CN109806389A

CN109806389A - A kind of trivalent inactivated vaccine against Haemophilus parasuis infection and its application

Info

Publication number: CN109806389A
Application number: CN201910131770.2A
Authority: CN
Inventors: 王治方; 徐引弟; 张青娴; 朱文豪; 许峰; 李海利; 郎利敏; 焦文强; 张立宪; 游一; 王克领
Original assignee: Institute of Animal Husbandry and Veterinary Medicine of Henan Academy of Agricultural Sciences
Current assignee: Institute of Animal Husbandry and Veterinary Medicine of Henan Academy of Agricultural Sciences
Priority date: 2019-02-22
Filing date: 2019-02-22
Publication date: 2019-05-28
Anticipated expiration: 2039-02-22
Also published as: CN109806389B

Abstract

The invention belongs to veterinary biologics technical fields, and in particular to a kind of 2 type of haemophilus parasuis serum, 5 types, 7 type tervalence inactivated vaccines and application.The preparation method of the separation of the bacterial strain for being used to prepare trivalent inactivated vaccine against Haemophilus parasuis infection the invention discloses three plants, identification and vaccine, three strain vaccine bacterial strains are respectively HN1553 plants of 2 type of haemophilus parasuis, deposit number is CGMCC NO:16801, HN1570 plants of haemophilus parasuis Serotype 5, deposit number is CGMCC NO:16802, HN1565 plants of haemophilus parasuis serum 7-type, and deposit number is CGMCC NO:16803.Vaccine of the invention can be very good to prevent the infection of clinical haemophilus parasuis serum 2 type, 5 types and 7 types, and vaccine preparation simple process, safety is good, duration of immunity, good immune effect.

Description

A kind of trivalent inactivated vaccine against Haemophilus parasuis infection and its application

Technical field

The invention belongs to veterinary biologics technical fields, and in particular to a kind of 2 type of haemophilus parasuis serum, 5 types, 7 The preparation of type tervalence inactivated vaccine and application.

Background technique:

Haemophilus parasuis (Haemophilus parasuis, HPS) be Pasteurella section a kind of Gram-negative it is polymorphic Dialister bacterium is the pathogen of pig Haemophilus parasuis, mainly causes polyserositis, arthritis and the meningitis of pig, face Bed shows as cough, expiratory dyspnea, and abdominal respiration, palpitating speed, skin surface is rubescent or pale, and the ear tip is blue, and eyelid is subcutaneous There is nose and suppurate liquid in oedema, part sick pig, and walking slowly or is reluctant to stand, and occur walking lamely or limpings of side property, wrist joint, instep pass Enlargement is saved, incoordination, front side is sleeping on one's deathbed or four limbs are in sample of striking.Sometimes also can non-evident sympton and die by visitation of God, when serious Sow abortion.This disease is widely present in worldwide, and German scholar Glsser was reported first in 1910, is also known as removed from office Laplace disease (Glsser's disease).

Haemophilus parasuis can infect the pig of various age brackets, occur mainly in after wean and the child care stage, main to feel The pig of 2 week old to 4 monthly ages is contaminated, disease incidence is generally 10%~15%, and up to 50%, which has become closely the death rate when serious Wean over year, one of the main reason for child care piglet is dead, is one of the main pathogen of clinical mixed infection, is caused to pig breeding industry Biggish economic loss seriously affects the sound development of pig breeding industry.

Haemophilus parasuis clinical serum type is more, and standard parting has 15 serotypes, and clinically there are also 20% or more no Separable bacterial strain, the cause of disease are in worldwide distribution, and various regions epidemic link serotype is different, lacks immunological cross between each serotype Protective capability.Two kinds of approach of clinical prevention and control Haemophilus parasuis have antibiotic usage and vaccine immunity, but due to domestic beast With antibiotic abuse lack of standardization and long-time service, more and more bacterial antibiotics is caused to produce durability, secondary pig is bloodthirsty Bacillus clinical separation strain drug resistance phenomenon is more and more obvious, and has seriously affected the bactericidal effect of antibiotic.Vaccine immunization is anti- The optimal path of Haemophilus parasuis is controlled, it should be according to the popular corresponding unit price of serotype selection or polyvaccine.It is domestic secondary Haemophilus suis commercialized vaccine is mostly to be directed to 4 type of serum, 5 types, the divalent of 13 types or trivalent vaccine, with each department Major Epidemic Bacterial strain serotype differs greatly, and causes control effect bad.Lack immunological cross protection between each serotype of haemophilus parasuis, Haemophilus parasuis inactivated vaccine only has resistance protective effect to the bacterial strain of same serotype, once epidemic link serotype and epidemic disease Seedling serotype is not inconsistent, which acts on swinery with regard to unprotect.

Summary of the invention:

For immunological cross protection is lacked between each serotype of current haemophilus parasuis, haemophilus parasuis inactivated vaccine is only right The bacterial strain of same serotype has the problem of resistance is protected, and the present invention provides a kind of 2 type of haemophilus parasuis serum, 5 types, 7 types three Bivalent inactivated vaccine.

The present invention solves scheme used by its technical problem: a kind of trivalent inactivated vaccine against Haemophilus parasuis infection, by three kinds of pairs Haemophilus suis serotype antigen and immunologic adjuvant are made, and three kinds of haemophilus parasuis serotype antigen has respectively inactivated HN1553 plants of 2 type of haemophilus parasuis, HN1565 plants of antigens of HN1570 plants of 5 type and 7 types, wherein the haemophilus parasuis 2 HN1553 plants of types, deposit number are CGMCC NO:16801；HN1570 plants of haemophilus parasuis Serotype 5, deposit number is CGMCC NO:16802；HN1565 plants of haemophilus parasuis serum 7-type, deposit number is CGMCC NO:16803.Preservation date: On November 9th, 2018, depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation address: north The institute 3 of the Chaoyang District Jing Shi North Star West Road 1.

