CN110042149B - Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method - Google Patents
Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method Download PDFInfo
- Publication number
- CN110042149B CN110042149B CN201910326207.0A CN201910326207A CN110042149B CN 110042149 B CN110042149 B CN 110042149B CN 201910326207 A CN201910326207 A CN 201910326207A CN 110042149 B CN110042149 B CN 110042149B
- Authority
- CN
- China
- Prior art keywords
- dna
- chip
- concentration
- gene
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a three-dimensional foldable chip proximity hybridization-electrochemiluminescence gene detection method. In the aspect of a gene detection method, the invention adopts an H-type adjacent hybridization strategy, so that the cloth chip has good universality for detecting different target DNAs. The multi-walled carbon nanotube-chitosan modified cloth chip working electrode is also suitable for a paper chip, but due to the porous capillary fiber characteristics of the cloth material, the MWCNTs-CS solution can better stay on the surface of the cloth, so that good electrode surface modification is easy to operate and obtain, and the detection sensitivity is improved. In addition, before detection, the signal probe is not chemically modified to mark a luminescent group, so that the method is simple to operate, and the tedious and complicated modification process of the signal probe is avoided. The three-dimensional three-electrode cloth chip limits the working electrode on one side and limits the counter electrode and the reference electrode on the other side, thereby avoiding adverse effects on other electrodes during working electrode modification treatment.
Description
Technical Field
The invention relates to application of a microfluidic chip in gene detection, in particular to a three-dimensional foldable chip-based adjacent hybridization-electrochemiluminescence gene detection method.
Background
The traditional microfluidic chip mostly adopts materials such as silicon, glass, high polymer and the like as a substrate, but the materials of the substrate are relatively expensive. In addition, metals such as gold, platinum, and Indium Tin Oxide (ITO) are often used as chip electrode materials, and they have good conductivity, but have disadvantages such as complicated pretreatment and time-consuming. Therefore, micro-fluidic devices and screen printing electrode technologies using various fiber materials (paper, cloth, wire, etc.) as substrates have been receiving great attention from researchers. Particularly, the softness and the folding performance of the fiber material provide better development prospect for the fiber material chip. At present, many detection methods are applied to fiber material chips, such as electrochemiluminescence, electrochemistry, fluorescence analysis, colorimetric analysis and the like, wherein the electrochemiluminescence method combines the advantages of chemiluminescence and electrochemistry, becomes a powerful detection means due to the inherent characteristics of high selectivity, low background, wide detection range and the like, and is widely applied to various gene detection and immunoassay.
A three-dimensional Paper chip electrochemiluminescence protein sensor based on a rolling circle replication signal amplification strategy is disclosed in the literature (Paper-based electrochemiluminescence apparatus for using the protein detection and amplification of the amplified captured DNA-carbon dots nanoparticles on rolling circle amplification [ J ]. Biosensors and Bioelectronics,2015, 68. In the literature, quantum dots are used as an electrochemical luminescent material and are labeled at one end of a signal probe, so that the probe design is complicated. In addition, the rolling circle replication method adopted in the literature needs to convert dNTPs into single-stranded DNA under enzyme catalysis, and has strict reaction conditions, multiple reaction reagents and complex process, thereby having certain professional requirements on experimenters.
Chinese patent ZL 201510246434.4 discloses preparation of an alloy nanoparticle modified electroluminescent cell sensing paper chip. The patent compounds cells to be detected with luminescent substances PtNi @ CQDs, then specifically binds tumor cells through the screened aptamer, and the work needs to fix the aptamer on the surface of an electrode for electrochemical luminescence detection, so that the kit has good specificity and sensitivity. However, it has the disadvantage that the chip is not universal, i.e. when detecting other tumor cells, it is necessary to re-screen aptamers, re-perform chip layer-by-layer modification and self-assembly processes.
In the electrochemical luminescence gene detection method, two most common strategies are used to realize the binding of target and probe, wherein one is a "sandwich" structure formed by capture probe/target/signal probe, and the other is a one-step hybridization reaction between capture probe and target to realize gene detection. Such as the literature (Graphene functional chlorinated porous Au-paper based electrochemical detection device for detection of DNA using fluorescent nanoparticles coated calcium carbonate/carbonate nanoparticles as labels J]2014 Biosensors and bioelectronics,2014, 59) 3 /CMC@AgNP S . However, chips using paper fibers as a substrate have problems of low mechanical strength, poor wet strength, and low durability.In addition, the sandwich structure makes the luminescent group of the signal probe and the surface of the electrode spaced at a certain distance, which is not beneficial to the electron transfer process of electrochemical luminescence.
Disclosure of Invention
The invention aims to provide a gene detection method based on three-dimensional foldable chip proximity hybridization-electrochemiluminescence (PH-ECL). In the aspect of a gene detection method, an H-shaped PH strategy is adopted, so that the cloth chip has good universality for detecting different target DNAs. The multi-walled carbon nanotube-chitosan (MWCNTs-CS) is used for modifying the working electrode of the cloth chip, the modification method is also suitable for the paper chip, but the porous capillary fiber characteristic of the cloth material enables the MWCNTs-CS solution to better stay on the surface of the cloth, so that the good electrode surface modification is easy to operate and obtain, and the detection sensitivity is improved. In addition, before detection, the signal probe is not chemically modified to mark a luminescent group, so that the method is simple to operate, and the tedious and complicated modification process of the signal probe is avoided.
