatttttaa caggatttcc tcgccatgat aaattactat 120

ctggaaatat aaaaggagct aagacaattc tcatcgtacc tacatggcga cattatatta 180

tggggactca aattggaaaa ggagccaata cacgcgagct aaataaagcc tttatgacaa 240

caaattatgc taaagcttgg tataatttat tacatagtca ggaattaaaa aatttaatta 300

aaaatttagg atataaagtt atttttgcac cacaccctaa tattgaacca tatttaaatg 360

agtttaacat cccccaatat attgatgtgt ggaaaagtgc aatatcaaga gaaagtatgc 420

aaagtttatt ccaacaatca aatctattga ttacggacta ttcatctatt gcatttgaaa 480

tggcatttct aggaaaacaa acaatctatt accaatttga taaagaggaa tttagatctg 540

gaattcatac atatcaacaa ggatactttg aatacgagaa agatggattt ggtcctgtag 600

ctgaaacatt agatgattta tttattcacc tagataaatt cgtaaacggt gaaaatgatt 660

acataaatat ttatcaatct cgtatacaaa aaacatttaa atatcgggat acgaataatt 720

gccaacgtgt ttatgaagct attattaact tagatatgcc ggataaagat attaataaaa 780

atattatctt aaatgcttta gaatctgctt acaaagctca agactggaat ttagttatct 840

ctcgtgctga agctttatta gcagaaatac ctaatcattc atttgctaag agtgtgttat 900

tgaagcagtg atagcttcaa acaataaaga gaaaatgcaa gtactactag cttctcct 958

Claims (6)

1. a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine, it is characterised in that: including The haemophilus parasuis bacterial strain HNHPS1 serotype antigen of inactivation, the haemophilus parasuis bacterial strain HN1570 serotype of inactivation are anti- Former, inactivation pig streptococcus bacterial strain HNSS1 serotype antigen, inactivation Actinobacillus pleuropneumoniae bacterial strain HNAPP1 antigen.

2. a kind of haemophilus parasuis according to claim 1, Streptococcus suis and Actinobacillus pleuropneumoniae three inactivate Vaccine, it is characterised in that: the bacterial strain HNHPS1 is 4 type haemophilus parasuis of serum (Haemophilus parasuis), in On November 22nd, 2016 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, and deposit number is CGMCC NO:13335；The bacterial strain HN1570 is Serotype 5 haemophilus parasuis (Haemophilus parasuis), in On November 09th, 2018 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, and deposit number is CGMCC NO:16802；The bacterial strain HNSS1 was 2 type Streptococcus suis (Streptococcus suis), November 22 in 2016 It is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center day, deposit number is CGMCC NO:13334； The bacterial strain HNAPP1 was 1 type Actinobacillus pleuropneumoniae (Actinobacilus pleuropneumoniae), in 2016 It was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on November 22, deposit number is CGMCC NO: 13333。

3. a kind of haemophilus parasuis according to claim 1, Streptococcus suis and Actinobacillus pleuropneumoniae three inactivate Vaccine, it is characterised in that: the bacterial strain HNHPS1 serotype antigen, bacterial strain HN1570 serotype antigen, bacterial strain HNSS1 serotype Antigen, bacterial strain HNAPP1 antigen ratio be 1: 1: 1: 1.

4. the preparation method of a kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine, special Sign is, comprising the following steps:

A. it is proliferated: by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type and pleuropneumonia HNAPP1 plants of 1 type of Actinobacillus breeds culture respectively, obtains haemophilus parasuis HNHPS1 plants, HN1570 plants, Streptococcus suis HNSS1 plants and Actinobacillus pleuropneumoniae HNAPP1 plants of bacterium solution, and count plate is carried out respectively；

B. inactivate: HNHPS1 plants of the haemophilus parasuis obtained respectively into step a, HN1570 plants, HNSS1 plants of Streptococcus suis and Formalin is added according to the 0.2% of bacterium solution volume in HNAPP1 plants of bacterium solutions of Actinobacillus pleuropneumoniae, for 24 hours in 37 DEG C of inactivations；