A kind of above-mentioned trivalent inactivated vaccine against Haemophilus parasuis infection, HN1553 plants of 2 type of haemophilus parasuis, 5 types HN1570 plants, the serotype antigen ratio of HN1565 plants of 7 type be 1: 1: 1.

A kind of above-mentioned trivalent inactivated vaccine against Haemophilus parasuis infection, 2 type of haemophilus parasuis serum, 5 types, 7 types are anti- Former content is 1 × 10¹⁰ CFU/mL。

A kind of above-mentioned trivalent inactivated vaccine against Haemophilus parasuis infection, the immunologic adjuvant are aluminum hydroxide adjuvant.

The present invention also provides a kind of preparation methods of trivalent inactivated vaccine against Haemophilus parasuis infection, comprising the following steps:

A. it is proliferated: HN1553 plants of 2 type of haemophilus parasuis serum, HN1570 plants of haemophilus parasuis Serotype 5, secondary pig is bloodthirsty HN1565 plants of bacterial strains of bacillus serum 7-type breed culture respectively, obtain haemophilus parasuis HN1553 plants, HN1570 plants, HN1565 Strain bacterium solution, and count plate is carried out respectively；

B. inactivate: HN1553 plants of the haemophilus parasuis obtained respectively into step a, HN1570 plants, press in HN1565 plants of bacterium solutions Formalin is added according to the 0.2% of bacterium solution volume, for 24 hours in 37 DEG C of inactivations；

C. be concentrated: using ultrafiltration apparatus respectively be concentrated inactivation after examine qualification HN1553 plants of haemophilus parasuis, HN1570 plants, HN1565 plants of bacterium solutions, according to the count plate before inactivation, adjusting concentration final concentration with sterile saline is 1.0 × 1¹⁰ CFU/mL；

D. vaccine is prepared: HN1553 plants, HN1570 plants, HN1565 plants of haemophilus parasuis will obtained after proliferation, inactivation, concentration Antigen liquid mixes according to 1: 1: 1 ratio, the aluminium hydroxide gel adjuvant of final volume 10% is added, mixes and haemophilus parasuis is made Tervalence inactivated vaccine.

A kind of preparation method of above-mentioned trivalent inactivated vaccine against Haemophilus parasuis infection breeds the operation step of culture in the step a Suddenly are as follows:

(1) first order seed is bred: by HN1565 plants of HN1553 plants of 2 type of haemophilus parasuis, HN1570 plants of 5 type and 7 types freeze-dried vaccines It kind is inoculated on TSA plate respectively, 37 DEG C are cultivated 18 ~ 24 hours, and picking meets the requirements colonies typical, and passage inoculation is containing new respectively The TSA plate of raw cow's serum, is cultivated 24 hours in 37 DEG C, after the assay was approved, as first order seed；It is added in the TSA plate There are the newborn bovine serum of final concentration 5% and the NAD of final concentration 0.01%；

(2) secondary seed is bred: each strain first order seed is inoculated in respectively in TSB fluid nutrient medium, in 37 DEG C, shaking table oscillation is trained It supports 18 ~ 24 hours, carries out purely after the assay was approved, as secondary seed；Final concentration is added in the TSB fluid nutrient medium 5% newborn bovine serum and the NAD of final concentration 0.01%；

(3) secondary seed of three kinds of bacterial strains is inoculated in TSB fluid nutrient medium respectively by 1%, respectively at 37 DEG C, shaking table vibrates Culture harvested bacterium solution after 18~24 hours；Newborn bovine serum and end in the TSB fluid nutrient medium added with final concentration 5% is dense The NAD of degree 0.01%.

A kind of trivalent inactivated vaccine against Haemophilus parasuis infection described in any of the above-described is bloodthirsty in the secondary pig of preparation prevention and treatment Application in the drug of bacillus related diseases.

Beneficial effects of the present invention: the present invention filters out advantage epidemic link haemophilus parasuis blood from clinical separation strain HN1565 plants of HN1553 plants of clear 2 type, HN1570 plants of 5 type, 7 type bacterial strains, wherein bacterial strain HN1553 plants and HN1570 plant are young to child care Pig has stronger pathogenicity, causes the morbidity of child care pig dead；HN1565 plants of bacterial strain in the present invention are to child care piglet pathogenicity It is slightly weak, but child care piglet respiratory symptom can be caused, hypoevolutism, the price of deed reduces；It is found by experiment that this three plants secondary pigs Haemophilus has good immunogenicity, the inactivated vaccine for using this three plants of haemophilus parasuis to prepare as strain antigens, can To prevent the infection of clinical haemophilus parasuis serum 2 type, 5 types and 7 types, while the vaccine preparation simple process well, and Safety is good, and good immune effect, duration of immunity are long.

Detailed description of the invention

Fig. 1 is bacterial strain HN1553 colonial morphology.

Fig. 2 is form under bacterial strain HN1553 thallus 100 × microscope of Gram's staining.

The PCR that Fig. 3 is bacterial strain HN1553 is identified and serotype PCR qualification result, and the Marker in figure is 2000 bp of DL, It is followed successively by 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp from top to bottom；Swimming lane 1 is primer P1, P2 expansion Increase HN1553 plants of 16S rRNA genetic results；Swimming lane 2 is that primer P3, P4 expand HN1553 plants of WZX genetic results；Swimming lane 3 is yin Property control.