The purpose of the invention is realized by the following technical scheme:
a gene detection method based on a three-dimensional foldable chip comprises the following steps:
(1) Design of Probe and auxiliary DNA sequences
Selecting a characteristic segment of a tumor characteristic gene to be detected as target DNA (T-DNA);
designing sequences of a capture hairpin probe DNA (HP-DNA) and two auxiliary DNAs (H-DNA 1 and H-DNA 2);
the 4 DNA sequences satisfy the following conditions:
the 5 'end of the H-DNA1 is complementary to the 3' end of the T-DNA;
the 3 'end of the H-DNA1 is complementary to the 5' end of the HP-DNA;
the intermediate sequence of the H-DNA1 is complementary with the intermediate sequence of the H-DNA 2;
the 5 'end of H-DNA2 is complementary to the 3' end of HP-DNA;
the 3 'end of H-DNA2 is complementary to the 5' end of T-DNA;
the HP-DNA is connected with amino at the 3' end;
the number of the complementary bases of the H-DNA1 and the H-DNA2 is preferably 8bp; the PH-ECL signal intensity and background intensity are enhanced with the increase of the number of pairs of complementary bases of H-DNA1 and H-DNA2, the signal intensity increase is not obvious after 8bp, but the background signal increase is obvious.
The tumor characteristic genes, K-ras gene and p53 gene are exemplified in the invention, but this should not limit the scope of the invention, and the method of the invention is applicable to all characteristic gene segments;
(2) Formation of a pH Complex
Adding H-DNA1, H-DNA2 and a sample to be tested (possibly containing T-DNA) into a buffer solution, and incubating for several minutes to form a PH complex (PHC) if the sample to be tested contains the T-DNA;
the buffer solution is preferably TE buffer solution (pH value is 8.5);
(3) Preparation and sample loading of sensing interface before chip folding
Dripping MWCNTs-CS solution on the surface of a working electrode of the foldable three-dimensional chip, and standing for several minutes at room temperature;
dripping Glutaraldehyde (GA) solution on a working electrode of the foldable three-dimensional chip, reacting at room temperature, and washing with deionized water; then, dripping HP-DNA onto the surface of a working electrode of the modified GA, reacting for several minutes under the conditions of constant temperature and constant humidity, washing by adopting a Tris-HCl buffer solution (containing a certain amount of SDS), and airing at room temperature; finally, adding bovine serum albumin blocking buffer (BSA-BB) dropwise onto the surface of the modified HP-DNA working electrode, incubating at room temperature, and washing with PBS buffer to obtain a chip sensing interface;
the foldable three-dimensional chip can adopt a three-dimensional chip in the prior art;
for example, foldable three-dimensional chips disclosed in the literature (Paper-based electrochemical device for using the transistor detection and applying the applied cassette DNA-carbon dots nano based on rolling amplification [ J ]. Biosensors and Bioelectronics,2015,68, 413-420) (see Scheme1:2.3.Design and design of the D3 origami device specifically);
for another example, a foldable paper chip disclosed in chinese patent ZL 201510246434.4 (see the drawings of the specification, the claims and the related description of the specification);
the foldable three-dimensional chip can adopt a cloth substrate or a paper substrate, and preferably adopts the cloth substrate;
the PH-ECL signal intensity is increased along with the increase of the MWCNTs concentration, and the PH-ECL signal intensity reaches the maximum value when the concentration reaches 5 g/L; as the concentration further increased, the pH-ECL signal intensity slowly decreased. Therefore, the concentration of MWCNTs in the MWCNTs-CS solution in the method of the present invention is preferably 5g/L.
Heating the HP-DNA on a PCR instrument at 95 ℃ for 5min before use, and then gradually cooling to 4 ℃ to form a stem-loop structure;
the concentration of the HP-DNA is preferably 0.5. Mu.M; in the present invention, the intensity of the pH-ECL signal increases and then decreases with increasing HP-DNA concentration, and the background intensity does not change much.
Uniformly mixing a PHC solution and a terpyridyl ruthenium (TBR) solution with the same volume, then dropwise adding the mixture to the prepared sensing interface, incubating for a period of time at constant temperature and constant humidity, then washing with a washing buffer solution (containing Tris-HCl and Tween-20), and drying at room temperature;
the concentration of the TBR solution is preferably 1mM; as the concentration of TBR increases, the PH-ECL signal intensity increases, while the background intensity does not change much; when the concentration is more than 1mM, the pH-ECL signal intensity tends to be stable with the TBR concentration.
The incubation time is preferably 40min, since the PH-ECL signal intensity and the background intensity increase with increasing incubation time, but after 40min the signal intensity does not increase significantly, whereas the background intensity increases significantly.
(4) Sample detection after chip folding
Folding the chip along a folding line to enable the sample cell and the auxiliary cell to be overlapped to form a three-electrode structure capable of performing PH-ECL detection; then, tripropylamine (TPA) solution is dripped into the auxiliary pool, and the chip is put into a dark box after the sample Chi Zhonggong is soaked as an electrode; finally, starting a CCD automatic imaging function, and then starting a potentiostat, and if the sample to be detected contains the tumor characteristic gene to be detected, triggering a PH-ECL reaction;
as the TPA concentration increased, the PH-ECL signal intensity increased with little change in background intensity; at concentrations above 20mM, the pH-ECL intensity tends to stabilize. Therefore, to obtain the maximum signal-to-noise ratio, the concentration of the TPA solution is preferably 20mM.
Storing the luminous video acquired by the CCD in real time into a WMA format; changing the video into a JPG picture format by using VGIF software; then, the light emitting region of the working electrode was cut out using nEO imaging4.4.1 (Shenzhen Thunder Net cut co., ltd., shenzhen, china); finally the mean grey values of the pictures were measured by Matlab R2012a (MathWorks company, USA) and the imaging data were analysed using origin7.0 (Microcal Software inc., newark, USA) Software.
