CN110055337B - Method for identifying sex of ancient human remains with extremely low DNA content - Google Patents
Method for identifying sex of ancient human remains with extremely low DNA content Download PDFInfo
- Publication number
- CN110055337B CN110055337B CN201910185048.7A CN201910185048A CN110055337B CN 110055337 B CN110055337 B CN 110055337B CN 201910185048 A CN201910185048 A CN 201910185048A CN 110055337 B CN110055337 B CN 110055337B
- Authority
- CN
- China
- Prior art keywords
- sex
- ancient
- dna
- chromosome
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method for identifying the sex of ancient human remains with extremely low DNA content comprises the steps of firstly identifying the content of extracted DNA; then setting two pairs of sex identification sites respectively, marking as sex site A and B, wherein the sex site A is enamel protein gene, the sex site B is a section of conservative area on X and Y chromosomes, and respectively amplifying and identifying the sex site A and the sex site B by means of a real-time fluorescent quantitative PCR MGB probe method; according to the method, two sex amplified genes are combined, and the identification results of the two sex genes can be supplemented and verified mutually, so that the reliability of the identification result of the sex of the ancient human remains is greatly improved; the method of the invention uses a small amount of ancient DNA template, and the whole process of identifying two sex genes by template quantification can be completed only by 1.5 mul; compared with the traditional PCR amplification and gel electrophoresis verification steps, the application of the real-time fluorescence quantitative PCR technology shortens the experimental time, reduces the operation steps and improves the detection sensitivity and efficiency.
Description
Technical Field
The invention relates to the field of molecular archaeology, in particular to a method for identifying the sex of ancient human remains with extremely low DNA content.
Background
The modern archaeology in China is characterized in that a group of object types which have definite characteristics and are often accompanied with appearance are used as marks for distinguishing different cultures, and the archaeology idea just excludes people who create historical cultures. Therefore, the rise of the ancient DNA molecular anthropology in China is just to break through the single morphologically corresponding cultural qualitative research mode, and all the information of the ancient human living matters is injected into the human historical research process, so that the human historical research is pulled to the research track of human core, and the anthropology, archaeology and life science are alternately fused and developed.
Gender information of ancient human remains is one of the essential key information for archaeological study. Only if the sex information of individuals in the grave group is accurately known, important scientific problems such as family structures, social structures and the like can be further researched.
The traditional method for identifying the sex of the ancient human remains mainly comprises morphological analysis, and the sex determination is mainly based on sex marks of bones such as skull, pelvis, limb bones and the like. The integrity of bone preservation is different, and the accuracy of the identification result is also different. It is difficult to morphologically determine the sex of an individual who is under-aged.
With the development of molecular biology in these years, ancient human sex identification was carried out using Amelogenin (Amelogenin) gene, which is generally distributed on X and Y chromosomes with different fragment lengths, amplified by ordinary PCR and detected by gel electrophoresis, and male with 106bp and 112bp bands and female with 106bp band. The discovery of the method promotes the development of sex determination of ancient human remains, and particularly realizes the possibility of carrying out sex determination on the remains with smaller ages. However, for remains with poor preservation conditions, the ancient DNA content is extremely low and the degradation is severe, the electrophoresis is difficult to reach the detection limit of ancient DNA bands, the gene on the X or Y chromosome can only be amplified to form one band, according to a gender analysis method, a female usually forms one band, and a male usually forms two bands, so that misreading occurs, the authenticity of the result is influenced, and the reliability of the gender result is greatly reduced.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a method for identifying the sex of ancient human remains with extremely low DNA content, the whole sex identification process can be completed only by 1.5 mu l of template amount, two pairs of sex identification sites are respectively set to complement and verify mutually, the sites are respectively amplified and identified by means of a real-time fluorescence quantitative PCR MGB probe method, the detection sensitivity is greatly improved, and the efficiency is improved for identifying the sex of the ancient human remains with poor preservation.