C. be concentrated: using ultrafiltration apparatus respectively be concentrated inactivation after examine qualification HNHPS1 plants of haemophilus parasuis, HN1570 plants, HNSS1 plants of Streptococcus suis are used sterile physiological according to the count plate before inactivation with Actinobacillus pleuropneumoniae HNAPP1 plants of bacterium solution Salt water adjustment concentration final concentration of 1.0 × 10¹⁰CFU/mL；

D. it prepares vaccine: including the following steps

(1) preparation of oily phase: taking in the oily phase tank of 92 parts of additions of injection white oil by volume, 1 part of aluminum stearate be added into tank, It is stirring while adding to add 6 parts of Si Ben -80,116 DEG C of high pressure sterilization 40min until fully transparent, after being cooled to room temperature again plus Enter vitamin A and each 0.5 part of vitamin E, be uniformly mixed obtain oil it is mutually spare；

(2) preparation of water phase: by HNHPS1 plants of the haemophilus parasuis obtained after concentration, HN1570 plants, HNSS1 plants of Streptococcus suis With HNAPP1 plants of antigen liquids of Actinobacillus pleuropneumoniae, it is configured to antigen liquid according to 1: 1: 1: 1 ratio mixing, by volume ratio 95 parts of antigen liquid is taken, 5 parts of Tween-80 after sterilizing is added are sufficiently stirred up to being completely dissolved, it is spare to obtain water phase；

(3) it emulsifies: according to the ratio of water phase and oily phase 1: 2, oily phase is added, into emulsion tank first with the revolving speed of 3000-4000rpm Stirring, then water phase is added into emulsion tank and continues to be stirred emulsification, packing bottling after the completion of emulsification.

5. a kind of haemophilus parasuis according to claim 4, Streptococcus suis and Actinobacillus pleuropneumoniae three inactivate The preparation method of vaccine, it is characterised in that: the operating procedure of culture is bred in the step a are as follows:

(1) first order seed is bred: by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type It is inoculated on TSA plate respectively with Actinobacillus pleuropneumoniae HNAPP1 plants of freeze-drying lactobacillus of 1 type, 37 DEG C are cultivated 18 ~ 24 hours, are chosen Take satisfactory colonies typical, respectively passage be inoculated on TSA plate, in 37 DEG C cultivate 24 hours, after the assay was approved, as First order seed；The NAD of newborn bovine serum and final concentration 0.01% in the TSA plate added with final concentration 5%；

(2) secondary seed is bred: by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type It is inoculated into TSB fluid nutrient medium respectively with Actinobacillus pleuropneumoniae HNAPP1 plants of first order seeds of 1 type, in 37 DEG C, 5%CO₂It shakes Bed shaken cultivation 18 ~ 24 hours carries out purely after the assay was approved, as secondary seed；It is added in the TSB fluid nutrient medium The newborn bovine serum of final concentration 5% and the NAD of final concentration 0.01%；

(3) by HNHPS1 plants of 4 type of haemophilus parasuis, HN1570 plants of 5 type, HNSS1 plants of streptococcus suis 2-type and pleuropneumonia unwrapping wire The secondary seed of 1 HNAPP1 plants of bacterial strains of type of bacillus is inoculated in TSB fluid nutrient medium respectively by 1%, in 37 DEG C, 5%CO₂Shaking table Shaken cultivation harvested bacterium solution after 18~24 hours；In the TSB fluid nutrient medium added with final concentration 5% newborn bovine serum and The NAD of final concentration 0.01%.

6. a kind of haemophilus parasuis, Streptococcus suis described in -5 any claims and pleuropneumonia are put according to claim 1 Line bar bacterium triple inactivated vaccine prevents and treats haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae correlation in preparation Application in the drug of disease.