Electrochemiluminescence intensity = mean gray value × pixel point;
the average gray value is calculated by image analysis software;
the CCD is a portable CCD digital imaging device, is a product of Mingmei technology Limited in Guangzhou, and has the model of MC15;
the TBR, TPA and GA are dissolved in PBS buffer solution (pH value is 7.5); the CS solution is prepared by acetic acid buffer solution (pH value is 6.0); MWCNTs are dissolved in CS solution.
The basic principle of the invention is as follows:
modifying MWCNTs-CS on the surface of a working electrode, and activating the surface by GA (GA), wherein the MWCNTs can be used for improving the electron transfer speed and increasing the specific surface area, so that the detection sensitivity is improved; CS has film forming property and provides amino, the condensation reaction of the GA further modified and the amino on CS exposes a great deal of aldehyde groups on the surface of the working electrode, and the aldehyde groups are covalently combined with the amino on HP-DNA, so that the HP-DNA is fixed on the surface of the electrode to form the required sensing interface.
When T-DNA is present, the T-DNA and two auxiliary DNAs (H-DNA 1 and H-DNA 2) can undergo a hybridization reaction to generate PHC, which is then mixed with TBR appropriately and added dropwise to the surface of the working electrode so that the PHC opens the HP-DNA on the working electrode while allowing a large amount of TBR to be inserted into the DNA double strand. After the chip is folded, a coreactant TPA is added, and then a potentiostat is used for supplying power to trigger the PH-ECL.
By PH is meant that a pair of affinity probes simultaneously and adjacently recognizes and binds to a target molecule such that the tails of the pair of affinity probes also hybridize adjacent to each other to form a "T" type structure. Compared with the traditional sandwich structure, the method can ensure that the marked groups are sufficiently close to the electrodes, the electron transfer efficiency is improved, and the detection sensitivity is further improved. In the present patent application, the "T" type PHC is combined with HP-DNA on the working electrode to form an "H" type structure, and the "H" type contains more double-stranded DNA so as to cause more TBR insertion, thereby improving the reaction sensitivity. Meanwhile, the method has wide detection range and high selectivity, and can identify single-base or double-base mutation.
Compared with the prior art, the invention has the following advantages and effects:
(1) Compared with other chip substrate materials (such as silicon, glass, high polymer and the like), the chip processed by the cloth substrate is applied to gene detection, and the DNA sensor which is cheap, simple and convenient and has strong operability is developed.
(2) Compared with a two-dimensional three-electrode cloth chip, the three-dimensional three-electrode cloth chip limits the working electrode on one side and limits the counter electrode and the reference electrode on the other side, thereby avoiding adverse effects on other two electrodes during modification or treatment of the working electrode, and simultaneously avoiding the modification solution from overflowing to a reaction tank to pollute the reaction tank.
(3) The DNA sensor is based on label-free electrochemiluminescence, so that a long and complicated signal probe labeling process is avoided, and adverse effects of solution physical and chemical factors (such as pH, temperature and the like) on DNA molecules in the labeling process are also avoided.
(4) Compared with other gene sensing methods, the PH-ECL method has the advantages that: the fluorescent probe not only can enable the luminescent group to be close to the electrode to the maximum extent so as to improve the detection sensitivity and selectivity, but also has the potential of being applied to protein detection.
(5) The gene chip developed by the invention has good universality, and the problem that the chip needs to be re-modified when different target sequences are detected is avoided, so that the problem of waste of chip materials is effectively solved, and the gene chip has the advantages of high resource utilization rate, low cost and the like.
(6) Compared with other expensive and complex optical imaging systems, the invention adopts simple CCD equipment for imaging detection; and the signal amplification strategy of the carbon nano tube is combined, so that the DNA detection sensitivity of the electrochemiluminescence of the cloth chip is greatly improved.
Drawings
FIG. 1 shows the shape of a reaction cell of the present invention, wherein 1 is a sample cell, 2 is an auxiliary cell, and 3 is a folding line.
FIG. 2 is an electrode configuration of the present invention, wherein 1 is a working electrode, 2 is a reference electrode, and 3 is a counter electrode.
FIG. 3 is a diagram of an array object after a chip is processed by screen printing according to the method of the present invention.
FIG. 4 is a schematic representation of the proximity hybridization of T-DNA to two pieces of H-DNA in the method of the present invention.
FIG. 5 is a schematic illustration of the preparation and loading of the sensing interface prior to chip folding in the method of the present invention.
Figure 6 is a schematic view of a two-dimensional web chip shape (including the outside and inside of the chip) and its folds according to the present invention.
FIG. 7 is a graph showing the relationship between the intensity of electrochemiluminescence and the number of pairs of complementary bases of H-DNA1 and H-DNA2 in the method of the present invention.
FIG. 8 is a graph showing the relationship between the intensity of electrochemiluminescence and the concentration of HP-DNA in the method of the present invention.
FIG. 9 is a graph of electrochemiluminescence intensity versus incubation time in a method of the invention.
FIG. 10 is a graph of electrochemiluminescence intensity as a function of TBR concentration in the method of the present invention.
FIG. 11 is a graph of electrochemiluminescence intensity as a function of TPA concentration in a process of the invention.
FIG. 12 is a graph of electrochemiluminescence intensity as a function of scan rate in a method of the invention.
FIG. 13 is a graph of the electrochemiluminescence intensity as a function of MWCNTs concentration in the method of the present invention.
FIG. 14 is a graph showing the relationship between the intensity of electrochemiluminescence and the concentration of T-DNA in the method of the present invention.