In order to achieve the purpose, the invention adopts the following technical solutions:
a method for identifying the sex of ancient human remains with extremely low DNA content comprises the following steps:
step one, extraction of ancient DNA
Step two, quantification of ancient DNA
Selecting human mitochondrial DNA sequence, designing a 113bp long DNA fragment, designing a probe, synthesizing a primer and the probe simultaneously, as shown in Table 1,
TABLE 1 quantitative primers for ancient DNA
The preparation of the standard product comprises the following steps: PCR amplification target fragment, purification of PCR product, transfection of recombinant plasmid, colony PCR, constant-temperature culture of bacteria successfully subjected to colony PCR, overnight shake of bacteria, extraction of plasmid and preparation of quality assurance product.
And amplifying the standard substance and the ancient DNA sample by using a real-time fluorescent quantitative PCR SYBR method, drawing a standard curve according to the amplification result of the standard substance, and further calculating the absolute quantitative result of the ancient DNA sample.
Step three, synthesis of sex locus A primer
The lengths of fragments of the Amelogenin gene are different on X chromosomes and Y chromosomes generally, male types with 106bp bands and 112bp bands after electrophoresis, female types with 106bp bands only and synthetic primers shown in table 2.
TABLE 2 Ampelogenin Gene amplification primers
Step four, synthesis of sex locus B primer
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome;
the size of the X chromosome amplification product fragment is 330 bp; the fragment size of the Y chromosome amplification product is 218bp, and the sequences of the primers M4, M5 and M6 are shown in Table 3;
TABLE 3 sex Gene amplification primers
Step five, combining two pairs of sex sites: two pairs of sex identification sites are respectively set and marked as sex sites A and B, the sex site A is an enamel protein gene, the sex site B is a section of conserved region on X and Y chromosomes, and the sex sites A and B are integrated to be used as Markers for identifying the sex of ancient human remains.
Step six, amplification and identification of sex loci A and B
Synthesizing an MGB Probe, simultaneously amplifying sex loci A and B by using a real-time fluorescent quantitative PCR Probe method and using NEB Luna Universal Probe Qpcr Master Mix, M3004, putting the amplification results of the sex loci A and B together for comprehensive analysis, and finally obtaining the sex information of the ancient human remains.
Step one, the ancient DNA extraction specifically comprises the following steps:
(1) weighing 0.5-2 g of bone meal, and adding 1ml of 10% SDS; 4ml of EDTA pH 8.0 and 100. mu.l of proteinase K at 10mg/ml, shaking overnight at 37 ℃; transferring the DNA extraction sample after overnight into an air bath for oscillation, continuing to oscillate the warm bath for 6h at 55 ℃, and then standing for 5min at 95 ℃ to inactivate redundant proteinase K;
(2) centrifuging the product obtained in the step (1) at 7500r/min for 8min, adding 800 μ l of supernatant into an ultrafiltration centrifugal tube, centrifuging at 6800r/min, and concentrating the lysate to 100 μ l;
(3) adding 300 mu l of binding buffer solution and 20 mu l of magnetic bead suspension, reversing and uniformly mixing for 10min, placing the centrifuge tube in a magnetic frame for 1min to enable the magnetic beads to be adsorbed to the side wall, and sucking away liquid in the centrifuge tube, wherein the binding buffer solution is a mixture of 5M GuSCN, 25mM NaCl and 50mM Tris;
(4) adding 500 μ l of washing buffer solution, gently inverting for several times, adsorbing magnetic beads by using a magnetic frame, sucking away liquid in the tube after 1min, and repeating the washing process once, wherein the washing buffer solution is 125mM NaCl, 10mM Tris,1mM EDTA with pH of 8.0, and ethanol accounting for 50% of the total volume;
(5) taking down the centrifugal tube, adding 50-100 mul of TE eluent to suspend the magnetic beads, carrying out water bath at 55 ℃ for 10min, placing the centrifugal tube on a magnetic frame for 1min to adsorb the magnetic beads, and transferring the eluent to a clean centrifugal tube to obtain an ancient DNA extraction solution; TE eluent was a mixture of 10mM Tris and 1mM EDTA, pH 8.0.
Calculating the absolute quantitative result of the ancient DNA sample in the second step, which specifically comprises the following steps:
the method comprises the following steps of (1) carrying out real-time fluorescent quantitative PCR by using Luna Universal qPCR Master Mix and M3003 of NEB company, wherein each standard sample is repeated for three times, the sample loading amount of a template is 0.5 mu l, and the total amount is 20 mu l; qPCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles.
The sixth step is specifically as follows:
and (3) PCR system: probe qPCR mix 10ul, 20uM forward primer 0.5 ul, 20uM reverse primer 0.5 ul, 10uM Probe-AMGX0.4 ul, 10uM Probe-AMGY 0.4 ul, template DNA 0.5 ul, adding water to make the total volume to 20 ul;
PCR amplification reaction conditions: 60s at 95 ℃; 15s at 95 ℃, 30s at 60 ℃ and 40 cycles;
and (3) operating on a real-time fluorescent quantitative PCR instrument by using the reaction system and the reaction conditions by means of a 96-well plate, comprehensively analyzing to obtain a sex locus amplification result, and obtaining sex information of the sample according to the amplification result.
The invention has the advantages that:
1. two pairs of sex determination sites are set respectively and marked as sex sites A and B, wherein the sex site A is an enamel protein gene, and the sex site B is a conserved region on X and Y chromosomes. The invention designs the combination of two sex amplification genes by means of the real-time fluorescence quantitative PCR MGB probe method to amplify and identify the sex locus A and the sex locus B respectively, and the identification results of the two sex amplification genes can be supplemented and verified mutually, thereby greatly increasing the reliability of the identification results of the sex of ancient human remains.
2. The method uses a small amount of ancient DNA template, can complete the whole sex determination process by only 1.5 mul template,
3. compared with the traditional PCR amplification and gel electrophoresis verification steps, the application of the real-time fluorescence quantitative PCR technology shortens the experimental time and reduces the operation steps, more importantly, the detection sensitivity is greatly improved, and the efficiency is improved for identifying the sex of ancient human remains with poor preservation.
Drawings
FIG. 1 quantitation of ancient DNA.
FIG. 2 is a schematic diagram of the amplification of three specific sex primers.
FIG. 3 amplification and identification of sex site A.
FIG. 4 results of amplification and identification of sex site B.
FIG. 5 quantitation of ancient DNA.
FIG. 6 results of amplification and identification of sex site A.
FIG. 7 results of amplification and identification of sex site B.
FIG. 8 is a flow chart illustrating the operation of the present invention.
Detailed Description
The present invention will be described in detail with reference to the accompanying drawings.
Example one
1. Experimental samples: by taking ancient human remains of five village fruit ancient sites of Xinshi apparatus age as a research object 5000 years ago, the standards of pollution prevention are strictly followed when samples are collected, and a collector uses a disposable pollution-free mask, a cap, gloves and a pollution-free appliance. Three samples AH1-2, AH1-3, AH 1-13.
2. Experimental methods and results
Step one, extracting ancient DNA of an ancient site of five village fruit yarn, namely weighing 500mg bone meal, and adding 1ml of 10% SDS; 4ml of EDTA (pH 8.0) and 100. mu.l of 10mg/ml proteinase K, shaken overnight at 37 ℃; after overnight, the DNA extraction sample is transferred into an air bath for shaking, the shaking temperature bath is continued at 55 ℃ for 6h, and then the DNA extraction sample is placed at 95 ℃ for 5min to inactivate the redundant proteinase K. Centrifuging the lysate 7500r/min for 8min, adding 800 μ l of supernatant into an ultrafiltration centrifuge tube, centrifuging at 6800r/min, and concentrating the lysate to 100 μ l. Add 300. mu.l binding buffer (5M GuSCN, 25mM NaCl, 50mM Tris) and 20. mu.l magnetic bead suspension, mix for 10min by inversion, place the tube in magnetic rack for 1min to make the magnetic beads adsorb to the side wall, and suck away the liquid in the tube. Add 500. mu.l of washing buffer (50% ethanol, 125mM NaCl, 10mM Tris,1mM EDTA, pH 8.0), gently invert several times, adsorb the beads using a magnetic rack, and aspirate off the tube after 1 min. The washing process was repeated once. Taking down the centrifugal tube, adding 50-100 μ l of TE eluent (10mM Tris,1mM EDTA, pH 8.0), suspending the magnetic beads, carrying out water bath at 55 ℃ for 10min, placing the centrifugal tube on a magnetic frame for 1min, adsorbing the magnetic beads, and transferring the eluent to a clean centrifugal tube to obtain the ancient DNA extraction solution.
Step two, quantifying the ancient DNA: preparing a 113bp standard substance; the real-time fluorescent quantitative PCR was performed with the Luna Universal qPCR Master Mix (M3003) from NEB, three replicates of each standard, 0.5. mu.l of template load, and 20. mu.l of total; qPCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. The results of the ancient DNA quantification are shown in FIG. 1.
Step three, synthesis of sex locus A primer
The lengths of fragments of the Amelogenin gene are different on X chromosomes and Y chromosomes generally, male types with 106bp bands and 112bp bands after electrophoresis, female types with 106bp bands only and synthetic primers shown in table 2.
Step four, synthesis of sex locus B primer
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome, as shown in figure 2.
The size of the X chromosome amplification product fragment is 330 bp; the fragment size of the Y chromosome amplification product is 218bp, and the sequences of the primers M4, M5 and M6 are shown in Table 3;
step five, combining two pairs of sex sites: two pairs of sex identification sites are respectively set and marked as sex sites A and B, the sex site A is an enamel protein gene, the sex site B is a section of conserved region on X and Y chromosomes, and the sex sites A and B are integrated to be used as Markers for identifying the sex of ancient human remains.
Step six, amplification and identification of sex loci A and B
(1) Amplification and characterization of sex site A
The lengths of fragments of the Amelogenin gene are different on X chromosomes and Y chromosomes, male sex appears in 106bp and 112bp bands after electrophoresis, and female sex appears in 106bp band only.
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively (as shown in figure 2), wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome.
Using NEB Luna Universal Probe Qpcr Master Mix (M3004)
And (3) PCR system: probe qPCR mix 10ul, forward primer (20uM)0.5 ul, reverse primer (20uM)0.5 ul, Probe-AMGX (10uM)0.4 ul, Probe-AMGY (10uM)0.4 ul, template DNA 0.5 ul, and water was added to make the total volume 20 ul.
PCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. The amplification and identification of sex site a is shown in figure 3.
(2) Amplification and identification of sex site B
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome.
Using NEB Luna Universal Probe Qpcr Master Mix (M3004)
And (3) PCR system: probe qPCR mix 10ul, forward primer (20uM)0.5 ul, reverse primer (20uM)0.5 ul, Probe-AMGX (10uM)0.4 ul, Probe-AMGY (10uM)0.4 ul, template DNA 0.5 ul, and water was added to make the total volume 20 ul.
PCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. The results of amplification and identification of sex site B are shown in figure 4.
Example two
1. Experimental samples: the Li shan Feng Lin Xiangxi ruin is a seat with a raise. The long slope graveyard earth cave grave crossing the cave, the graveyard finds people's bone 2 utensils altogether, wherein two utensils are unanimous in the head direction, lie in coffin trace scope, one of them utensil is for making one's body up straight limb buries, another utensil is for making one's body bend limb buries, and the head direction is opposite to above-mentioned two utensils, and the utensil is buried the formula of the body unclearly.
2. Experimental methods and results
Step one, extracting ancient DNA of a Li Shanfenglin Xiangxi ancient site, namely weighing 500mg bone meal, and adding 1ml of 10% SDS; 4ml of EDTA (pH 8.0) and 100. mu.l of 10mg/ml proteinase K, shaking overnight at 37 ℃; after overnight, the DNA extraction sample is transferred into an air bath for shaking, the shaking bath is continued for 6h at 55 ℃, and then the DNA extraction sample is placed for 5min at 95 ℃ to inactivate the redundant proteinase K. After the lysate is centrifuged at 7500r/min for 8min, 800. mu.l of supernatant is added into an ultrafiltration centrifugal tube, and 6800r/min is centrifuged, and the lysate is concentrated to 100. mu.l. Add 300. mu.l binding buffer (5M GuSCN, 25mM NaCl, 50mM Tris) and 20. mu.l magnetic bead suspension, mix for 10min by inversion, place the tube in magnetic rack for 1min to make the magnetic beads adsorb to the side wall, and suck away the liquid in the tube. Add 500. mu.l of washing buffer (50% ethanol, 125mM NaCl, 10mM Tris,1mM EDTA, pH 8.0), gently invert several times, adsorb the beads using a magnetic rack, and aspirate off the tube after 1 min. The washing process was repeated once. Taking down the centrifugal tube, adding 50-100 μ l of TE eluent (10mM Tris,1mM EDTA, pH 8.0), suspending the magnetic beads, carrying out water bath at 55 ℃ for 10min, placing the centrifugal tube on a magnetic frame for 1min, adsorbing the magnetic beads, and transferring the eluent to a clean centrifugal tube to obtain the ancient DNA extraction solution.
Step two, quantifying the ancient DNA: preparing a 113bp standard substance; the real-time fluorescent quantitative PCR was performed with the Luna Universal qPCR Master Mix (M3003) from NEB, three replicates of each standard, 0.5. mu.l of template load, and 20. mu.l of total; qPCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. The results of the ancient DNA quantification are shown in FIG. 5.
Step three, synthesis of sex locus A primer
The lengths of fragments of the Amelogenin gene are different on X chromosomes and Y chromosomes generally, male types with 106bp bands and 112bp bands after electrophoresis, female types with 106bp bands only and synthetic primers shown in table 2.
Step four, synthesis of sex locus B primer
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome;
the size of the X chromosome amplification product fragment is 330 bp; the fragment size of the Y chromosome amplification product is 218bp, and the sequences of the primers M4, M5 and M6 are shown in Table 3;
step five, combining two pairs of sex sites: two pairs of sex identification sites are respectively set and marked as sex sites A and B, the sex site A is an enamel protein gene, the sex site B is a section of conserved region on X and Y chromosomes, and the sex sites A and B are integrated to be used as Markers for identifying the sex of ancient human remains.
Step six, amplification and identification of sex loci A and B
(1) Amplification and characterization of sex site A
The lengths of fragments of the Amelogenin gene are different on X chromosomes and Y chromosomes, male sex appears in 106bp and 112bp bands after electrophoresis, and female sex appears in 106bp band only.
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome.
Using NEB Luna Universal Probe Qpcr Master Mix (M3004)
And (3) PCR system: probe qPCR mix 10ul, forward primer (20uM)0.5 ul, reverse primer (20uM)0.5 ul, Probe-AMGX (10uM)0.4 ul, Probe-AMGY (10uM)0.4 ul, template DNA 0.5 ul, and water was added to make the total volume 20 ul.
PCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. The amplification and identification of sex site a is shown in figure 6.
(2) Amplification and identification of sex site B
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome.
Using NEB Luna Universal Probe Qpcr Master Mix (M3004)
And (3) PCR system: probe qPCR mix 10ul, forward primer (20uM)0.5 ul, reverse primer (20uM)0.5 ul, Probe-AMGX (10uM)0.4 ul, Probe-AMGY (10uM)0.4 ul, template DNA 0.5 ul, and water was added to make the total volume 20 ul.
PCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles. The results of amplification and identification of sex site B are shown in figure 7.
<110> an ancient human remains sex determination method aiming at extremely low DNA content
<120> university of west ampere traffic
<160> 12
<170> SIPOSequenceListing 1.0
<210> L15997
<211> 20
<212> DNA
<213> Artificial sequence
<400> L15997
<210> H16071
<211> 20
<212> DNA
<213> Artificial sequence
<400> H16071
<210> Probe-113
<211> 17
<212> DNA
<213> Artificial sequence
<400> Probe-113
gaagcagatt tgggtac 17
<210> AMG-F
<211> 24
<212> DNA
<213> Artificial sequence
<400> AMG-F
ccctgggctc tgtaaagaat agtg 24
<210> AMG-R
<211> 24
<212> DNA
<213> Artificial sequence
<400> AMG-F
atcagagctt aaactgggaa gctg 24
<210> Probe-AMGX
<211> 17
<212> DNA
<213> Artificial sequence
<400> Probe-AMGX
tatcccagat gtttctc 17
<210> Probe-AMGY
<211> 16
<212> DNA
<213> Artificial sequence
<400> Probe-AMGX
<210> M4
<211> 21
<212> DNA
<213> Artificial sequence
<400> M4
cagcttccca gtttaagcta t 21
<210> M5
<211> 22
<212> DNA
<213> Artificial sequence
<400> M5
tctcctatac cacttagtca ct 22
<210> M6
<211> 23
<212> DNA
<213> Artificial sequence
<400> M6
gcccaaagtt agtaatttta cct 23
<210> Probe-M5
<211> 22
<212> DNA
<213> Artificial sequence
<400> Probe-M5
agtgactaag tggtatagga ga 22
<210> Probe-M6
<211> 23
<212> DNA
<213> Artificial sequence
<400> Probe-M6
aggtaaaatt actaactttg ggc 23
Claims (4)
1. A method for determining the sex of ancient human remains with extremely low DNA content, which is characterized by comprising the following steps:
step one, extraction of ancient DNA
Step two, quantification of ancient DNA
Selecting a human mitochondrial DNA sequence, designing a DNA fragment with the length of 113bp, designing a probe, and simultaneously synthesizing a primer and the sequence as follows:
L15997 CACCATTAGCACCCAAAGCT
H16071 ACATAGCGGTTGTTGATGGG
Probe-113 VIC-GAAGCAGATTTGGGTAC
the preparation of the standard product comprises the following steps: amplifying a target fragment by PCR, purifying a PCR product, transfecting recombinant plasmids, performing colony PCR, performing constant-temperature culture on bacteria successfully subjected to colony PCR, shaking the bacteria overnight, extracting the plasmids, and finishing preparation of a preserved product;
amplifying the standard substance and the ancient DNA sample by using a real-time fluorescent quantitative PCR SYBR method, drawing a standard curve according to the amplification result of the standard substance, and further calculating the absolute quantitative result of the ancient DNA sample;
step three, synthesis of sex locus A primer
The lengths of fragments of the Amelogenin gene are usually different on X chromosomes and Y chromosomes, male sex appears in 106bp and 112bp bands after electrophoresis, female sex appears in 106bp band only, and synthetic primers and sequences are as follows:
step four, synthesis of sex locus B primer
Amplifying the X chromosome fragment and the Y chromosome fragment of the sample by using 3 specific sex primers respectively, wherein the primer M4 acts on the 5' ends of the X chromosome and the Y chromosome; primer M5 only acts on the 3' end of the X chromosome; whereas M6 acts only on the 3' end of the Y chromosome;
the size of the X chromosome amplification product fragment is 330 bp; the fragment of the Y chromosome amplification product has the size of 218bp, and the sequences of the primers M4, M5 and M6 are as follows:
step five, combining two pairs of sex sites: respectively setting two pairs of sex determination sites, marking as sex sites A and B, wherein the sex site A is an enamel protein gene, the sex site B is a section of conserved region on X and Y chromosomes, and integrating the sex sites A and B to be used as Markers for sex determination of ancient human remains;
step six, amplification and identification of sex loci A and B
Synthesizing an MGB Probe, simultaneously amplifying sex sites A and B by using a real-time fluorescent quantitative PCR Probe method and using NEB Luna Universal Probe Qpcr Master Mix, M3004, putting the amplification results of the sex sites A and B together for comprehensive analysis, and finally obtaining the sex information of the ancient human remains.
2. The method according to claim 1, wherein the step of sexing the ancient human remains having an extremely low DNA content,
step one, the ancient DNA extraction specifically comprises the following steps:
(1) weighing 0.5-2 g of bone meal, and adding 1ml of 10% SDS; 4ml of EDTA pH 8.0 and 100. mu.l of proteinase K at 10mg/ml, shaking overnight at 37 ℃; transferring the DNA extraction sample after overnight into an air bath for oscillation, continuing to oscillate the warm bath for 6h at 55 ℃, and then standing for 5min at 95 ℃ to inactivate redundant proteinase K;
(2) centrifuging the product obtained in the step (1) at 7500r/min for 8min, adding 800 μ l of supernatant into an ultrafiltration centrifugal tube, centrifuging at 6800r/min, and concentrating the lysate to 100 μ l;
(3) adding 300 mu l of binding buffer solution and 20 mu l of magnetic bead suspension, reversing and uniformly mixing for 10min, placing the centrifugal tube on a magnetic frame for 1min to enable the magnetic beads to be adsorbed to the side wall, and sucking away liquid in the centrifugal tube, wherein the binding buffer solution is a mixture of 5M GuSCN, 25mM NaCl and 50mM Tris;
(4) adding 500 μ l of washing buffer solution, gently inverting for several times, adsorbing magnetic beads by using a magnetic frame, sucking away liquid in the tube after 1min, and repeating the washing process once, wherein the washing buffer solution is 125mM NaCl, 10mM Tris,1mM EDTA with pH of 8.0, and ethanol accounting for 50% of the total volume;
(5) taking down the centrifugal tube, adding 50-100 mul of TE eluent to suspend the magnetic beads, carrying out water bath at 55 ℃ for 10min, placing the centrifugal tube on a magnetic frame for 1min to adsorb the magnetic beads, and transferring the eluent to a clean centrifugal tube to obtain an ancient DNA extraction solution; TE eluent was a mixture of 10mM Tris and 1mM EDTA, pH 8.0.
3. The method for identifying the sex of the ancient human remains with extremely low DNA content according to claim 1, wherein the step two of calculating the absolute quantitative result of the ancient DNA sample specifically comprises the following steps:
the method comprises the following steps of (1) carrying out real-time fluorescent quantitative PCR by using Luna Universal qPCR Master Mix and M3003 of NEB company, wherein each standard sample is repeated for three times, the sample loading amount of a template is 0.5 mu l, and the total amount is 20 mu l; qPCR amplification reaction conditions: 60s at 95 ℃; 95 ℃ for 15s, 60 ℃ for 30s, 40 cycles.
4. The method for identifying the sex of the ancient human remains with extremely low DNA content according to claim 1, wherein the sixth step is specifically as follows:
and (3) PCR system: probe qPCR mix 10ul, 20uM forward primer 0.5 ul, 20uM reverse primer 0.5 ul, 10uM Probe-AMGX0.4 ul, 10uM Probe-AMGY 0.4 ul, template DNA 0.5 ul, adding water to make the total volume to 20 ul;
PCR amplification reaction conditions: 60s at 95 ℃; 15s at 95 ℃, 30s at 60 ℃ and 40 cycles;
and (3) operating on a real-time fluorescent quantitative PCR instrument by using the reaction system and the reaction conditions by means of a 96-well plate, comprehensively analyzing to obtain a sex locus amplification result, and obtaining sex information of the sample according to the amplification result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910185048.7A CN110055337B (en) | 2019-03-12 | 2019-03-12 | Method for identifying sex of ancient human remains with extremely low DNA content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910185048.7A CN110055337B (en) | 2019-03-12 | 2019-03-12 | Method for identifying sex of ancient human remains with extremely low DNA content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110055337A CN110055337A (en) | 2019-07-26 |
| CN110055337B true CN110055337B (en) | 2021-02-02 |
Family
ID=67316760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910185048.7A Active CN110055337B (en) | 2019-03-12 | 2019-03-12 | Method for identifying sex of ancient human remains with extremely low DNA content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110055337B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0846775A3 (en) * | 1996-12-03 | 1999-01-13 | The Secretary of State for the Home Department | Primers permitting increased discrimination in DNA profiling techniques |
| CN101892309A (en) * | 2010-05-19 | 2010-11-24 | 中国农业科学院北京畜牧兽医研究所 | Method for discriminating ox and early embryo sex thereof |
| KR20160134106A (en) * | 2015-05-14 | 2016-11-23 | 배재대학교 산학협력단 | Kit for gender determination |
-
2019
- 2019-03-12 CN CN201910185048.7A patent/CN110055337B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0846775A3 (en) * | 1996-12-03 | 1999-01-13 | The Secretary of State for the Home Department | Primers permitting increased discrimination in DNA profiling techniques |
| CN101892309A (en) * | 2010-05-19 | 2010-11-24 | 中国农业科学院北京畜牧兽医研究所 | Method for discriminating ox and early embryo sex thereof |
| KR20160134106A (en) * | 2015-05-14 | 2016-11-23 | 배재대학교 산학협력단 | Kit for gender determination |
Non-Patent Citations (2)
| Title |
|---|
| Sex estimation using sexually dimorphic amelogenin protein fragments in human enamel;Glendon J. Parker等;《Journal of Archaeological Science》;20190131;第1-12页 * |
| 荧光引物扩增AMG基因鉴定古代人骨遗骸的性别;刘树柏等;《吉林大学学报(理学版)》;20040131;第139-142页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110055337A (en) | 2019-07-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2555389T3 (en) | Analysis of gene expression in individual cells | |
| US10519484B2 (en) | Lytic composition and application thereof, kit, method for preparing nucleic acid by utilizing lytic composition, and nucleic acid analysis method | |
| CN108070658B (en) | Non-diagnostic method for detecting MSI | |
| CN107988340B (en) | PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof | |
| CN112981011B (en) | Primer composition for detecting SARS-CoV-2 and its application | |
| EP3608452A1 (en) | Method for constructing amplicon library through one-step process | |
| KR101707992B1 (en) | Composition for diagnosing porcine reproductive and respiratory syndrome virus and method for diagnosing the same | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN107841566B (en) | Composite amplification system for rapidly mutating short tandem repeat sequence of Y chromosome, kit and application | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| CN112239779B (en) | Primer and kit for rapidly identifying sex of trachinotus ovatus and application of primer and kit | |
| CN110055337B (en) | Method for identifying sex of ancient human remains with extremely low DNA content | |
| CN112522434A (en) | Primer group and kit for simultaneously detecting multiple pathogenic fungi | |
| CN115786587A (en) | Primer group for multiplex PCR (polymerase chain reaction) for simultaneously detecting 4 pathogens as well as detection method and kit thereof | |
| CN104404128A (en) | TERT gene combination mutation site detection kit | |
| CN116042879A (en) | Kit and detection method for detecting brucella wild strain and vaccine strain | |
| CN114134218B (en) | Fluorescent detection method based on CRISPR-Cas12a | |
| CN113881786B (en) | Primer for identifying pseudobagrus ussuriensis, pseudobagrus ussuriensis and individuals with forward and reverse hybridization of pseudobagrus ussuriensis and pseudobagrus ussuriensis | |
| CN107245533B (en) | A kind of crucian coronavirus TaqMan real-time fluorescence quantitative RT-PCRs detection primer and application | |
| CN106148483B (en) | Primer and method for detecting escherichia coli cell DNA | |
| CN108823321A (en) | A kind of the HRM detection method and primer of beta-casein gene parting | |
| CN113122629B (en) | Primer and probe for hairpin amplification blocking method for gene mutation detection and application thereof | |
| CN107988232A (en) | The DNA bar code standard sequence and its method for identifying molecules of a kind of open country Storehouse midge | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN110616270A (en) | COI gene sequence-based molecular identification method of beta and beta |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |