CN108823321A

CN108823321A - A kind of the HRM detection method and primer of beta-casein gene parting

Info

Publication number: CN108823321A
Application number: CN201810660317.6A
Authority: CN
Inventors: 耿晓晖; 殷臣胤
Original assignee: Beijing Xiang Zhong Biotechnology Co Ltd
Current assignee: Beijing Xiang Zhong Biotechnology Co Ltd
Priority date: 2018-06-25
Filing date: 2018-06-25
Publication date: 2018-11-16

Abstract

The invention discloses a kind of HRM detection method of beta-casein gene parting and primers.The primer sequence is as follows：Upstream primer：5'-ATC CAC CCC TTT GCC CAG AC-3'；Downstream primer：5'-GGG GTT TGA GTA AGA GGA GGG-3'.Detection method includes the following steps by HRM of the invention：（A）Extract sample DNA；（B）PCR amplification is carried out using above-mentioned primer to the sample DNA；（C）HRM analysis is carried out to pcr amplification product, data is collected, determines amplified production genotype.The detection method can effectively distinguish the beta-casein of three kinds of genotype, easy to operate, and detection speed is fast, be able to achieve high-throughput detection, and accuracy is high, and specificity is good, and reproducible and expense is low.

Description

A kind of the HRM detection method and primer of beta-casein gene parting

Technical field

The invention belongs to field of biotechnology, are related to the detection method and primer of a kind of beta-casein gene parting, can answer Identification for the homozygous milk cow of A2A2.

Background technique

Milk protein is broadly divided into casein and lactalbumin, and lactalbumin is divided into alpha-lactalbumin and beta lactoglobulin again Deng accounting for about the 20% of milk protein；Casein has the several types such as α, β and κ, accounts for about the 80% of milk protein.Research hair in recent years Existing, beta-casein has the multiple types such as A1, A2, A3, B, C, D, E according to the difference of its structure.The beta-casein of A1 and A2 type is Most common two kinds in milk cow group, A2 type is wild type, and A1 type is the saltant type formed after A2 type is mutated.

The amino acid of the protein that beta-casein is made of 209 amino acid, the 67th site of A1 type beta-casein is group Propylhomoserin（Codon is CAT）, can be hydrolyzed by certain enzyme spcificitys and generate one section of amino acid fragment --- β-hydrolyzed casein（BCM- 7）, some researches show that BCM-7 is a type caffeine substance, may result in the raising of heart disease and diabetes morbidity And infant's allergic symptom, cause part population to react similar to the digestive system of lactose intolerance, abdominal pain, flatulence, intestines occurs The symptoms such as scorching disease incidence increase；And the amino acid in the 67th site of A2 type beta-casein is proline（Codon is CCT）, can not By specific for hydrolysis, therefore BCM-7 cannot be formed, it is relatively more safe.And in the A2 type beta-casein in milk and human milk Beta-casein structure is increasingly similar, and people's beta-casein will not equally generate BCM-7, and the negative shadow as caused by BCM-7 will not occur It rings.Therefore, based on breast milk it is more close, equally do not generate formula milk made of the A2 type beta-casein of BCM-7 because it is free of A1 type beta-casein is more advantageous to the growth and development for promoting infant.The milk cow that screening specially produces A2 type beta-casein is milked And for producing the high-end high-quality formula milk containing only A2 type beta-casein for improving current domestic powder quality with important Effect.

The method of existing beta-casein gene parting detection has enzyme incision technology, generation sequencing, Taqman probe technique etc.. Such as the country patent CN105219839A, CN105018582A and CN105925717A are disclosed based on digestion principle to β- The method that casein carries out parting carries out digestion processing using restriction enzyme to corresponding pcr amplified fragment, recycles gel Electrophoresis carries out race glue, carries out artificial interpretation to obtained band to distinguish different types of beta-casein.This method needs to buy Special enzyme, it is at high cost；It is complicated to detect reaction step, time-consuming；Artificial interpretation result is easy to appear error, result reliability It is lower.Patent CN105018581A discloses a kind of method for carrying out beta-casein gene parting based on sequencing approach, to corresponding PCR fragment expanded after using sequenator carry out sequencing comparison, but sequenator involves great expense, and does not accomplish really Stopped pipe operation.Method disclosed in patent CN105861671A is based on mass spectrograph and is detected, and same mass spectrograph is also expensive. Patent CN107287292A discloses a kind of method based on multiple Ligase detection reaction, is carried out first using one group of primer multiple PCR amplification, then multiple connection enzyme reaction is carried out, finally by sequenator scanning and agarose gel electrophoresis analysis connection reaction institute The fragment length of generation determines beta-casein gene type according to Fragment Differential.This method is complicated for operation, at high cost, time-consuming.Specially Sharp CN107058582A discloses a kind of based on KASP（Competitive ApoE gene）The beta-casein parting side of detection Method need to buy dedicated KASP mix.But these existing method higher costs operate relative complex.

HRM, i.e. high-resolution melting curve analysis technology（High Resolution Melting）, it is to rise in recent years Single nucleotide polymorphism（SNP）And mutation research tool.It by real-time monitoring temperature-rise period double center chain DNA fluorescent dye with The combination situation of pcr amplification product, to determine whether there are SNP.Whether different SNP sites are that heterozygote etc. can all influence to melt The peak shape of solution curve has very high specificity, stability and repeatability as DNA fingerprinting.It can be just according to curve Really distinguish wild-type homozygote, heterozygote and mutant homozygote, thus HRM analysis can effectively distinguish different SNP sites with Different genotype.This detection method by the limitation in mutating alkali yl site and type, is not necessarily to sequence-specific probes, in PCR After directly run high-resolution melting, the analysis to sample genotype can be completed.

Fluorescent dye is divided into unsaturation fluorescent dye（Such as Sybr Green）And saturated fluorescence dyestuff（As Eva Green, LC Green, Ly Green etc.）.For opposite unsaturation fluorescent dye, saturated fluorescence dyestuff is had the following advantages that：1. saturation Fluorescent dye reacts no any inhibiting effect to PCR, therefore can be added before PCR reaction, and other unsaturation fluorescence If meeting suppression PCR reaction in the more addition reaction solution of dyestuff, therefore the addition that can only limit the quantity, thus the instruction to Fluorescence PCR It is restricted；2. when DNA high-temperature denaturation, the addition of unsaturation fluorescent dye is single-stranded it will cause when DNA double chain high-temperature denaturation Partial luminescent dye molecule migrates, and luminescent dye molecule recombines the vacant site of double-stranded DNA, and fluorescence is caused to believe Number do not change, therefore false negative occur, specificity decline cannot differentiate the difference of single base, and saturable dye will not then go out Existing such situation；3. high-temperature stable, for the PCR product of high GC content, Tm value is higher, in DNA double chain high-temperature digestion, satisfy It is more stable with fluorescent dye combination nucleic acid.LC Green price is relatively high in saturated fluorescence dyestuff, and Eva Green is fabulous because of its Cost performance deeply welcome by everybody.

Summary of the invention

Place that purpose of the invention is to overcome the shortcomings in the prior art provides a kind of easy to operate, at low cost, energy Accurately, the method and primer of the detection of beta-casein gene type are efficiently carried out, the screening for the homozygous milk cow of A2A2 provides reliably Identification method.