FIG. 15 is a pH-ECL selectivity evaluation of cloth chips in the method of the present invention.
FIG. 16 is a pH-ECL commonality assessment of cloth chips in the method of the invention.
FIG. 17 is a graph comparing pH-ECL luminescence under the same conditions for cloth chips and paper chips in the method of the present invention.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
Example 1
The preparation of the foldable three-dimensional cloth chip comprises the following steps:
(1) Three-dimensional cloth chip design and processing
Designing the shape of a reaction cell and an electrode by using drawing software Adobe Illustrator CS 5; the reaction cell is shaped as shown in FIG. 1, and comprises a sample cell 1 (diameter 6.5 mm) and an auxiliary cell 2 (diameter 14 mm), and a folding line 3 with the width of 1mm is designed between the two cells;
the electrode shape is shown in fig. 2, and the electrode is a three-electrode including a working electrode (circular) 1, a counter electrode 3, and a reference electrode (partially annular) 2.
Processing and manufacturing a corresponding 200-mesh nylon screen plate (namely a reaction tank screen plate and an electrode screen plate) according to the design shape; pressing an electrode screen (containing 4 rows and 2 columns of electrode patterns) on a cloth (150 mm multiplied by 150 mm), and screen-printing carbon slurry on the screen; then the cloth piece and the screen plate are separated and put into a 90 ℃ oven for drying for 30min. Then, the reaction Chi Wangban (containing 4 rows and 2 columns of reaction cell patterns) is pressed on the back of the cloth piece printed with the electrode, the screen plate and the cloth piece are tightly attached, wax is coated on the screen plate of the reaction cell by a pink wax crayon, and the screen plate is uniformly milled by a smooth milling spoon. The web and the cloth piece were then placed together on a hot plate and heated at 90 c for about 3 seconds, and then the cloth piece was removed from the reaction cell web and cooled to room temperature, thereby producing a cloth chip array (fig. 3).
Example 2
The application of the foldable three-dimensional cloth chip PH-ECL in the detection of K-ras gene comprises the following steps:
(1) Design of desired DNA sequence
The DNA sequence was designed as follows (5 '-3'):
T-DNA agttggagctggtggcgtaggc (SEQ ID NO. 1); the total length of the K-ras gene is about 35kb, and the T-DNA sequence contains a most common mutation site, a 12 th codon GGT;
HP-DNA:cggagacataacaatagatccg(SEQ ID NO.2)-(CH 2 ) 6 -NH 2 ；
H-DNA1:gcctacgccaccaggatgagtgtgttatgtc(SEQ ID NO.3)；
H-DNA2:cggatctatcactcatcgtccaact(SEQ ID NO.4)。
(2) PH reaction process of T-DNA
Adjacent hybridization schematic As shown in FIG. 4, 10. Mu. L H-DNA1 and H-DNA2 (10. Mu.M each) were mixed with different concentrations of T-DNA; then TE buffer was added to a total volume of 100. Mu.L; finally, the reaction was incubated at 37 ℃ for 30min, whereby a pH complex (PHC) was formed.
(3) Preparation and sample loading of sensing interface before chip folding
From the cloth chip array of example 1, 8 individual cloth chips were cut out as appropriate, and then, as shown in fig. 5, the processing for each cloth chip was as follows: dripping 2.5 mu L MWCNTs-CS solution on the surface of the working electrode, and standing for 30min at room temperature; dripping 2 μ L of 2.5% GA solution on a working electrode, reacting at room temperature for 60min, and washing with deionized water for 3 times; then, 5. Mu.L of HP-DNA (0.5. Mu.M) was dropped onto the surface of the working electrode of the modified GA, reacted at 37 ℃ for 30min under constant temperature and humidity, washed three times with Tris-HCl buffer (10 mM) (containing 1% SDS), and air-dried at room temperature; finally, 2. Mu.L of BSA-BB (0.1%) was dropped onto the surface of the modified HP-DNA working electrode, incubated at room temperature for 30min, and then washed three times with PBS buffer to prepare a cloth-chip sensing interface.
After a certain volume of PHC solution and TBR (2 mM) solution with the same volume are uniformly mixed, 5 mu L of PHC solution is dripped on the prepared sensing interface, the mixture is incubated for 40min at the constant temperature and humidity of 37 ℃, then the mixture is washed three times by washing buffer solution (containing 50mM Tris-HCl and 0.02% Tween-20) and dried at room temperature.
(4) Sample detection after chip folding
As shown in fig. 6, the two-dimensional cloth chip is folded along the folding line to form a three-dimensional cloth chip, and the sample cell and the auxiliary cell are overlapped to form a three-electrode structure capable of performing PH-ECL detection; then, 40 mu of LTPA solution (20 mM) is dripped into the auxiliary pool, and the chip is placed into a dark box after the sample Chi Zhonggong is taken as an electrode for soaking; and finally, starting a CCD automatic imaging function, and then starting a potentiostat to scan and supply power (the potential and the scanning rate are 0-2V and 60mV/s respectively) by a cyclic voltammetry method to trigger the PH-ECL reaction.
Example 3
Several important factors (H-DNA 1 and H-DNA2 complementary base pair number, HP-DNA concentration, incubation time, TBR concentration, TPA concentration, scanning rate and MWCNTs concentration) affecting the pH-ECL gene sensing luminescence intensity of the three-dimensional cloth chip in example 2 were optimized:
a) Preferably H-DNA1 and H-DNA2 complementary base pairs
1. The concentration of the T-DNA (K-ras gene fragment) to be tested is 25pM, the number of complementary base pairs of H-DNA1 and H-DNA2 is determined, the concentration of HP-DNA is 0.4 mu M, the incubation time is 40min, the concentration of TBR is 1mM, the concentration of TPA is 20mM, the scanning speed is 100mV s -1 MWCNTs concentration 5g L -1 。
2. Several experimental groups were set up: the number of pairs of complementary bases of H-DNA1 and H-DNA2 is set to several different values (5 bp, 6bp, 7bp, 8bp, 9 bp).