Fig. 4 is bacterial strain HN1570 colonial morphology.

Fig. 5 is form under bacterial strain HN1570 thallus 100 × microscope of Gram's staining.

The PCR that Fig. 6 is bacterial strain HN1570 is identified and serotype PCR qualification result, and the Marker in figure is 2000 bp of DL, It is followed successively by 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp from top to bottom；Swimming lane 1 is primer P1, P2 expansion Increase HN1570 plants of 16S rRNA genetic results；Swimming lane 2 is that primer P5, P6 expand HN1570 plants of wciP genetic results；Swimming lane 3 is yin Property control.

Fig. 7 is bacterial strain HN1565 colonial morphology.

Fig. 8 is form under bacterial strain HN1565 thallus 100 × microscope of Gram's staining.

The PCR that Fig. 9 is bacterial strain HN1565 is identified and serotype PCR qualification result, and the Marker in figure is DL 2000bp, It is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp from top to bottom；Swimming lane 1 is primer P1, P2 amplification HN1565 plants of 16S rRNA genetic results；Swimming lane 2 is that primer P7, P8 expand HN1565 plants of funQ genetic results；Swimming lane 3 is yin Property control.

Biomaterial preservation information

(1) bacterial strain HN1553 is haemophilus parasuis Haemophilus parasuis, is preserved on November 09th, 2018 State's Microbiological Culture Collection administration committee common micro-organisms center (CGMCC), address are BeiChen West Road, Chaoyang District, BeiJing City 1 Number institute 3, deposit number are CGMCC NO:16801；

(2) bacterial strain HN1570 is haemophilus parasuis Haemophilus parasuis, is preserved on November 09th, 2018 State's Microbiological Culture Collection administration committee common micro-organisms center (CGMCC), address are BeiChen West Road, Chaoyang District, BeiJing City 1 Number institute 3, deposit number: CGMCC NO:16802；

(3) bacterial strain HN1565 is haemophilus parasuis Haemophilus parasuis, is preserved on November 09th, 2018 State's Microbiological Culture Collection administration committee common micro-organisms center (CGMCC), address are BeiChen West Road, Chaoyang District, BeiJing City 1 Number institute 3, deposit number: CGMCC NO:16803.

Specific embodiment:

Present invention will be further explained below with reference to the attached drawings and examples.

Three bacterial strains involved in the present invention, i.e., haemophilus parasuis HN1553 plants, HN1570 plants and HN1565 plants, wherein bacterium HN1553 plants and HN1570 plants of strain are located away from the painstaking effort that the child care pig of typical polyserositis occurs, in TSA solid culture Without other bacterial growths when separating on base, only haemophilus parasuis is grown, and viral titer is high in TSB fluid nutrient medium, reaches 10⁹CFU/mL or more；Bacterial strain HN1565 is located away from the lung tissue that the child care pig of typical respiratory symptom occurs, in TSA solid Purified without other bacterial growths when separating on culture medium, only haemophilus parasuis grows, is proliferated in TSB fluid nutrient medium Titre is high, up to 10⁹CFU/mL or more.

Embodiment 1: the separation and identification of bacterial strain HN1553

The preparation of 1.1 culture mediums

TSB fluid nutrient medium: by TSB gravy powder (Tryptic Soy broth, pancreas peptone soybean broth) 30g, it is dissolved in 1000 In mL ultrapure water, 115 DEG C of 15 min of sterilizing add 50 mL of fetal calf serum, sterile 1%NAD(Nicotinamide adenine Dinucleotide, nicotinamide adenine dinucleotide, cozymase) 1 mL.

TSA solid medium: TSA agar powder (Tryptic Soy Agar, tryptose soya agar) 40g is dissolved in In 1000mL ultrapure water, 115 DEG C of sterilizing 15min add fetal calf serum 50mL, sterile 1%NAD that 1mL (is added as needed)；In 4 It DEG C saves backup.

The separation of bacterial strain HN1553

Applicant's painstaking effort that aseptically the child care pig of typical polyserositis occurred for acquisition in 2018, which are inoculated in, to be contained Have on the TSA solid medium of NAD, 36 h is cultivated in 37 DEG C of constant incubators, the doubtful bacterium colony of picking carries out passage purifying, then trains Support 24~48 hours after observe haemophilus parasuis colonial morphology, grow consistent tip-like size, it is colorless and transparent, smooth, Wet, the bacterium colony (see figure 1) that diameter is 1 ~ 2 millimeter；While purifying and it is inoculated in the TSA solid culture without NAD On base, it cannot be grown on the TSA culture medium without NAD；The single bacterium colony of picking purifying carries out gram stain microscopy, observation Morphological features are Gram-negative bacteria, have a variety of different forms, cause Filamentous bacterium from single coccobacillus to elongated Body (see figure 2).It is thermophilic tentatively to judge that bacterial strain HN1553 belongs to secondary pig from the measurement result of bacterial strain HN1553 morphology and biochemical characteristic Blood bacillus Pseudomonas.

The identification of bacterial strain HN1553

1.3.1 design of primers

Expansion according to sequence design a pair of universal primer of haemophilus parasuis 16S rRNA gene, for haemophilus parasuis Increase, primer sequence is as follows:

P1:5 '-GTGATGAGGAAGGGTGGTGT -3 ' (SEQ ID NO.1)

P2:5 '-GGCTTCGTCACCCTCTGT -3 ' (SEQ ID NO.2)

Amplified fragments size is 822bp.