In order to achieve the above object, the present invention provides a kind of primer that the HRM for beta-casein gene parting is detected, institute It is as follows to state primer sequence：

Upstream primer：5 '-ATC CAC CCC TTT GCC CAG AC-3 ' (SEQ ID NO.1),

Downstream primer：5'-GGG GTT TGA GTA AGA GGA GGG-3' (SEQ ID NO.2).

In order to achieve the above object, the present invention also provides a kind of HRM detection methods of beta-casein gene parting, including with Lower step：

（A）Extract sample DNA；

（B）PCR amplification is carried out using following primer to the sample DNA；

（C）HRM analysis is carried out to pcr amplification product, data is collected, determines amplified production genotype；

The primer sequence is：

Upstream primer：5 '-ATC CAC CCC TTT GCC CAG AC-3 ',

Downstream primer：5'-GGG GTT TGA GTA AGA GGA GGG-3'.

Preferably, the step（B）Middle pcr amplification reaction carries out according to the following steps：

（1）95 DEG C 2 minutes；

（2）95 DEG C 10 seconds, 60 DEG C 30 seconds, altogether carry out 40 circulation.

Preferably, the step（B）Middle PCR amplification is carried out in reaction solution, wherein the reaction solution of 20 μ l is by following Group is grouped as：

2X HRM Analysis Premix：10μl；

10 μM of upstream primer：0.6μl；

10 μM of downstream primer：0.6μl；

The DNA profiling of 50ng/ μ l：1μl；

RNase-Free ddH₂O：Polishing to 20 μ l,

Wherein, the 2X HRM Analysis Premix includes 500 μM of dNTP, 0.1U archaeal dna polymerases, saturated fluorescence dye Material, 20mM Tris-HCl, 100mM KCl and 3mM MgCl₂。

Preferably, the saturated fluorescence dyestuff is Eva Green dyestuff.

Preferably, the step（C）In to pcr amplification product carry out HRM analysis product fusion processes be：95 DEG C of holdings 10 seconds, near 40 DEG C were kept for 10 seconds, are melted later from 40 DEG C of heatings to 85 DEG C, and melting rate is 0.05 DEG C/sec, is warming up to 85 DEG C It keeps 1 second, is kept for 30 seconds near 40 DEG C later afterwards；Real time detection signal during melting from 40 DEG C of heatings to 85 DEG C, letter Number detection frequency be 12 times/DEG C.

The present invention has the following advantages that：

（1）The primer pair A1A1 type that the present invention designs（Mutant homozygote）, A2A2 type（Wild-type homozygote）, A1A2 type（It is miscellaneous Zygote）Beta-casein gene have amplification property well, PCR is high-efficient, and it is bent in HRM detection can to effectively improve melting The resolution ratio of line；

（2）The present invention establishes a kind of HRM detection method of beta-casein gene parting for the first time, the primer designed using the present invention The beta-casein gene of A1A1 type, A2A2 type and A1A2 type can be effectively distinguished, the detection method is easy to operate, detects speed Fastly, it is able to achieve high-throughput detection, accuracy is high, and specificity is good, and reproducible and expense is low.

Detailed description of the invention

Fig. 1 is that the HRM Gene scanning of the beta-casein of three kinds of genotype analyzes temperature drift figure（Normalized and Shifted Melting Curves）；

Fig. 2 is that the HRM Gene scanning of the beta-casein of three kinds of genotype analyzes subtractive curve graph（Normalized and Temp-Shifted Difference Plot）；

Fig. 3 is the pcr amplification product agarose gel photograph of different primers, and wherein Fig. 3 A is that the PCR of number 1-8 primer expands Increase production object agarose gel photograph, Fig. 3 B is the pcr amplification product agarose gel photograph of number 9-12 primer；

Fig. 4 is that the primer pair DNA of number 5 carries out the HRM Gene scanning analysis temperature drift figure after PCR amplification；

Fig. 5 is that the primer pair DNA of number 5 carries out the HRM Gene scanning analysis subtractive curve graph after PCR amplification；

Fig. 6 is that the primer pair DNA of number 7 carries out the HRM Gene scanning analysis temperature drift figure after PCR amplification；

Fig. 7 is that the primer pair DNA of number 7 carries out the HRM Gene scanning analysis subtractive curve graph after PCR amplification；

Fig. 8 is that the primer pair DNA of number 9 carries out the HRM Gene scanning analysis temperature drift figure after PCR amplification；

Fig. 9 is that the primer pair DNA of number 9 carries out the HRM Gene scanning analysis subtractive curve graph after PCR amplification；

Figure 10 is that the primer pair DNA of number 11 carries out the HRM Gene scanning analysis temperature drift figure after PCR amplification；

Figure 11 is that the primer pair DNA of number 11 carries out the HRM Gene scanning analysis subtractive curve graph after PCR amplification；

Figure 12 is that the primer pair DNA of number 12 carries out the HRM Gene scanning analysis temperature drift figure after PCR amplification；

Figure 13 is that the primer pair DNA of number 12 carries out the HRM Gene scanning analysis subtractive curve graph after PCR amplification；

Figure 14 is that the HRM Gene scanning of 22 test samples in accuracy experiment analyzes temperature drift figure；

Figure 15 is that the HRM Gene scanning of 22 test samples in accuracy experiment analyzes subtractive curve graph；

Figure 16 is 67 sequencing result figures of No. 1 milk cattle beta-casein in accuracy experiment；

Figure 17 is 67 sequencing result figures of No. 2 milk cattle beta-caseins in accuracy experiment；

Figure 18 is 67 sequencing result figures of No. 3 milk cattle beta-caseins in accuracy experiment；

Figure 19 is 67 sequencing result figures of No. 4 milk cattle beta-caseins in accuracy experiment；

Figure 20 is 67 sequencing result figures of No. 5 milk cattle beta-caseins in accuracy experiment；

Figure 21 is 67 sequencing result figures of No. 6 milk cattle beta-caseins in accuracy experiment；

Figure 22 is 67 sequencing result figures of No. 7 milk cattle beta-caseins in accuracy experiment；

Figure 23 is 67 sequencing result figures of No. 8 milk cattle beta-caseins in accuracy experiment；

Figure 24 is 67 sequencing result figures of No. 9 milk cattle beta-caseins in accuracy experiment；

Figure 25 is 67 sequencing result figures of No. 10 milk cattle beta-caseins in accuracy experiment；

Figure 26 is 67 sequencing result figures of No. 11 milk cattle beta-caseins in accuracy experiment；

Figure 27 is 67 sequencing result figures of No. 12 milk cattle beta-caseins in accuracy experiment；

Figure 28 is 67 sequencing result figures of No. 13 milk cattle beta-caseins in accuracy experiment；

Figure 29 is 67 sequencing result figures of No. 14 milk cattle beta-caseins in accuracy experiment；

Figure 30 is 67 sequencing result figures of No. 15 milk cattle beta-caseins in accuracy experiment；

Figure 31 is 67 sequencing result figures of No. 16 milk cattle beta-caseins in accuracy experiment；

Figure 32 is 67 sequencing result figures of No. 17 milk cattle beta-caseins in accuracy experiment；

Figure 33 is 67 sequencing result figures of No. 18 milk cattle beta-caseins in accuracy experiment；

Figure 34 is 67 sequencing result figures of No. 19 milk cattle beta-caseins in accuracy experiment；

Figure 35 is 67 sequencing result figures of No. 20 milk cattle beta-caseins in accuracy experiment；

Figure 36 is 67 sequencing result figures of No. 21 milk cattle beta-caseins in accuracy experiment；

Figure 37 is 67 sequencing result figures of No. 22 milk cattle beta-caseins in accuracy experiment；

Figure 38 is that the HRM Gene scanning of the test sample of three kinds of different genotypes in repeated experiment analyzes temperature drift Figure, wherein each sample repeats to survey three times；

Figure 39 is that the HRM Gene scanning of the test sample of three kinds of different genotypes in repeated experiment analyzes subtractive curve Figure, wherein each sample repeats to survey three times.