3. The procedure and other materials were the same as in example 2, and the test results are shown in fig. 7.
From the experimental results it can be seen that: the PH-ECL signal intensity and background intensity are enhanced with the increase of the number of pairs of complementary bases of H-DNA1 and H-DNA2, the signal intensity increase is not obvious after 8bp, but the background signal increase is obvious. The reason for this may be that H-DNA1 and H-DNA2 hybridize above 8bp in the absence of T-DNA so that HP-DNA is turned on at the working electrode. In order to obtain the maximum signal-to-noise ratio, the number of complementary base pairs of H-DNA1 and H-DNA2 in the method of the invention is preferably 8bp.
b) Preferred HP-DNA concentration
1. The concentration of T-DNA (K-ras gene fragment) to be tested is 25pM, the number of complementary basic groups of H-DNA1 and H-DNA2 is 8bp, the concentration of HP-DNA is undetermined, the incubation time is 40min, the concentration of TBR is 1mM, the concentration of TPA is concentratedDegree 20mM, scan rate 100mV s -1 MWCNTs concentration 5g L -1 。
2. Several experimental groups were set up: HP-DNA concentration was set to several different values (0.2. Mu.M, 0.4. Mu.M, 0.5. Mu.M, 0.6. Mu.M, 0.8. Mu.M).
3. Procedure and other materials were the same as in example 2, and the test results are shown in fig. 8.
From the experimental results it can be seen that: the PH-ECL signal intensity increases and then decreases with increasing HP-DNA concentration, and the background intensity does not change much. This may be due to steric hindrance of the high density of HP-DNA immobilized on the surface of the working electrode, preventing more PHC from hybridizing to HP-DNA. Based on this fact, the method of the present invention uses 0.5. Mu.M for the optimum concentration of HP-DNA.
c) Preferred incubation time
1. The concentration of T-DNA (K-ras gene fragment) to be tested is 25pM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the concentration of HP-DNA is 0.5 mu M, the incubation time is undetermined, the concentration of TBR is 1mM, the concentration of TPA is 20mM, the scanning speed is 100mV s -1 MWCNTs concentration 5g L -1 。
2. Several experimental groups were set up: the incubation time was set at several different values (10 min, 20min, 30min, 40min, 50 min).
3. Procedure and other materials were the same as in example 2, and the test results are shown in fig. 9.
From the experimental results it can be seen that: the PH-ECL signal intensity and background intensity increased with increasing incubation time, but the signal intensity did not increase significantly after 40min, while the background intensity increased significantly. This may be caused by the fact that negatively charged BSA on the electrode surface electrostatically adsorbs positively charged TBR that is not inserted into PHC, and thus the excess TBR is difficult to wash out. Therefore, the method of the invention preferably has an incubation time of 40min.
d) TBR concentration is preferred
1. The concentration of T-DNA (K-ras gene fragment) to be detected is 25pM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the concentration of HP-DNA is 0.5 mu M, the incubation time is 40min, the concentration of TBR is undetermined, the concentration of TPA is 20mM, the scanning rate is 100mV s -1 Concentration of MWCNTsDegree 5g L -1 。
2. Several experimental groups were set up: TBR concentration was set at several different values (0.6 mM, 0.8mM, 0.9mM, 1mM, 1.1mM, 1.2 mM).
3. The procedure and other materials were the same as in example 2, and the test results are shown in fig. 10.
From the experimental results it can be seen that: as the TBR concentration increases, the PH-ECL signal intensity increases with little change in background intensity; when the concentration is more than 1mM, the pH-ECL signal intensity tends to be stable with the TBR concentration. Therefore, the TBR concentration in the method of the present invention is preferably 1mM.
e) Preferred TPA concentration
1. The concentration of T-DNA (K-ras gene fragment) to be detected is 25pM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the concentration of HP-DNA is 0.5 mu M, the incubation time is 40min, the concentration of TBR is 1mM, the concentration of TPA is undetermined, the scanning rate is 100mV s -1 MWCNTs concentration 5g L -1 。
2. Several experimental groups were set up: TPA concentrations were set at several different values (10 mM, 15mM, 18mM, 20mM, 22mM, 25mM, 30 mM).
3. The procedure and other materials were the same as in example 2, and the test results are shown in fig. 11.
From the experimental results it can be seen that: as the TPA concentration increased, the PH-ECL signal intensity increased with little change in background intensity; at concentrations above 20mM, the pH-ECL intensity tends to stabilize. Therefore, to obtain the maximum signal-to-noise ratio, the TPA concentration is preferably 20mM.
f) Preferred scan rate
1. The concentration of T-DNA (K-ras gene fragment) to be detected is 25pM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the concentration of HP-DNA is 0.5 mu M, the incubation time is 40min, the concentration of TBR is 1mM, the concentration of TPA is 20mM, the scanning rate is undetermined, the concentration of MWCNTs is 5g L -1 。
2. Several experimental groups were set up: the scan rate was set to several different values (10 mV s) -1 、30mV s -1 、40mV s -1 、50mV s -1 、60mV s -1 、70mV s -1 、80mV s -1 、100mV s -1 )。
3. The procedure and other materials were the same as in example 2, and the test results are shown in fig. 12.
From the experimental results it can be seen that: when the scanning rate is from 10mV s -1 Increase to 60mV s -1 Then, the PH-ECL signal intensity is increased; when the scanning rate is further changed to 100mV s -1 The pH-ECL signal intensity gradually decreased. Therefore, the scanning rate is preferably 60mV s -1 。
g) Preferred MWCNTs concentration
1. The concentration of T-DNA (K-ras gene fragment) to be detected is 10fM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the concentration of HP-DNA is 0.5 mu M, the incubation time is 40min, the concentration of TBR is 1mM, the concentration of TPA is 20mM, the scanning speed is 60mV s -1 The MWCNTs concentration was undetermined.