According to the specific primer of 2 type of sequence design a pair of haemophilus parasuis of haemophilus parasuis WZX, for secondary pig The amplification of 2 type of haemophilus, primer sequence are as follows:

P3:5 '-CTAACAAGTTAGGTATGGAGGGTTTTGGTG -3 ' (SEQ ID NO.3)

P4:5 '-GGCACTGAATAAGGGATAATTGTACTG-3 ' (SEQ ID NO.4)

Amplified fragments size is 295bp.

1.3.2 PCR is identified

The DNA of bacterial strain HN1553 is extracted according to the operating procedure of DNA extraction kit, spectrophotometric determination concentration is 100ug/mL carries out PCR identification.Meanwhile it is positive control that haemophilus parasuis type strain, which is arranged, and streptococcus suis 2-type mark is arranged Quasi- strain is negative control.

Pcr amplification reaction system is 25 μ L:10 × buffer, 2.5 μ L, 2.5mM dNTPs, 0.5 μ L, and 10 μM/L is general to be drawn DdH is added in each 1 μ L, 100ug/mL DNA profiling of 1 μ L, 5U/ μ L rTaq, 1 μ L of object P1, P2₂O to 25 μ L；

Reaction condition: 95 DEG C of initial denaturation 5min, into circulation: 95 DEG C of 1 min, 57 DEG C of 1 min, 72 DEG C of 30 s, totally 35 are followed Ring, last 72 DEG C of extensions 10min, 4 DEG C of PCR product preservations.

Amplified production carries out electrophoresis, and every hole is loaded 10 μ L, 1% agarose gel electrophoresis, and observation result is (see figure under ultraviolet light 3).From the figure 3, it may be seen that the present embodiment bacterial strain HN1553 equally amplifies 822bp segment, bacterium with haemophilus parasuis reference culture Strain HN1553 sequencing and haemophilus parasuis CL120103 plants (GenBank NO:CP020085.1), SW140 plants of (GenBank NO:KC795299.1) 100% is homologous.Proof bacterial strain HN1553 be haemophilus parasuis (Haemophilus parasuis).

1.3.3 Serotype Identification

Referring to 1.3.2 method, is expanded with specific primer P3, P4 of 2 type of haemophilus parasuis, as a result amplify 295bp size Segment (see figure 3), sequencing result is as follows, sequencing with SW140 plants of 2 type haemophilus parasuis (GenBank NO: KC795299.1) 100% is homologous, it was demonstrated that bacterial strain HN1553 is 2 type haemophilus parasuis.

TCTAACAAGTTAGGTATGGAGGGTTTTGGTGAATTGTCTTATTACCAAATATTGACAACAATATTTGT TGTATTGGTTGGCTTTTGTCAAAGTAATGCAATATCTAGATACTATTATGCTTATGGCCAAAGGTCTGTTAATTTT ATTATGTTATCTGGGTATATATATACTTTTAGTATAGGTGTTATCGGTTTTATAACATCGTTATTTTTTGATAACA AAATTATTTCGTACTTGGTACTTTTATCTGTCTTTCAGGTTTTATTATCAGTACAATTATCCCTTATTCAGTGCCA (SEQ ID NO.5)

Embodiment 2: HN1570 plants of bacterial strain of separation and identification

The preparation of 2.1 culture mediums

Referring to the method preparation TSB fluid nutrient medium and TSA solid medium in embodiment 1.

HN1570 plants of bacterial strain are separately cultured

Applicant's painstaking effort that aseptically the child care pig of typical polyserositis occurred for acquisition in 2017, which are inoculated in, to be contained Have on the TSA solid medium of NAD, 36 h is cultivated in 37 DEG C of constant incubators, the doubtful bacterium colony of picking carries out passage purifying, then trains Support 24~48 hours after observe haemophilus parasuis colonial morphology, grow consistent tip-like size, it is colorless and transparent, smooth, Wet, the bacterium colony (see figure 4) that diameter is 1 ~ 2 millimeter；While purifying and it is inoculated in the TSA solid culture without NAD On base, it cannot be grown on the TSA culture medium without NAD；

The single bacterium colony of picking purifying carries out gram stain microscopy, and observation morphological features are Gram-negative bacteria, has A variety of different forms cause Filamentous thallus (see figure 5) from single coccobacillus to elongated.From bacterial strain HN1570 morphology and life The measurement result for changing characteristic tentatively judges that bacterial strain HN1570 belongs to haemophilus parasuis Pseudomonas.

The identification of bacterial strain HN1570

2.3.1 design of primers

The universal primer of haemophilus parasuis is primer P1 and P2.

According to the specific primer of 5 type of sequence design a pair of haemophilus parasuis of haemophilus parasuis wciP, for pair The amplification of 5 type of haemophilus suis, primer sequence are as follows:

P5:5 '-CCACTGGATAGAGAGTGGCAGG -3 ' (SEQ ID NO.6)

P6:5 '-CCATACATCTGAATTCCTAAGC-3 ' (SEQ ID NO.7)

Amplified fragments size is 450bp.

2.3.2 PCR is identified

The DNA of bacterial strain HN1570 is extracted according to the operating procedure of DNA extraction kit, referring to PCR amplification method in embodiment 1 PCR amplification is carried out to bacterial strain HN1570.

Amplified production is subjected to electrophoresis, every hole is loaded 10 μ L, 1% agarose gel electrophoresis, observed under ultraviolet light result (see Fig. 6).It will be appreciated from fig. 6 that the present embodiment strain to be tested, that is, bacterial strain HN1570 is equally amplified with haemophilus parasuis reference culture 822bp segment, bacterial strain HN1570 sequencing and haemophilus parasuis CLSH0104 plants of (GenBank NO:CP024412.1), 29755 Strain (GenBank NO:CP021644.1), KL0318 plants of (GenBank NO:CP009237.1) 99% are homologous；Prove bacterial strain HN1570 be haemophilus parasuis (Haemophilus parasuis).

2.3.3 Serotype Identification

Referring to 1.3.2 method, is expanded with specific primer P5, P6 of 5 type of haemophilus parasuis, as a result amplify 450bp size Segment (see figure 6), sequencing result is as follows, sequencing with KL0318 plants of 5 type haemophilus parasuis (GenBank NO: CP009237.1) 99% is homologous, it was demonstrated that bacterial strain HN1570 is 5 type haemophilus parasuis.

CCTCCATACATTCGAATTCCTAAGCCAAAAATATATTTTATTTCTAGGGAACCAGCCATGACTTAAAA AATCAACTGGTTTATCATGAAAGAAAAAGCGCTCTTTATTGACACCCCTCATAATAATCACATCATCATTTAAATA TACAAAATTTTCAGATAGAGCATCTATATTACCCAAATTCATTTCAATTGAACTGGAATTAAAAATAGGAAGGTGT TCTTTCTCATAATAAAGCTGATTATGTGTAATTAAAAATATTTTTTCATTATTTATATCTAACCATTCAGGAAAGT GTCCCTCAGTAATTAAATATATTCTATTATACCAAGGGCAGTTTTTTTCTATAGATCTTAGAACATATCTTAGAGT TCCCATATCTCTATATCTTGATTCAGAATTTGAACTAGTTTCTTTTAAATTTATATTACTATAGAAACTTTTTTTT GCCTGCCACTCTCTTATCCAGTGGA(SEQ ID NO.8)

Embodiment 3: HN1565 plants of bacterial strain of separation and identification

The preparation of 3.1 culture mediums

HN1565 plants of bacterial strain are separately cultured

Applicant's lung tissue that aseptically the child care pig of typical respiratory symptom occurred for acquisition in 2018 is inoculated in On TSA solid medium containing NAD, 36 h are cultivated in 37 DEG C of constant incubators, the doubtful bacterium colony of picking carries out passage purifying, then The colonial morphology that haemophilus parasuis is observed after culture 24~48 hours, grows consistent tip-like size, colorless and transparent, light Sliding, wet, the bacterium colony (see figure 7) that diameter is 1 ~ 2 millimeter；While purifying and it is inoculated in the TSA solid training without NAD It supports on base, cannot be grown on the TSA culture medium without NAD；

The single bacterium colony of picking purifying carries out gram stain microscopy, and observation morphological features are Gram-negative bacteria, has A variety of different forms cause Filamentous thallus (see figure 8) from single coccobacillus to elongated.From bacterial strain HN1565 morphology and life The measurement result for changing characteristic tentatively judges that bacterial strain HN1565 belongs to haemophilus parasuis Pseudomonas.

The identification of bacterial strain HN1565

3.3.1 design of primers

The universal primer of haemophilus parasuis is primer P1 and P2.

According to the specific primer of 7 type of sequence design a pair of haemophilus parasuis of haemophilus parasuis funQ, for pair The amplification of 7 type of haemophilus suis, primer sequence are as follows:

P7:5 '-CTCCGATTTCATCTTTTCTATGTGG -3 ' (SEQ ID NO.9)

P8:5 '-CGATAAACCATAACAATTCCTGGCAC-3 ' (SEQ ID NO.10)

Amplified fragments size is 490bp.

3.3.2 PCR is identified

The DNA of bacterial strain HN1565 is extracted according to the operating procedure of DNA extraction kit, referring to PCR amplification method in embodiment 1 PCR identification is carried out to bacterial strain HN1565.

Amplified production carries out electrophoresis, and every hole is loaded 10 μ L, 1% agarose gel electrophoresis, and observation result is (see figure under ultraviolet light 9), as shown in Figure 9, the present embodiment strain to be tested, that is, bacterial strain HN1565 is equally amplified with haemophilus parasuis reference culture 822bp segment, bacterial strain HN1565 sequencing and 174 plants of haemophilus parasuis (GenBank NO:KC795390.1), SH03 plants (GenBank NO:CP0091581) 98% is homologous；Proof bacterial strain HN1565 be haemophilus parasuis (Haemophilus parasuis).

3.3.3 Serotype Identification

Referring to 1.3.2 method, is expanded with specific primer P7, P8 of 7 type of haemophilus parasuis, as a result amplify 490bp size Segment (see figure 9), sequencing result is as follows, sequencing and SH03 plants of 7 type haemophilus parasuis (GenBank NO:CP0091581) 98% It is homologous, it was demonstrated that bacterial strain HN1565 is 7 type haemophilus parasuis.

TTCCGAAAAATCCTCTCCAAATTTCATCTTTTCTATGAGGATTTTTTTGAAATAAATATTTGAAGTAT AACTTTCTATTTTTTATTTTAAGTGTTCCTTTTAGCCTCAATTCTAGAATAATATCCTTAGATTTAATGATGTTTT ATATTGGGAGTGTTTTGTGTTTTAAAAGAGGTTTTTTGTATAAATCCATAATTATTTTTAGTGCGATTTTTTTTTC TATATCCTCTCTTATTTTAAGGGGGATGTCAGAGCAAGGTTTTATATATAACATATTAAATTTATCTTACATTTTT GATATTAGCTTAGATGTTTTTTTTAGAGGGGTGAATTATGTGACCAGTTTTTCAGTATATGAAATGGAATATGCTT TAGAACAGAAACTTAGTGGTACAGATGCATTCTTAATAAGTATAAACCCATTGCCTAGTTCTTATTTAAATGTGCA GCCATTATATGACCAGGCAATGGTAAATGCTTTTTCTCCTGTGCCAGGAATTGTTA TGGTTTATCGA(SEQ ID NO.11)

4 virulence test of embodiment

Child care pig 16 for choosing 9 ~ 10 week old wean health are experimental animal.Experimental animal is randomly divided into 4 groups, control group 4 Head, test 1 group 4, test 2 groups 4, test 3 groups 4.By HN1553 plants of haemophilus parasuis bacterial strain, HN1570 plants, HN1565 plants are inoculated with TSB fluid nutrient medium respectively, after 37 DEG C of 24 h of shaking table culture, measure cell concentration, continuous 10 times of dilutions painting Cloth solid plate, count plate under low power lens calculate stoste cell concentration, adjust to 10⁸CFU/mL；Test 1,2,3 group of animal Respectively by 3 mLHN1553, HN1570, HN1565 haemophilus parasuis liquid culture of Intratracheal inoculation, control animals are logical Cross the TSB fluid nutrient medium of 3 mL of Intratracheal inoculation sterilizing.It is observed continuously after injection 2 weeks, observes and records its number and dead of falling ill Die situations such as several.

Observation discovery: 1 and 2 group of test shows the symptoms such as breathe, have difficulty in breathing in inoculation haemophilus parasuis afterwards for 24 hours, Body temperature increases, ear, abdomen and buttocks cyanosis, and turn-takes.1 group is tested after 2 days dead 2 after dead 1,3 days；Test 2 groups after 2 days dead 2 after dead 2,3 days.Test 3 groups after inoculation 36h there are the respiratory symptoms such as breathe, cough, it is adjoint Body temperature increases, and death condition does not occur.Control animals body temperature between experimental period is normal and without apparent respiratory symptom.

It cuts open after the test and kills test group animal, while cuing open and killing 4 control animals, acquire pathological material of disease, carry out bacterium separation. 1,2 group of dissect lung of test has a large amount of fine plain sample exudations, with pleaural adhesion, hydropericardium, cor villosum, cerebral haemorrhage；Test 3 groups of chests Chamber has a small amount of cellulose to ooze out, the symptoms of pneumonia such as Pulmonary hemorrhage, hydropericardium；Control group dissect does not occur apparent pathology and becomes Change, 4 parts of pathological material of diseases of control group are not separated to haemophilus parasuis, and it is thermophilic to be separated to secondary pig in 4 parts of pathological material of diseases of 1,2,3 group of test Blood bacillus, PCR qualification result are consistent with bacterial strain HN1553, HN1570, HN1565.

Haemophilus suis strain HN1553, HN1570 are shown as the strongest bacterial strain of virulence as a result, determining by comprehensive virulence test, Haemophilus parasuis strain HN1565 shows as the weaker bacterial strain of virulence.

Embodiment 5: preparation, safety and the potency test of vaccine

5.1 the preparation of vaccine

5.1.1 strain and culture propagation

First order seed breeding

HN1565 plants of HN1553 plants of 2 type of haemophilus parasuis, HN1570 plants of 5 type and 7 types freeze-drying lactobacillus are inoculated in respectively containing new On the TSA plate of raw cow's serum (final concentration 5%) and NAD (final concentration 0.01%), 37 DEG C of cultures 18 ~ for 24 hours, picking meets the requirements Colonies typical, respectively passage inoculation contain newborn bovine serum (final concentration 5%) and NAD (final concentration 0.01%) TSA plate, 37 DEG C culture for 24 hours, after the assay was approved, as first order seed.

Secondary seed breeding

Each strain first order seed is inoculated in the TSB liquid containing newborn bovine serum (final concentration 5%) and NAD (final concentration 0.01%) respectively In body culture medium, 37 DEG C, shaking table shaken cultivation 18 ~ for 24 hours, it carries out purely after the assay was approved, as secondary seed.

5.1.2 antigen bacterium solution culture

The secondary seed of three kinds of bacterial strains is inoculated in respectively by 1% containing newborn bovine serum (final concentration 5%) and NAD (final concentration 0.01%) in TSB fluid nutrient medium, respectively at 37 DEG C, shaking table shaken cultivation 18~harvest bacterium solution afterwards for 24 hours.

5.1.3 count plate

By existing " Chinese veterinary pharmacopoeia " annex method, using be suitable for the growth of this bacterium containing 5% newborn bovine serum and 0.01%NAD TSA culture medium carry out count plate.Using shaking flask culture, count plate concentration, three kinds of strain culturing viable bacteria contents are 1 .0×10⁹CFU/mL or more.

5.1.4 bacterium solution inactivates

Respectively to 0.2% formalin of the culture solution addition volume total amount of three kinds of haemophilus parasuis bacterial strains, inactivated at 37 DEG C 24h。

5.1.5 inactivation is examined

It takes the inactivated bacterial liquid 0.2mL of three kinds of bacterial strains to be inoculated with respectively and is suitable for TSA plate (containing 5% newborn bovine serum and 0 .01% NAD), 37 DEG C of culture 48h are set, no bacterial growth is qualification.

5.1.6 the concentration of antigen

Three kinds of qualified antigen bacterium solutions are examined to pass through ultrafiltration system device concentration bacterium solution respectively inactivation.According to viable bacteria meter before inactivating Number is as a result, adjusted three kinds of somatic antigen concentration to 1.0 × 10 using sterile saline¹⁰CFU/mL, and by three kinds of antigen liquids It is uniformly mixed in the ratio of 1:1:1 (volume ratio).

5.1.7 adjuvant prepares

Aluminium hydroxide gel adjuvant is distributed into bottle, through 121 DEG C high pressure sterilization 30 minutes, room temperature storage it is spare.

5.1.8 vaccine preparation

By the aluminum hydroxide adjuvant for the antigen liquid addition 10% that concentration mixes, stirring is mixed well, and packing obtains aluminium hydroxide gel assistant The Haemophilus parasuis tervalence inactivated vaccine of agent.In final vaccine the first three bacterial strain total viable count containing inactivation be 1.0 × 10¹⁰CFU/mL。

The safety testing of vaccine

14 age in days sodium selenite 10 is chosen, is divided into 2 groups, every group 5.

Vaccine group: 4 mL this vaccine of musculi colli injection；

Control group: musculi colli injects 4 mL sterile salines.Animal heat is measured, clinical manifestation is observed, is observed 2 weeks altogether.

Mean body temperature variation after 1 vaccine inoculation piglet of table

Breathing, appetite, the state of mind be all during entire observation for the child care pig of the vaccine group that makes discovery from observation and control group Normally, as can be seen from Table 1, mean body temperature, which increases, is no more than 1 DEG C, illustrates inactivated vaccine safety of the invention.

The Immunization of 5.3 vaccines is tested

Vaccine immunity challenge test sets up HN1553 plants of challenge tests of haemophilus parasuis, HN1570 plants of haemophilus parasuis HN1565 plants of challenge tests of challenge test and haemophilus parasuis.2 week old sodium selenite 25 is chosen in every group of test, is divided into 5 groups, Every group 5.Specific grouping are as follows: 1 group of vaccine, 2 groups of vaccine, 3 groups of vaccine, 4 groups of vaccine, every group of vaccine group is injected the vaccine respectively 0.5ml,1ml,1.5ml,2ml；5th group is control group, injects 2mL sterile saline.Vaccine group and healthy control group 3 weeks Two exempt to inject the same dose of vaccines or sterile saline afterwards.Two exempt from each group test in latter 14 days respectively with 10⁹The secondary pig of CFU is thermophilic Blood bacillus HN1553, HN1570, HN1565 bacterial strain bacterium solution takes collunarium to attack poison.The clinical manifestation of each group piglet is observed, it is daily to survey Determine body temperature, observes 2 weeks altogether.

The morbidity and mortality for calculating entire observation cycle experimental piglet, measure body temperature, to organs such as dead pig lungs Bacterium is carried out to be separately cultured.

Observation discovery: vaccine group and non-immune group have apparent difference, attack after poison second day, the piglet second of non-immune group It starts clinical symptoms occur, and body temperature increases, and expiratory dyspnea is turn-taked, and starts death occur after 2 days, dead 5 altogether after 2 weeks. There is hydrops in the non-immune group death pig thoracic cavity of dissect and abdominal cavity, and have fibrinous exudate, hydropericardium, have fiber in cavum pericardiale Disposition exudate, pericardiosymphysis.Lungs enlargement, two sides lobe of the lung extravasated blood or bleeding, surface fiber disposition exudate.Meninx is congested, Cerebrospinal fluid increases.The piglet of healthy control group does not fall ill.And in vaccine group, there is 1 to go out in 5 piglets of 0.5ml vaccine group Existing clinical symptoms and case variation；5 piglets of 1ml, 1.5ml and 2ml vaccine group do not fall ill.Haemophilus parasuis HN1553 plants, HN1570 plants, HN1565 plants of Immunization result be shown in Table 2, table 3, table 4 respectively.

Table HN1553 plants of Immunization test results of 2 haemophilus parasuis

Note: " --- " indicates not applicable.

Table HN1570 plants of Immunization test results of 3 haemophilus parasuis

Note: " --- " indicates not applicable.

Table HN1565 plants of Immunization test results of 4 haemophilus parasuis

Note: " --- " indicates not applicable.

This vaccine 0.5ml immunizing dose is immunized twice it can be seen from above-mentioned Immunization test result can resist secondary pig The infection of haemophilus serum 2 type, 5 types and 7 types illustrates that inactivated vaccine of the invention has good protecting effect.

The foregoing is merely the optimal embodiments of the present invention, and for those skilled in the art, the present invention can have various Change and variation.All within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done should all include Within protection scope of the present invention.

Sequence table

<110>Animal Busbandry &. Veterinary Medicine Inst., Henan Prov. Academy of Agriculture

<120>a kind of trivalent inactivated vaccine against Haemophilus parasuis infection and its application

<141> 2019-02-22

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 1

gtgatgagga agggtggtgt 20

<210> 2

<211> 18

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 2

ggcttcgtca ccctctgt 18

<210> 3

<211> 30

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 3

ctaacaagtt aggtatggag ggttttggtg 30

<210> 4

<211> 27

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 4

ggcactgaat aagggataat tgtactg 27

<210> 5

<211> 296

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 5

tctaacaagt taggtatgga gggttttggt gaattgtctt attaccaaat attgacaaca 60

atatttgttg tattggttgg cttttgtcaa agtaatgcaa tatctagata ctattatgct 120

tatggccaaa ggtctgttaa ttttattatg ttatctgggt atatatatac ttttagtata 180

ggtgttatcg gttttataac atcgttattt tttgataaca aaattatttc gtacttggta 240

cttttatctg tctttcaggt tttattatca gtacaattat cccttattca gtgcca 296

<210> 6

<211> 22

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 6

ccactggata gagagtggca gg 22

<210> 7

<211> 22

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 7

ccatacatct gaattcctaa gc 22

<210> 8

<211> 473

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 8

cctccataca ttcgaattcc taagccaaaa atatatttta tttctaggga accagccatg 60

acttaaaaaa tcaactggtt tatcatgaaa gaaaaagcgc tctttattga cacccctcat 120

aataatcaca tcatcattta aatatacaaa attttcagat agagcatcta tattacccaa 180

attcatttca attgaactgg aattaaaaat aggaaggtgt tctttctcat aataaagctg 240

attatgtgta attaaaaata ttttttcatt atttatatct aaccattcag gaaagtgtcc 300

ctcagtaatt aaatatattc tattatacca agggcagttt ttttctatag atcttagaac 360

atatcttaga gttcccatat ctctatatct tgattcagaa tttgaactag tttcttttaa 420

atttatatta ctatagaaac ttttttttgc ctgccactct cttatccagt gga 473

<210> 9

<211> 25

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 9

ctccgatttc atcttttcta tgtgg 25

<210> 10

<211> 26

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 10

cgataaacca taacaattcc tggcac 26

<210> 11

<211> 515

<212> DNA

<213>haemophilus parasuis (Haemophilus parasuis)

<400> 11

ttccgaaaaa tcctctccaa atttcatctt ttctatgagg atttttttga aataaatatt 60

tgaagtataa ctttctattt tttattttaa gtgttccttt tagcctcaat tctagaataa 120

tatccttaga tttaatgatg ttttatattg ggagtgtttt gtgttttaaa agaggttttt 180

tgtataaatc cataattatt tttagtgcga tttttttttc tatatcctct cttattttaa 240

gggggatgtc agagcaaggt tttatatata acatattaaa tttatcttac atttttgata 300

ttagcttaga tgtttttttt agaggggtga attatgtgac cagtttttca gtatatgaaa 360

tggaatatgc tttagaacag aaacttagtg gtacagatgc attcttaata agtataaacc 420

cattgcctag ttcttattta aatgtgcagc cattatatga ccaggcaatg gtaaatgctt 480

tttctcctgt gccaggaatt gttatggttt atcga 515

Claims

1. a kind of trivalent inactivated vaccine against Haemophilus parasuis infection, it is characterised in that: by three kinds of haemophilus parasuis serotype antigens and Immunologic adjuvant is made, 2 type of haemophilus parasuis that three kinds of haemophilus parasuis serotype antigen has respectively inactivated HN1565 plants of HN1553 plants, HN1570 plants of 5 type and 7 types antigens, wherein HN1553 plants of 2 type of haemophilus parasuis, preservation Number is CGMCC NO:16801；HN1570 plants of haemophilus parasuis Serotype 5, deposit number is CGMCC NO:16802；It is secondary HN1565 plants of haemophilus suis serum 7-type, deposit number is CGMCC NO:16803；Preservation date: it protects on November 9th, 2018 Unit: China Committee for Culture Collection of Microorganisms's common micro-organisms center is hidden, preservation address: Chaoyang District, Beijing City North Star west The institute 3 of road 1.

2. a kind of trivalent inactivated vaccine against Haemophilus parasuis infection according to claim 1, which is characterized in that the pair pig is bloodthirsty 2 type of bacillus, 5 types, 7 type serotype antigen ratios are 1: 1: 1.

3. a kind of trivalent inactivated vaccine against Haemophilus parasuis infection according to claim 1, which is characterized in that the pair pig is bloodthirsty 2 type of bacillus serum, 5 types, the content of 7 type antigens are 1 × 10¹⁰ CFU/mL。

4. a kind of trivalent inactivated vaccine against Haemophilus parasuis infection according to claim 1, which is characterized in that the immune assistant Agent is aluminium hydroxide gel adjuvant.

5. a kind of preparation method of trivalent inactivated vaccine against Haemophilus parasuis infection, which comprises the following steps:

C. be concentrated: using ultrafiltration apparatus respectively be concentrated inactivation after examine qualification HN1553 plants of haemophilus parasuis, HN1570 plants, HN1565 plants of bacterium solutions, according to the count plate before inactivation, with sterile saline adjustment concentration final concentration of 1.0 × 10¹⁰ CFU/ mL；

6. a kind of preparation method of trivalent inactivated vaccine against Haemophilus parasuis infection according to claim 5, which is characterized in that institute State the operating procedure that culture is bred in step a are as follows:

(1) first order seed is bred: by HN1565 plants of HN1553 plants of 2 type of haemophilus parasuis, HN1570 plants of 5 type and 7 types freeze-dried vaccines Kind is inoculated in respectively on TSA plate, and 37 DEG C are cultivated 18 ~ 24 hours, and the satisfactory colonies typical of picking, passage is inoculated in respectively On TSA plate, cultivated 24 hours in 37 DEG C, after the assay was approved, as first order seed；Final concentration is added in the TSA plate 5% newborn bovine serum and the NAD of final concentration 0.01%；

(3) secondary seed of three kinds of bacterial strains is inoculated in TSB fluid nutrient medium respectively by 1%, respectively at 37 DEG C, shaking table shakes Bacterium solution is harvested after swinging culture 18~24 hours；Newborn bovine serum and end in the TSB fluid nutrient medium added with final concentration 5% The NAD of concentration 0.01%.

7. a kind of trivalent inactivated vaccine against Haemophilus parasuis infection described in -4 any claims prevents in preparation according to claim 1 With the application in the drug for the treatment of haemophilus parasuis related diseases.