Specific embodiment

The present invention is elaborated combined with specific embodiments below, but scope of protection of the present invention is not limited thereto, it is any Those skilled in the art is in technical scope disclosed by the invention, and any changes or substitutions that can be easily thought of, all answers It is included within the scope of the present invention.Therefore, protection scope of the present invention should be with the scope of protection of the claims It is quasi-.

Some proprietary terms of the invention and symbol are explained below：

In the present invention, term " primer " is two segment oligonucleotide sequences, can be natural being also possible to synthesis, and one is drawn Object is complementary with a DNA template chain of target gene one end, another DNA profiling of another primer and the target gene other end Chain is complementary.Primer can be used as under certain condition induce DNA synthesis starting point, can induce under certain condition synthesis with The primer extension product of nucleic acid chains complementation, i.e., in four kinds of DNA and a kind of polymerization agent（That is archaeal dna polymerase）In the presence of Under, above-mentioned synthesis is carried out in a kind of suitable buffer and at a suitable temperature.

Term " PCR amplification ", i.e. polymerase chain reaction（Also known as：Polymerase chain reaction）, it is a kind of external DNA cloning Technology, under the conditions of being existing for template DNA, primer and the four kinds of deoxyribonucleotides, the enzymatic dependent on archaeal dna polymerase is closed The DNA fragmentation to be amplified oligonucleotides strand primer complementary with its two sides is passed through " high-temperature denaturation --- low-temperature annealing --- by reaction The multiple circulation of primer extend " three-step reaction, keeps DNA fragmentation quantitatively in exponential increase, to obtain me in a short time Needed for a large amount of specific gene segment.

Term " SNP " is single nucleotide polymorphism, refers to the variation in the genome by single nucleotide acid, including convert, Transversion, missing and insertion, the genetic marker of formation, there are many quantity, rich polymorphism.From the point of view of theoretically, each SNP Point can have 4 kinds of different variant forms, but actually occur only there are two types of, i.e., conversion and transversion, the ratio between the two be 2： 1.In general, SNP refers to the single nucleotide variations that variation frequency is greater than 1%.

" 2X HRM Analysis Premix ", " the 2X Taq PCR occurred in specification and claims 2X in MasterMix " etc. indicates double strength." Premix ", " MasterMix " are premixed liquid, refer to and are carrying out PCR amplification When reaction, in addition to DNA profiling, primer and RNase-Free ddH₂Reaction solution except O generally comprises dNTP, enzyme, buffering Liquid etc..

The foundation of the HRM detection method of beta-casein gene parting

（One）DNA is extracted

Collecting sample（Blood, hair follicle, sperm etc.）DNA is extracted, any acquisition having disclosed can be used in the extracting method of DNA Method or the extracts kit of commercialization, such as phenol chloroform extraction method, centrifugal column method, paramagnetic particle method, blood DNA extracts kit Deng.In this experiment, applicant extracts DNA, blood DNA extracts kit using blood DNA extracts kit from blood sample Purchased from Tiangeng biochemical technology（Beijing）Co., Ltd, catalog number (Cat.No.) DP348.DNA extraction step is as follows：

（1）200 μ l milk cow blood sample to be checked is taken, the premixed solution of 200 μ l buffer GB and 20 μ l Proteinase K is added, fills Divide and be mixed by inversion, 56 DEG C are placed 10 minutes, are mixed by inversion therebetween for several times, and solution becomes limpid.

（2）It is placed at room temperature for 2~350 μ l buffer solution B D is added after five minutes, be sufficiently mixed by inversion.

（3）Previous step acquired solution is added in an adsorption column CG2（Adsorption column CG2 is put into collecting pipe）, 12000rpm（~13400 × g）Centrifugation 30 seconds, outwells the waste liquid in collecting pipe, adsorption column CG2 is put into collecting pipe.

（4）500 μ l buffer GDB, 12000rpm are added into adsorption column CG2（~13400 × g）Centrifugation 30 seconds, is outwelled Adsorption column CG2 is put into collecting pipe by the waste liquid in collecting pipe.

（5）600 μ l rinsing liquid PWB are added into adsorption column CG2（Appropriate dehydrated alcohol is added using preceding）, 12000rpm （~13400 × g）Centrifugation 30 seconds, outwells the waste liquid in collecting pipe, adsorption column CG2 is put into collecting pipe.

（6）Repetitive operation step（5）.

（7）12000rpm（~13400 × g）Centrifugation 2 minutes, outwells waste liquid.Adsorption column CG2 is placed in and is placed at room temperature for 2 points Clock, thoroughly to dry rinsing liquid remaining in adsorbent material.

（8）Adsorption column CG2 is transferred in 1.5ml centrifuge tube, 50 μ l elution buffers are vacantly added dropwise to adsorbed film middle position Liquid TB is placed at room temperature for 2 minutes, 12000rpm（~13400 × g）Centrifugation 2 minutes, solution is collected into centrifuge tube.The solution As DNA solution.

（Two）The PCR amplification of DNA

Milk cow is subjected to DNA extraction using above-mentioned DNA extraction method, and carries out PCR expansion by DNA profiling of the DNA solution of acquisition Increase.

Any reaction system or commercialization for being adapted for HRM analysis having disclosed can be used in PCR amplification system HRM assay kit.In this experiment, applicant carries out PCR amplification, the examination of EvaGreen dyestuff using EvaGreen dye reagent box Agent box is purchased from Tiangeng biochemical technology（Beijing）Co., Ltd, catalog number (Cat.No.) FP210.

The content of each component is as follows in the pcr amplification reaction system of 20 μ l：

2X HRM Analysis Premix：10μl；

10 μM of upstream primer：0.6μl；

10 μM of downstream primer：0.6μl；

The DNA profiling of 50ng/ μ l：1μl；

RNase-Free ddH₂O：Polishing is to 20 μ l.

Wherein, the sequence of upstream primer is 5 '-ATC CAC CCC TTT GCC CAG AC-3 ', the sequence of downstream primer For 5 '-GGG GTT TGA GTA AGA GGA GGG-3 '.2X HRM Analysis Premix includes 500 μM of dNTP, 0.1U Archaeal dna polymerase, saturated fluorescence dyestuff, 20mM Tris-HCl, 100mM KCl and 3mM MgCl₂.Wherein saturated fluorescence dyestuff is Eva Green dyestuff.

Pcr amplification reaction can carry out according to the following steps：

（1）95 DEG C 2 minutes；

（Three）HRM detection and interpretation of result

Genotyping is carried out using HRM detection method to above-mentioned pcr amplification product, product melts program setting and is：95℃ 10 Second, 40 DEG C 10 seconds, 85 DEG C 1 second, 40 DEG C 30 seconds, rate of dissolution be 0.05 DEG C/sec, signal detection frequency be 12 times/DEG C.

PCR amplification and HRM detection use 480 instrument of LightCycler in experiment（Roche Holding Ag）Operation, Gene The analysis of scanning method.

Using it is above-mentioned "The foundation of the HRM detection method of beta-casein gene parting" in system, method and step pair A1A1 type, A2A2 type, A1A2 type beta-casein gene are detected, wherein A1A1 type, A2A2 type, A1A2 type beta-casein gene It is determined by following " gene order surveying methods of beta-casein gene parting ".Fig. 1 and Fig. 2 is respectively that the temperature drift of HRM detection is bent Line and subtractive curve.As depicted in figs. 1 and 2, curve 1-1,2-1 represents A1A1 type beta-casein gene（Mutant homozygote）, Curve 1-2,2-2 represent A2A2 type beta-casein gene（Wild-type homozygote）, curve 1-3,2-3 represent A1A2 type beta-casein Gene（Heterozygote）, the curve difference for representing three kinds of genotype beta-casein genes is obvious, can be good at distinguishing three kinds of genes Type.

The concentration of the DNA profiling used in the reaction solution of above-mentioned pcr amplification reaction is 50ng/ μ l, the concentration of DNA profiling Difference according to DNA extraction method may be other concentration, as long as guaranteeing that the final content of DNA in reaction solution is for 50ng It can.The concentration of DNA profiling, which also can according to need, is diluted to specific concentration, this skill can be used in DNA concentration measurement and dilution Method well known to art field and instrument carry out, such as nucleic acid analyzer, spectrophotometer etc..

HRM detection method of the invention can meet detection demand using common PCR instrument, visit without extra purchase fluorescence Needle, special enzyme and premixed liquid, it is easy, quick, it is at low cost, as a result accurately, and realize real stopped pipe operation.

The design of primers and screening that HRM for beta-casein gene parting is detected

It is good special to have surprisingly found that following primer pair beta-casein gene of the invention has by largely screening by inventor Property, and for HRM detection when, the resolution ratio of HRM detection curve can be effectively improved.In order to illustrate the excellent of primer of the invention Point, inventor devise following experiment.

Primer sequence of the invention is as follows：

Upstream primer：5 '-ATC CAC CCC TTT GCC CAG AC-3 ', downstream primer：5'-GGG GTT TGA GTA AGA GGA GGG-3’。

（One）Design of primers

According to the beta-casein gene sequence announced on NCBI（SEQ ID NO.3）, utilize Primer5 design of primers tool （Canadian Premier company）Design 12 group-specific primers as shown in Table 1：

Table 1

The extension increasing sequence of all primers covers the mutational site of beta-casein, by raw work bioengineering（Shanghai）The limited public affairs of share Department's synthesis.

（Two）The specific amplification of primer

1. DNA is extracted and amplification

Use blood DNA extracts kit（Tiangeng biochemical technology（Beijing）Co., Ltd）Cow blood is extracted according to above-mentioned steps DNA prepares DNA profiling.12 pairs of primer pair DNA profilings being respectively adopted in above-mentioned table 1 later carry out PCR amplification and DNA sample are made Product.Pcr amplification reaction uses LightCycler 480（Roche Holding Ag）Instrument carry out, using with "Beta-casein gene parting HRM detection method foundation" in identical pcr amplification reaction system and step.

2. electrophoretic analysis

Above-mentioned 12 pcr amplification products are subjected to agarose gel electrophoresis analysis, specific step is as follows：

（1）It weighs 0.5g agarose to be placed in conical flask, 50mL tbe buffer liquid is added, microwave heating is boiled to agarose whole Melt, shakes up, obtain 1% Ago-Gel；

（2）Above-mentioned solution is poured into glue mould, it is in place to plug comb, make its solidification at room temperature；

（3）Gel and inside groove are put into electrophoresis tank, addition electrophoretic buffer is not until crossing offset plate 1-2 ㎜.2 μ l are taken respectively DNA sample and 10 μ l 6X sample-loading buffers mix to obtain DNA sample after dilution, and each loading hole is separately added into 10 μ l Marker With the DNA sample after dilution；

（4）After the completion of sample-adding, electrophoresis slot cover is closed, is powered on immediately.Voltage is maintained at 110V, electric current 50mA；

（5）When band is moved to away from gel front about 2 cm（About 40 minutes）, stop electrophoresis.It takes pictures and observes under ultraviolet.

Electrophoretic analysis result is as shown in Fig. 3 A, Fig. 3 B.M is Marker in Fig. 3 A, Fig. 3 B（Purchased from Tiangeng biochemical technology（North Capital）Co., Ltd, article No. MD101）, in Fig. 3 A swimming lane 1-8 be respectively must after carrying out PCR amplification using the primer of number 1-8 The product arrived, swimming lane 9-12 is respectively the product obtained after the primer progress PCR amplification using number 9-12 in Fig. 3 B.By scheming It is that 5,6,7,9,11,12 this 6 pairs of primers carry out the electricity of the product obtained after PCR amplification that 3A, Fig. 3 B, which can be seen that using number, Band of swimming is single, illustrates this available more single DNA fragmentation of 6 pairs of primers that number is 5,6,7,9,11,12, specificity Well, expanding effect is good.

3. the HRM detection sensitivity of primer

Use "The foundation of the HRM detection method of beta-casein gene parting" in system, method and step number is respectively adopted PCR amplification and HRM detection are carried out for 5,6,7,9,11, the 12 above-mentioned blood DNA of 6 pairs of primer pairs.

HRM testing result after using number to carry out PCR amplification for 5 primer pair DNA is as shown in Figure 4, Figure 5.Fig. 4 is The temperature drift curve of HRM detection, three curves for representing three kinds of genotype beta-casein genes as seen from Figure 4 can not divide It opens, can not effectively distinguish three kinds of genotype.Fig. 5 is the subtractive curve of HRM detection, represents three kinds of genotype as seen from Figure 5 Only has the difference less than 1 although three curves of beta-casein gene can separate, between three, curve difference is unknown It is aobvious, it can not effectively distinguish three kinds of genotype.

Use the primer numbered as 6（I.e. of the invention "The foundation of the HRM detection method of beta-casein gene parting" in made Primer）HRM testing result after carrying out PCR amplification to DNA is as shown in Figure 1 and Figure 2, and Fig. 1 and Fig. 2 are respectively what HRM was detected Temperature drift curve and subtractive curve.In Fig. 1 and Fig. 2, curve 1-1,2-1 represent A1A1 type beta-casein gene（Saltant type is pure Zygote）, curve 1-2,2-2 represent A2A2 type beta-casein gene（Wild-type homozygote）, curve 1-3,2-3 represent A1A2 type β- Casein gene（Heterozygote）, it can be seen that the curve difference for representing three kinds of genotype beta-casein genes is obvious, can be fine Three kinds of genotype of differentiation.

HRM testing result after using number to carry out PCR amplification for 7 primer pair DNA is as shown in Figure 6, Figure 7, Fig. 6 and figure 7 be respectively the temperature drift curve and subtractive curve of HRM detection, it can be seen that represents the song of three kinds of genotype beta-casein genes In line, there are two curves that can hardly separate, difference is unobvious, can not effectively distinguish three kinds of genotype.

HRM testing result after using number to carry out PCR amplification for 9 primer pair DNA is as shown in Figure 8, Figure 9.Fig. 8 is The temperature drift curve of HRM detection, as seen from Figure 8, the curve for representing three kinds of genotype beta-casein genes can not separate, Three kinds of genotype can not effectively be distinguished.Fig. 9 is the subtractive curve of HRM detection, it can be seen that represents three kinds of genotype beta-caseins The curve difference of gene is unobvious, and two of them are almost overlapped, and can not effectively distinguish three kinds of genotype.

HRM testing result after using number to carry out PCR amplification for 11 primer pair DNA is as shown in Figure 10, Figure 11.Figure 10 It is respectively the temperature drift curve and subtractive curve of HRM detection with Figure 11, it can be seen that represent three kinds of genotype beta-casein bases In the curve of cause, there are two can not almost separate, difference is unobvious, can not effectively distinguish three kinds of genotype.

HRM testing result after using number to carry out PCR amplification for 12 primer pair DNA is as shown in Figure 12 and Figure 13, Figure 12 It is respectively the temperature drift curve and subtractive curve of HRM detection with Figure 13, it can be seen that represent three kinds of genotype beta-casein bases In the curve of cause, there are two can not almost separate, difference is unobvious, can not effectively distinguish three kinds of genotype.

Above-mentioned experimental result is shown, in the primer that the good number of expanding effect is 5,6,7,9,11,12, only number is 6 Primer can effectively distinguish three kinds of genotype.

Wherein, the primer amplification fragment length that the primer of number 7,9,11,12 and number are 6 is in 100bp or so, especially It is the primer that number is 11（Expanding fragment length is 101bp）The primer for being 6 with number（Expanding fragment length is 98bp）Expand Increase fragment length and differs only by 3bp, but another people is surprisingly, the primer that only number is 6 is being shown to beta-casein While gene excellent specificity, sensitive three kinds of genotype can be efficiently differentiated.

To sum up, the following primer of the invention that number is 6 can not only specific amplification beta-casein, and HRM detect In can effectively distinguish three kinds of genotype, high sensitivity.

Upstream primer：5 '-ATC CAC CCC TTT GCC CAG AC-3 ',

Downstream primer：5'-GGG GTT TGA GTA AGA GGA GGG-3'.

The analysis of the accuracy of the HRM detection method of beta-casein gene parting

22 cow heads are randomly choosed, it is numbered.Using above-mentioned DNA extraction step, the blood DNA two of above-mentioned milk cow is extracted Part.By the blood DNA sample of above-mentioned 22 cow head use respectively following " gene order surveying methods of beta-casein gene parting " and HRM detection method of the present invention, i.e., "The foundation of the HRM detection method of beta-casein gene parting" in system, method and step Carry out parting detection.

（One）The gene order surveying method of beta-casein gene parting

The blood DNA of milk cow to be checked is extracted using above-mentioned DNA extraction method, and uses LightCycler 480（Roche is public Department）Instrument carries out PCR amplification, and wherein the primer of PCR amplification is：

Upstream primer：acccttgattccattcagtctctga (SEQ ID NO.26)；

Downstream primer：tggagaaggaggcttgggag (SEQ ID NO.27).

Amplification system is 10 μ l 2X Taq PCR MasterMix（Ingredient be 0.1 U Taq polymerase, 500 μM of dNTP, 20mM Tris-HCl、100mM KCl、3mM MgCl₂）（Tiangeng biochemical technology（Beijing）Co., Ltd, catalog number (Cat.No.)：KT201）, 10 μM of 0.5 μ l of upstream primer, 10 μM of 0.5 μ l of downstream primer, 1 DNA μ l, ddH₂O 8μl。

Amplified reaction step is：

（1）94 DEG C 5 minutes；

（2）94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C 1 minute, altogether carry out 40 circulation；

（3）72 DEG C 10 minutes.

Later by the product after above-mentioned amplification by sequencing company（Sinogenomax Co., Ltd.）It carries out Sequencing.

（Two）The comparison of HRM detection method and gene order surveying method of the invention

The temperature drift curve and subtractive curve of 22 cow head HRM detection are shown in Figure 14, Figure 15, as shown, in above-mentioned 22 milk Wild-type homozygote milk cow 9 are detected in ox altogether（A,A'）, heterozygote milk cow 10（B,B'）, mutant homozygote milk cow 3 Head（C,C'）.Each milk cow number and corresponding genotype results are as shown in table 2.

The 1-22 milk cattle beta-casein DNA sequence dna that gene order surveying method detects is shown in the sequence SEQ ID in sequence table 67 sequencing result figures of NO.28~SEQ ID NO.49,1-22 milk cattle beta-casein are as shown in Figure 16-37.Gene sequencing Genotyping result is shown in Table 2.

By sequence SEQ ID NO.28~SEQ ID NO.49 and Figure 16-37 it can be seen that number is 1-9 totally 9 cow head 67 amino acids of beta-casein are proline（Codon is CCT）, it is wild-type homozygote milk cow；Number is that 20-21 shares 3 67 amino acids of cow head beta-casein are histidine（Codon is CAT）, it is mutant homozygote milk cow；Number 10-19 67 amino acids for sharing 10 cow head beta-caseins are a heterozygote（Sequence is CC/AT, and the sequence is in appended nucleotide Cmt is shown as in sequence table）, it is heterozygote milk cow.

Table 2

As shown in Table 2, HRM testing result of the invention is consistent with gene sequencing parting testing result, accuracy rate 100%, illustrates this The HRM detection method of invention and primer for the method for the present invention is reliable efficiently, accuracy is strong.

The repeatability analysis of the HRM detection method of beta-casein gene parting

From above-mentioned 22 cow head sample choose number be 1,10,20 milk cow sample, using HRM detection method of the invention into Row detection.Each sample repeats detection 3 times, and the temperature drift curve and subtractive curve of HRM detection are shown in Figure 38, Figure 39, as schemed institute Show, the wild-type homozygote milk cow that number is 1（D,D'）, number be 10 heterozygote milk cows（E,E'）, number be 20 saltant type Homozygote milk cow（F,F'）It is different repeat between result it is consistent.And this testing result and analysis of the accuracy of each sample In testing result it is also consistent, illustrate that the reaction system, condition and primer are reproducible.

The feasibility analysis of the HRM detection method of beta-casein gene parting

Sample used in above-mentioned detection is that milk cow whole blood sample is saved at room temperature using the blood sampling blood sampling tube containing EDTA anti-coagulants And it is transported to test experience, 5 days time-consuming, blood sample saves under the conditions of being placed in -20 DEG C extracts DNA after a week, and DNA sample is in -20 DEG C Under the conditions of save 30 days, carry out Genotyping according to the method in the present invention later, prove that this method obtains by sequencing analysis The result is that reliable.

In practice, pasture does not have the ability of oneself detection usually, needs to give in sample competent laboratory, above-mentioned Sample preservation and the process of transport can satisfy the practical operation requirement in practice completely, and preservation and extraction obtain under this condition DNA fully meets detection demand, and obtains reliable result.Illustrate that the feasibility of this method in practice is high.

Sequence table

<110>Beijing is to middle Bioisystech Co., Ltd

<120>A kind of the HRM detection method and primer of beta-casein gene parting

<160> 49

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

atccacccct ttgcccagac 20

<210> 2

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

ggggtttgag taagaggagg g 21

<210> 3

<211> 1560

<212> DNA

<213>Milk cow (Bos taurus)

<400> 3

ctcaagatta ccaccttcta ccaagagaag tagtgctaga agttggccat tgttaaggaa 60

ctccttgaat taaaaaaaca catattaaga cttagttttc attaaaacaa acaaaaataa 120

acctcagagt aacttttaaa gtctttttaa aatggatctt tctttgttat atgaaaccag 180

tttggactat tatccaaagt atgtagctac cactctgcag gcaactcagg aagaggtgga 240

ataagtgttg aaatctccaa accctgattt cacttgactc tctgatttca cctgtgaaga 300

aagtgggtta atgagaaatc cttcagtgag cattttactc attagtcttc atatgacccc 360

aatttcttaa ccaaaccaaa tggaagattt tctttctctc tcttcactga attatgtttt 420

aaaaagagga ggataattca tcatgaataa caattataac tggattatgg actcaaagat 480

ttgttttcct tctttccagg atgaactcca ggataaaatc cacccctttg cccagacaca 540

gtctctagtc tatcccttcc ctgggcccat ccctaacagc ctcccacaaa acatccctcc 600

tcttactcaa acccctgtgg tggtgccgcc tttccttcag cctgaagtaa tgggagtctc 660

caaagtgaag gaggctatgg ctcctaagca caaagaaatg cccttcccta aatatccagt 720

tgagcccttt actgaaagcc agagcctgac tctcactgat gttgaaaatc tgcaccttcc 780

tctgcctctg ctccagtctt ggatgcacca gcctcaccag cctcttcctc caactgtcat 840

gtttcctcct cagtccgtgc tgtccctttc tcagtccaaa gtcctgcctg ttccccagaa 900

agcagtgccc tatccccaga gagatatgcc cattcaggcc tttctgctgt accaggagcc 960

tgtactcggt cctgtccggg gacccttccc tattattgta agtctaaatt tactaactgt 1020

gctgtttaac ttctgatgtt tgtatgatat tcgagtaatt aagagtccta taaaaaaatg 1080

aataatgaat ggttccaaaa taagcatagc tgagattaat gattgtcagc attagttata 1140

aatagaataa gctggagaac tttcacctcc cctccaccac cagatctcaa tgtctaggct 1200

tacccgtgga gattctgatg taattgttct ttctatgtag aagaaactta ttgggaagaa 1260

ataatataat ggactatgat ttaattggtc tgttgagacc aattaaatta gatgaaggcg 1320

attaaggtac aataaagcca gaattgaatt tgataatctc atttggctaa gaataacaaa 1380

cctaagaagg tttgctattt tctacaattt tgaagttctc cttatgcaca attatttcac 1440

cacatgactc atttcacatc ttgtttttga tatatgagca tatgagggaa aaatactgag 1500

atgcttattt caatactcag ggaaaatttt cttgccaaaa ggcaagaatt gtataaatca 1560

<210> 4

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

gggttaatga gaaatccttc agtg 24

<210> 5

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

actggatatt tagggaaggg ca 22

<210> 6

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

tccaaaccct gatttcactt gact 24

<210> 7

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

cagttggagg aagaggctgg t 21

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

taaaatccac ccctttgccc 20

<210> 9

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

gccatagcct ccttcacttt g 21

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

taaaatccac ccctttgccc 20

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

gacagttgga ggaagaggct 20

<210> 12

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

acccttgatt ccattcagtc tctga 25

<210> 13

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 13

tggagaagga ggcttgggag 20

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

taaaatccac ccctttgccc 20

<210> 15

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 15

ggggtttgag taagaggagg g 21

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 16

ctagtctatc ccttccctgg 20

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 17

aaggtgcaga ttttcaacat 20

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 18

aaaatccacc cctttgccca 20

<210> 19

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 19

gggatgtttt gtgggaggct 20

<210> 20

<211> 19

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 20

cacccctttg cccagacac 19

<210> 21

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 21

ggggtttgag taagaggagg g 21

<210> 22

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 22

aaaatccacc cctttgccca 20

<210> 23

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 23

ggggtttgag taagaggagg g 21

<210> 24

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 24

tctctagtct atcccttccc tgg 23

<210> 25

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 25

ggagactccc attacttcag gc 22

<210> 26

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 26

acccttgatt ccattcagtc tctga 25

<210> 27

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 27

tggagaagga ggcttgggag 20

<210> 28

<211> 539

<212> DNA

<213>Milk cow (Bos taurus)

<400> 28

ctttattaga gtgggttatg agaatccttc agtgagcatt ttactcatta gtcttcatat 60

gaccccaatt tcttaaccaa accaaatgga agattttctt tctctctctt cactgaatta 120

tgttttaaaa agaggaggat aattcatcat gaataacaat tataactgga ttatggactc 180

aaagatttgt tttccttctt tccaggatga actccaggat aaaatccacc cctttgccca 240

gacacagtct ctagtctatc ccttccctgg gcccatccct aacagcctcc cacaaaacat 300

ccctcctctt actcaaaccc ctgtggtggt gccgcctttc cttcagcctg aagtaatggg 360

agtctccaaa gtgaaggagg ctatggctcc taagcacaaa gaaatgccct tccctaaata 420

tccagttgag ccctttactg aaagccagag cctgactctc actgatgttg aaaatctgca 480

ccttcctctg cctctgctcc agtcttggat gcaccagcct caccagcctc ttcctccaa 539

<210> 29

<211> 538

<212> DNA

<213>Milk cow (Bos taurus)

<400> 29

cttcgagagt gggttatgag aatccttcag tgagcatttt actcattagt cttcatatga 60

ccccaatttc ttaaccaaac caaatggaag attttctttc tctctcttca ctgaattatg 120

ttttaaaaag aggaggataa ttcatcatga ataacaatta taactggatt atggactcaa 180

agatttgttt tccttctttc caggatgaac tccaggataa aatccacccc tttgcccaga 240

cacagtctct agtctatccc ttccctgggc ccatccctaa cagcctccca caaaacatcc 300

ctcctcttac tcaaacccct gtggtggtgc cgcctttcct tcagcctgaa gtaatgggag 360

tctccaaagt gaaggaggct atggctccta agcacaaaga aatgcccttc cctaaatatc 420

cagttgagcc ctttactgaa agccagagcc tgactctcac tgatgttgaa aatctgcacc 480

ttcctctgcc tctgctccag tcttggatgc accagcctca ccagcctcct tcctccaa 538

<210> 30

<211> 538

<212> DNA

<213>Milk cow (Bos taurus)

<400> 30

tcttccagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatcccta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcccct tcctccaa 538

<210> 31

<211> 543

<212> DNA

<213>Milk cow (Bos taurus)

<400> 31

ccttatcaga gtgggttatg agaatccttc agtgagcatt ttactcatta gtcttcatat 60

gaccccaatt tcttaaccaa accaaatgga agattttctt tctctctctt cactgaatta 120

tgttttaaaa agaggaggat aattcatcat gaataacaat tataactgga ttatggactc 180

aaagatttgt tttccttctt tccaggatga actccaggat aaaatccacc cctttgccca 240

gacacagtct ctagtctatc ccttccctgg gcccatccct aacagcctcc cacaaaacat 300

ccctcctctt actcaaaccc ctgtggtggt gccgcctttc cttcagcctg aagtaatggg 360

agtctccaaa gtgaaggagg ctatggctcc taagcacaaa gaaatgccct tccctaaata 420

tccagttgag ccctttactg aaagccagag cctgactctc actgatgttg aaaatctgca 480

ccttcctctg cctctgctcc agtcttggat gcaccagcct caccagcctc cttcctccaa 540

ata 543

<210> 32

<211> 539

<212> DNA

<213>Milk cow (Bos taurus)

<400> 32

ctgagcagaa gtgggttatg agaatccttc agtgagcatt ttactcatta gtcttcatat 60

gaccccaatt tcttaaccaa accaaatgga agattttctt tctctctctt cactgaatta 120

tgttttaaaa agaggaggat aattcatcat gaataacaat tataactgga ttatggactc 180

aaagatttgt tttccttctt tccaggatga actccaggat aaaatccacc cctttgccca 240

gacacagtct ctagtctatc ccttccctgg gcccatccct aacagcctcc cacaaaacat 300

ccctcctctt actcaaaccc ctgtggtggt gccgcctttc cttcagcctg aagtaatggg 360

agtctccaaa gtgaaggagg ctatggctcc taagcacaaa gaaatgccct tccctaaata 420

tccagttgag ccctttactg aaagccagag cctgactctc actgatgttg aaaatctgca 480

ccttcctctg cctctgctcc agtcttggat gcaccagcct caccagcctc ttcctccaa 539

<210> 33

<211> 542

<212> DNA

<213>Milk cow (Bos taurus)

<400> 33

tcagctagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatcccta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcccct tcctccaaac 540

ag 542

<210> 34

<211> 538

<212> DNA

<213>Milk cow (Bos taurus)

<400> 34

cctgagagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatcccta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcccct tcctccaa 538

<210> 35

<211> 544

<212> DNA

<213>Milk cow (Bos taurus)

<400> 35

tcttagagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatcccta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcccct ttcctccaaa 540

gaca 544

<210> 36

<211> 538

<212> DNA

<213>Milk cow (Bos taurus)

<400> 36

ccttcgagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatcccta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcctct tcctccaa 538

<210> 37

<211> 538

<212> DNA

<213>Milk cow (Bos taurus)

<400> 37

ttttcgagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatccmta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcctct tcctccaa 538

<210> 38

<211> 538

<212> DNA

<213>Milk cow (Bos taurus)

<400> 38

tttagagagt gggttatgag aatccttcag tgagcatttt actcattagt cttcatatga 60

ccccaatttc ttaaccaaac caaatggaag attttctttc tctctcttca ctgaattatg 120

ttttaaaaag aggaggataa ttcatcatga ataacaatta taactggatt atggactcaa 180

agatttgttt tccttctttc caggatgaac tccaggataa aatccacccc tttgcccaga 240

cacagtctct agtctatccc ttccctgggc ccatccmtaa cagcctccca caaaacatcc 300

ctcctcttac tcaaacccct gtggtggtgc cgcctttcct tcagcctgaa gtaatgggag 360

tctccaaagt gaaggaggct atggctccta agcacaaaga aatgcccttc cctaaatatc 420

cagttgagcc ctttactgaa agccagagcc tgactctcac tgatgttgaa aatctgcacc 480

ttcctctgcc tctgctccag tcttggatgc accagcctca ccagcccctt tcctccaa 538

<210> 39

<211> 540

<212> DNA

<213>Milk cow (Bos taurus)

<400> 39

ccttgctcag agtgggttat gagaatcctt cagtgagcat tttactcatt agtcttcata 60

tgaccccaat ttcttaacca aaccaaatgg aagattttct ttctctctct tcactgaatt 120

atgttttaaa aagaggagga taattcatca tgaataacaa ttataactgg attatggact 180

caaagatttg ttttccttct ttccaggatg aactccagga taaaatccac ccctttgccc 240

agacacagtc tctagtctat cccttccctg ggcccatccm taacagcctc ccacaaaaca 300

tccctcctct tactcaaacc cctgtggtgg tgccgccttt ccttcagcct gaagtaatgg 360

gagtctccaa agtgaaggag gctatggctc ctaagcacaa agaaatgccc ttccctaaat 420

atccagttga gccctttact gaaagccaga gcctgactct cactgatgtt gaaaatctgc 480

accttcctct gcctctgctc cagtcttgga tgcaccagcc tcaccagcct cttcctccaa 540

<210> 40

<211> 542

<212> DNA

<213>Milk cow (Bos taurus)

<400> 40

tctgctagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatccmta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcctcc ttcctccaaa 540

ga 542

<210> 41

<211> 539

<212> DNA

<213>Milk cow (Bos taurus)

<400> 41

atcagtgaga gtgggttaat gagaatcctt cagtgagcat tttactcatt agtcttcata 60

tgaccccaat ttcttaacca aaccaaatgg aagattttct ttctctctct tcactgaatt 120

atgttttaaa aagaggagga taattcatca tgaataacaa ttataactgg attatggact 180

caaagatttg ttttccttct ttccaggatg aactccagga taaaatccac ccctttgccc 240

agacacagtc tctagtctat cccttccctg ggcccatccm taacagcctc ccacaaaaca 300

tccctcctct tactcaaacc cctgtggtgg tgccgccttt ccttcagcct gaagtaatgg 360

gagtctccaa agtgaaggag gctatggctc ctaagcacaa agaaatgccc ttccctaaat 420

atccagttga gccctttact gaaagccaga gcctgactct cactgatgtt gaaaatctgc 480

accttcctct gcctctgctc cagtcttgga tgcaccagcc tcaccagcct cttcctcca 539

<210> 42

<211> 543

<212> DNA

<213>Milk cow (Bos taurus)

<400> 42

tctgcgagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatccmta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aagccagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcccct tcctccaaag 540

aga 543

<210> 43

<211> 541

<212> DNA

<213>Milk cow (Bos taurus)

<400> 43

tatgcgagag tgggttatga gaatccttca gtgagcattt tactcattag tcttcatatg 60

accccaattt cttaaccaaa ccaaatggaa gattttcttt ctctctcttc actgaattat 120

gttttaaaaa gaggaggata attcatcatg aataacaatt ataactggat tatggactca 180

aagatttgtt ttccttcttt ccaggatgaa ctccaggata aaatccaccc ctttgcccag 240

acacagtctc tagtctatcc cttccctggg cccatccmta acagcctccc acaaaacatc 300

cctcctctta ctcaaacccc tgtggtggtg ccgcctttcc ttcagcctga agtaatggga 360

gtctccaaag tgaaggaggc tatggctcct aagcacaaag aaatgccctt ccctaaatat 420

ccagttgagc cctttactga aaggcagagc ctgactctca ctgatgttga aaatctgcac 480

cttcctctgc ctctgctcca gtcttggatg caccagcctc accagcccct tcctccaaac 540

a 541

<210> 44

<211> 540

<212> DNA

<213>Milk cow (Bos taurus)

<400> 44

tttcgagagt gggttatgag aatccttcag tgagcatttt actcattagt cttcatatga 60

ccccaatttc ttaaccaaac caaatggaag attttctttc tctctcttca ctgaattatg 120

ttttaaaaag aggaggataa ttcatcatga ataacaatta taactggatt atggactcaa 180

agatttgttt tccttctttc caggatgaac tccaggataa aatccacccc tttgcccaga 240

cacagtctct agtctatccc ttccctgggc ccatccmtaa cagcctccca caaaacatcc 300

ctcctcttac tcaaacccct gtggtggtgc cgcctttcct tcagcctgaa gtaatgggag 360

tctccaaagt gaaggaggct atggctccta agcacaaaga aatgcccttc cctaaatatc 420

cagttgagcc ctttactgaa agccagagcc tgactctcac tgatgttgaa aatctgcacc 480

ttcctctgcc tctgctccag tcttggatgc accagcctca ccagcccctt cctccaaaca 540

<210> 45

<211> 540

<212> DNA

<213>Milk cow (Bos taurus)

<400> 45

tattcggaga gtgggttatg agaatccttc agtgagcatt ttactcatta gtcttcatat 60

gaccccaatt tcttaaccaa accaaatgga agattttctt tctctctctt cactgaatta 120

tgttttaaaa agaggaggat aattcatcat gaataacaat tataactgga ttatggactc 180

aaagatttgt tttccttctt tccaggatga actccaggat aaaatccacc cctttgccca 240

gacacagtct ctagtctatc ccttccctgg gcccatccmt aacagcctcc cacaaaacat 300

ccctcctctt actcaaaccc ctgtggtggt gccgcctttc cttcagcctg aagtaatggg 360

agtctccaaa gtgaaggagg ctatggctcc taagcacaaa gaaatgccct tccctaaata 420

tccagttgag ccctttactg aaagccagag cctgactctc actgatgttg aaaatctgca 480

ccttcctctg cctctgctcc agtcttggat gcaccagcct caccagcctc cttcctccaa 540

<210> 46

<211> 539

<212> DNA

<213>Milk cow (Bos taurus)

<400> 46

cattgctcag agtgggttat gagaatcctt cagtgagcat tttactcatt agtcttcata 60

tgaccccaat ttcttaacca aaccaaatgg aagattttct ttctctctct tcactgaatt 120

atgttttaaa aagaggagga taattcatca tgaataacaa ttataactgg attatggact 180

caaagatttg ttttccttct ttccaggatg aactccagga taaaatccac ccctttgccc 240

agacacagtc tctagtctat cccttccctg ggcccatccm taacagcctc ccacaaaaca 300

tccctcctct tactcaaacc cctgtggtgg tgccgccttt ccttcagcct gaagtaatgg 360

gagtctccaa agtgaaggag gctatggctc ctaagcacaa agaaatgccc ttccctaaat 420

atccagttga gccctttact gaaagccaga gcctgactct cactgatgtt gaaaatctgc 480

accttcctct gcctctgctc cagtcttgga tgcaccagcc tcaccagcct cttcctcca 539

<210> 47

<211> 539

<212> DNA

<213>Milk cow (Bos taurus)

<400> 47

cccggctaga gtgggttatg agaatccttc agtgagcatt ttactcatta gtcttcatat 60

gaccccaatt tcttaaccaa accaaatgga agattttctt tctctctctt cactgaatta 120

tgttttaaaa agaggaggat aattcatcat gaataacaat tataactgga ttatggactc 180

aaagatttgt tttccttctt tccaggatga actccaggat aaaatccacc cctttgccca 240

gacacagtct ctagtctatc ccttccctgg gcccatccat aacagcctcc cacaaaacat 300

ccctcctctt actcaaaccc ctgtggtggt gccgcctttc cttcagcctg aagtaatggg 360

agtctccaaa gtgaaggagg ctatggctcc taagcacaaa gaaatgccct tccctaaata 420

tccagttgag ccctttactg aaagccagag cctgactctc actgatgttg aaaatctgca 480

ccttcctctg cctctgctcc agtcttggat gcaccagcct caccagcctc ttcctccaa 539

<210> 48

<211> 542

<212> DNA

<213>Milk cow (Bos taurus)

<400> 48

tatctgggga gagtgggtta tgagaaatcc ttcagtgagc attttactca ttagtcttca 60

tatgacccca atttcttaac caaaccaaat ggaagatttt ctttctctct cttcactgaa 120

ttatgtttta aaaagaggag gataattcat catgaataac aattataact ggattatgga 180

ctcaaagatt tgttttcctt ctttccagga tgaactccag gataaaatcc acccctttgc 240

ccagacacag tctctagtct atcccttccc tgggcccatc cataacagcc tcccacaaaa 300

catccctcct cttactcaaa cccctgtggt ggtgccgcct ttccttcagc ctgaagtaat 360

gggagtctcc aaagtgaagg aggctatggc tcctaagcac aaagaaatgc ccttccctaa 420

atatccagtt gagcccttta ctgaaagcca gagcctgact ctcactgatg ttgaaaatct 480

gcaccttcct ctgcctctgc tccagtcttg gatgcaccag cctcaccagc ctcttcctcc 540

aa 542

<210> 49

<211> 543

<212> DNA

<213>Milk cow (Bos taurus)

<400> 49

ctttggtgga gaagtgggtt aatgagaatc cttcagtgag cattttactc attagtcttc 60

atatgacccc aatttcttaa ccaaaccaaa tggaagattt tctttctctc tcttcactga 120

attatgtttt aaaaagagga ggataattca tcatgaataa caattataac tggattatgg 180

actcaaagat ttgttttcct tctttccagg atgaactcca ggataaaatc cacccctttg 240

cccagacaca gtctctagtc tatcccttcc ctgggcccat ccataacagc ctcccacaaa 300

acatccctcc tcttactcaa acccctgtgg tggtgccgcc tttccttcag cctgaagtaa 360

tgggagtctc caaagtgaag gaggctatgg ctcctaagca caaagaaatg cccttcccta 420

aatatccagt tgagcccttt actgaaagcc agagcctgac tctcactgat gttgaaaatc 480

tgcaccttcc tctgcctctg ctccagtctt ggatgcacca gcctcaccag cctcttcctc 540

caa 543

Claims

1. a kind of primer that the HRM for beta-casein gene parting is detected, which is characterized in that the primer sequence is as follows：

Upstream primer：5 '-ATC CAC CCC TTT GCC CAG AC-3 ',

Downstream primer：5'-GGG GTT TGA GTA AGA GGA GGG-3'.

2. a kind of HRM detection method of beta-casein gene parting, which is characterized in that include the following steps：

（A）Extract sample DNA；

（B）PCR amplification is carried out using primer as described in claim 1 to the sample DNA；

（C）HRM detection is carried out to pcr amplification product, data is collected, determines amplified production genotype.

3. the HRM detection method of beta-casein gene parting according to claim 2, which is characterized in that the step（B） Middle pcr amplification reaction carries out according to the following steps：

（1）95 DEG C 2 minutes；

4. the HRM detection method of beta-casein gene parting according to claim 2, which is characterized in that the step（B） Middle PCR amplification is carried out in reaction solution, wherein the reaction solution of 20 μ l is composed of the following components：

2X HRM Analysis Premix：10μl；

10 μM of upstream primer：0.6μl；

10 μM of downstream primer：0.6μl；

The DNA profiling of 50ng/ μ l：1μl；

RNase-Free ddH₂O：Polishing to 20 μ l,

5. the HRM detection method of beta-casein gene parting according to claim 4, it is characterised in that：The saturation is glimmering Photoinitiator dye is Eva Green dyestuff.

6. the HRM detection method of beta-casein gene parting according to claim 2, which is characterized in that the step（C） In to pcr amplification product carry out HRM analysis product fusion processes be：95 DEG C are kept for 10 seconds, drop to 40 DEG C of holdings 10 seconds, later It melts from 40 DEG C of heatings to 85 DEG C, melting rate is 0.05 DEG C/sec, is kept for 1 second after being warming up to 85 DEG C, is down to 40 DEG C of holdings later 30 seconds；Real time detection signal during melting from 40 DEG C of heatings to 85 DEG C, signal detection frequency is 12 times/DEG C.