2. Several experimental groups were set up: the MWCNTs concentration was set at several different values (0 g/L, 3g/L, 4g/L, 5g/L, 6g/L, 7 g/L).
3. Procedure and other materials were the same as in example 2, and the test results are shown in fig. 13.
From the experimental results it can be seen that: the PH-ECL signal intensity is increased along with the increase of the MWCNTs concentration, and the PH-ECL signal intensity reaches the maximum value when the concentration reaches 5 g/L; as the concentration further increased, the pH-ECL signal intensity slowly decreased. A possible reason for this is that high concentrations of MWCNTs agglomerate, which impedes surface electron transfer of MWCNTs, thereby reducing the pH-ECL signal. Therefore, the MWCNTs concentration in the process of the present invention is preferably 5g/L.
Example 4
The chip pH-ECL assay for T-DNA (K-ras gene fragment) was performed under a few optimized conditions as outlined in example 3:
1. using the optimized parameters of example 3: 8bp of complementary base pair of H-DNA1 and H-DNA2, HP-DNA concentration of 0.5. Mu.M, incubation time of 40min, TBR concentration of 1mM, TPA concentration of 20mM, scan rate of 60mV s -1 MWCNTs concentration 5g L -1 。
2. Several experimental groups were set up: the concentration of the test T-DNA was set to several different values (2.5 nM, 50pM, 5pM, 0.5pM, 50fM, 10fM, 1 fM).
3. The procedure and other materials were the same as in example 2, and the measurement results are shown in FIG. 14.
From the experimental results it can be seen that: the pH-ECL signal intensity increases with increasing T-DNA concentration. The ECL intensity (expressed by Y) and the logarithm of the T-DNA concentration (expressed by X) have a certain linear relation, the linear equation can be expressed as Y =3.641X +17.182, and the correlation coefficient R 2 =0.994. The detection limit adopts a calculation method as follows: XL = Xb +3Sb, where Xb is the signal intensity at blank and Sb is the standard deviation of the blank (5 replicates); and obtaining the detection limit according to the T-DNA concentration corresponding to the obtained XL value. The detection limit of the method is 0.35fM.
Example 5
The cloth-chip pH-ECL selectivity experiments were performed under a few optimized conditions as outlined in example 3:
1. using the optimized parameters of example 3: the target sequence concentration is 5pM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the HP-DNA concentration is 0.5 mu M, the incubation time is 40min, the TBR concentration is 1mM, the TPA concentration is 20mM, and the scanning speed is 60mV s -1 MWCNTs concentration 5g L -1 。
2. Several mutation experimental groups of T-DNA were set up: complete complementary group (T-DNA), single base mutant group G12A (G at position 12 is mutated into A), single base mutation group G12T (G at position 12 is mutated into T), a two-base mutation group, a four-base mutation group, an arbitrary sequence group and a blank control.
3. The procedure and other materials were the same as in example 2, and the measurement results are shown in FIG. 15.
From the experimental results it can be seen that: compared with the complete complementary condition, the ECL intensity is obviously reduced under the two groups of single base mutation conditions. The two-base mutation resulted in an ECL intensity higher than that of the blank control group, but lower than that of the single-base mutation. The PH-ECL intensities of the four-base mutation group and the arbitrary sequence group were not greatly different from those of the blank control. Therefore, the method can realize good detection of single base and two base mutation of T-DNA.
Example 6
A chip-layout PH-ECL general experiment was performed under the optimized conditions found in example 3, using p53 gene fragment as the target sequence and redesigning the H-DNA1 and H-DNA2 sequences (for the sake of distinction, the new sequences are designated H-DNAa and H-DNAb):
1. using the parameters optimized in example 3, the complementary base pair numbers of H-DNAa and H-DNAb were 8bp, the HP-DNA concentration was 0.5. Mu.M, the incubation time was 40min, the TBR concentration was 1mM, the TPA concentration was 20mM, and the scan rate was 60mV s -1 MWCNTs concentration 5g L -1 。
2. Several experimental groups were set up: the concentration of the p53 gene to be tested was set to several different values (0 pM, 0.05pM, 5 pM).
3. Procedure and other materials were the same as in example 2, and the measurement results are shown in fig. 16.
The redesigned DNA sequence was as follows (5 '-3'):
T-DNA: ccaggacaggcacaaacacgcacctc (SEQ ID NO. 5); the p53 gene has a total length of about 20kb, and the T-DNA sequence contains the most common mutation site, namely, codon 273 ACG;
H-DNAa：gaggtgcgtgtttgtgcggatgagtgtgttatgtc(SEQ ID NO.6)；
H-DNAb：cggatctatcactcatcggtcctgg(SEQ ID NO.7)；
from the experimental results it can be seen that: ECL intensity increased with increasing p53 gene concentration. For the detection of different target sequences, the method only needs to redesign a pair of H-DNA sequences, and the complementary parts of the two H-DNAs and the HP-DNA do not need to be changed, so that the HP-DNA does not need to be redesigned, and the preparation of a chip distribution sensing interface is not needed. Therefore, the method has good universality.
Example 7
The PH-ECL comparative experiments of cloth and paper chips were carried out under a few optimized conditions as found in example 3:
1. using the optimized parameters of example 3: the target sequence concentration is 5pM, the complementary base pair number of H-DNA1 and H-DNA2 is 8bp, the HP-DNA concentration is 0.5 mu.M, the incubation time is 40min, the TBR concentration is 1mM, the TPA concentration is 20mM, and the scanning speed is 60mV s -1 MWCNTs concentration 5g L -1 。
2. Setting a cloth chip and a paper chip control experiment group: and respectively manufacturing a paper chip sensing interface and a cloth chip sensing interface, and detecting the T-DNA under the same condition. The paper chip adopts Whatman No.1 chromatography paper as a substrate material.
3. Procedure and other materials were the same as in example 2, and the measurement results are shown in fig. 17.
From the experimental results it can be seen that: the method is also suitable for paper substrates, but compared with the paper fiber materials with poor wet strength and poor durability, the cloth fiber materials with regular porous capillary fiber structures and good wet strength can better attach the nano materials and show better luminescence performance. Therefore, the method of the invention adopts the cloth fiber as the substrate material of the chip.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> university of south China
<120> three-dimensional foldable chip adjacent hybridization-electrochemical luminescence gene detection method
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> T-DNA
<400> 1
agttggagct ggtggcgtag gc 22
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> HP-DNA
<400> 2
cggagacata acaatagatc cg 22
<210> 3
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> H-DNA1
<400> 3
gcctacgcca ccaggatgag tgtgttatgt c 31
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> H-DNA2
<400> 4
cggatctatc actcatcgtc caact 25
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> T-DNA
<400> 5
ccaggacagg cacaaacacg cacctc 26
<210> 6
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> H-DNAa
<400> 6
gaggtgcgtg tttgtgcgga tgagtgtgtt atgtc 35
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> H-DNAb
<400> 7
cggatctatc actcatcggt cctgg 25
Claims (10)
1. A gene detection method for non-disease diagnosis or treatment purposes based on a three-dimensional foldable chip is characterized by comprising the following steps:
(1) Design of Probe and auxiliary DNA sequences
Selecting a characteristic fragment of a tumor characteristic gene to be detected as target DNA (T-DNA) aiming at the characteristic gene;
designing sequences of a capture hairpin probe DNA, namely HP-DNA, and two auxiliary DNAs, namely H-DNA1 and H-DNA 2;
the 4 DNA sequences satisfy the following conditions:
the 5 'end of the H-DNA1 is complementary to the 3' end of the T-DNA;
the 3 'end of the H-DNA1 is complementary to the 5' end of the HP-DNA;
the intermediate sequence of the H-DNA1 is complementary with the intermediate sequence of the H-DNA 2;
the 5 'end of H-DNA2 is complementary to the 3' end of HP-DNA;
the 3 'end of H-DNA2 is complementary to the 5' end of T-DNA;
the HP-DNA is connected with amino at the 3' end;
(2) Formation of a pH Complex
Adding H-DNA1, H-DNA2 and a sample to be detected into a buffer solution, and incubating for several minutes, wherein if the sample to be detected contains T-DNA, a PH compound is formed;
(3) Preparation and sample loading of sensing interface before chip folding
Dripping a multi-walled carbon nanotube-chitosan (MWCNTs-CS) solution on the surface of a working electrode of the foldable three-dimensional chip, and standing for several minutes at room temperature;
dripping a glutaraldehyde solution on a working electrode of the foldable three-dimensional chip, reacting at room temperature, and washing with deionized water; then, dripping HP-DNA onto the surface of a working electrode of the modified GA, reacting for several minutes under the conditions of constant temperature and constant humidity, washing by adopting a Tris-HCl buffer solution, and airing at room temperature; finally, dropwise adding a bovine serum albumin blocking buffer solution onto the surface of the modified HP-DNA working electrode, incubating at room temperature, and washing with a PBS buffer solution to obtain a chip sensing interface;
uniformly mixing a PH compound solution with the same volume with a terpyridyl ruthenium solution, then dropwise adding the mixed solution to the prepared sensing interface, incubating at constant temperature and constant humidity, washing with a washing buffer solution, and drying at room temperature;
(4) Sample detection after chip folding
Folding the foldable three-dimensional chip along a folding line, and overlapping the sample cell and the auxiliary cell to form a three-electrode structure capable of performing PH-ECL detection; then, a tripropylamine solution is dripped into the auxiliary pool, and the chip is placed into a dark box after the sample Chi Zhonggong is soaked as an electrode; and finally, starting a CCD automatic imaging function, and then starting a potentiostat, wherein if the sample to be detected contains the tumor characteristic gene to be detected, the PH-ECL reaction is triggered.
2. The gene detection method according to claim 1, characterized in that: the number of complementary base pairs of the H-DNA1 and the H-DNA2 in the step (1) is 8bp.
3. The method for detecting a gene according to claim 1, wherein: the tumor characteristic genes in the step (1) comprise K-ras genes and p53 genes.
4. The method for detecting a gene according to claim 1, wherein: and (4) the foldable three-dimensional chip in the step (3) is a cloth substrate.
5. The gene detection method according to claim 1, characterized in that: in the step (3), the concentration of the multi-wall carbon nanotubes (MWCNTs) in the multi-wall carbon nanotube-chitosan solution is 5g/L.
6. The gene detection method according to claim 1, characterized in that: in step (3), the concentration of the HP-DNA is 0.5. Mu.M.
7. The gene detection method according to claim 1, characterized in that: in the step (3), the concentration of the terpyridyl ruthenium solution is 1mM.
8. The gene detection method according to claim 1, characterized in that: in the step (3), the incubation is carried out for 40min.
9. The gene detection method according to claim 1, characterized in that: in the step (4), the concentration of the tripropylamine solution is 20mM.
10. The gene detection method according to claim 1, characterized in that: in the step (4), storing the luminous video acquired by the CCD in real time into a WMA format; changing the video into a JPG picture format by using VGIF software; then, the working electrode light-emitting area was cut out using the nEO iMAGING 4.4.1; finally, the average grey value of the picture is measured by Matlab R2012a and the imaging data is analyzed and processed by using Origin7.0 software.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910326207.0A CN110042149B (en) | 2019-04-23 | 2019-04-23 | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910326207.0A CN110042149B (en) | 2019-04-23 | 2019-04-23 | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110042149A CN110042149A (en) | 2019-07-23 |
| CN110042149B true CN110042149B (en) | 2022-12-13 |
Family
ID=67278573
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910326207.0A Active CN110042149B (en) | 2019-04-23 | 2019-04-23 | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110042149B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111830107A (en) * | 2020-07-13 | 2020-10-27 | 济南大学 | Method for detecting prostate specific antigen based on enzyme biofuel cell |
| CN113151403B (en) * | 2021-04-06 | 2023-06-16 | 中国科学技术大学 | DNA and methylation level detection kit, preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004850A (en) * | 2014-06-11 | 2014-08-27 | 华南师范大学 | Paper-based micro-fluidic chip enhancement type chemiluminescence gene sensing method |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
-
2019
- 2019-04-23 CN CN201910326207.0A patent/CN110042149B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004850A (en) * | 2014-06-11 | 2014-08-27 | 华南师范大学 | Paper-based micro-fluidic chip enhancement type chemiluminescence gene sensing method |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
Non-Patent Citations (3)
| Title |
|---|
| Amplified electrochemiluminescence detection of nucleic acids by hairpin probe-based isothermal amplification;Xiaoming Zhou 等;《The Royal Society of Chemistry》;20120626;全文 * |
| Recent advances in electrochemiluminescence;Zhongyuan Liu 等;《Chemical Society Reviews》;20151231;全文 * |
| 电化学发光PCR技术检测转基因植物;刘晋峰等;《生物化学与生物物理进展》;20041231;第31卷(第4期);375-378 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110042149A (en) | 2019-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Labuda et al. | Electrochemical nucleic acid-based biosensors: Concepts, terms, and methodology (IUPAC Technical Report) | |
| Bertoncello et al. | Analytical applications of nanomaterials in electrogenerated chemiluminescence | |
| TWI336782B (en) | Composite modified electrode trip | |
| CN110042149B (en) | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method | |
| CN104004850B (en) | A kind of paper substrate micro-fluidic chip enhanced chemical bioluminescence gene method for sensing | |
| Gao et al. | Graphene oxide directed in-situ deposition of electroactive silver nanoparticles and its electrochemical sensing application for DNA analysis | |
| Guo et al. | Imaging analysis based on electrogenerated chemiluminescence | |
| Liu et al. | Dual-ratiometric aptasensor for streptomycin detection based on the in-situ coupling of photoelectrochemical and electrochemical assay with a bifunctional probe of methylene blue | |
| Huang et al. | Voltammetric determination of attomolar levels of a sequence derived from the genom of hepatitis B virus by using molecular beacon mediated circular strand displacement and rolling circle amplification | |
| CN103175873B (en) | Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal | |
| CN106442479B (en) | The method that paper base bipolar electrode electrochemical luminescence molecular switch system is used for rapid sensitive genetic test pathogenic bacteria | |
| Su et al. | A three-dimensional cloth-based microfluidic label-free proximity hybridization-electrochemiluminescence biosensor for ultrasensitive detection of K-ras gene | |
| CN102262122A (en) | Single-wall carbon nano tube-based ultrasensitive deoxyribonucleic acid (DNA) biosensor and preparation method and application thereof | |
| CN106442690A (en) | ECL detection method of unlabeled DNA based on porphyrin and DNA double helix groove mosaicism action | |
| Wang et al. | Label-free bifunctional electrochemiluminescence aptasensor for detection of adenosine and lysozyme | |
| Song et al. | Electrochemical immunoassay for CD10 antigen using scanning electrochemical microscopy | |
| Li et al. | Proximity hybridization-regulated electrochemical stripping of silver nanoparticles via nanogold induced deposition for immunoassay | |
| Hasoň et al. | Label-free electrochemical analysis of purine nucleotides and nucleobases at disposable carbon electrodes in microliter volumes | |
| Niu et al. | Sensitive DNA biosensor improved by Luteolin copper (II) as indicator based on silver nanoparticles and carbon nanotubes modified electrode | |
| Li et al. | Label-free electrogenerated chemiluminescence biosensing method for trace bleomycin detection based on a Ru (phen) 32+–hairpin DNA composite film electrode | |
| CN105334253A (en) | Method of testing PML/RAR alpha genes through electrochemical biosensor of carbon dot @ graphene oxide composite material | |
| Marquette et al. | Conducting elastomer surface texturing: a path to electrode spotting: Application to the biochip production | |
| Pividori et al. | Graphite-epoxy platforms for electrochemical genosensing | |
| Cheng et al. | Novel sandwich-type electrochemiluminescence aptasensor based on luminol functionalized aptamer as signal probe for kanamycin detection | |
| CN110542714A (en) | preparation of DNA walker and application of DNA walker in sensing analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |