CN110042149A - A kind of foldable chip of three-dimensional is adjacent to hybridization-electrochemiluminescgene gene detection method - Google Patents
A kind of foldable chip of three-dimensional is adjacent to hybridization-electrochemiluminescgene gene detection method Download PDFInfo
- Publication number
- CN110042149A CN110042149A CN201910326207.0A CN201910326207A CN110042149A CN 110042149 A CN110042149 A CN 110042149A CN 201910326207 A CN201910326207 A CN 201910326207A CN 110042149 A CN110042149 A CN 110042149A
- Authority
- CN
- China
- Prior art keywords
- dna
- chip
- concentration
- gene
- dna1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of foldable chips of three-dimensional adjacent to hybridization-electrochemiluminescgene gene detection method.On gene tester, the present invention, adjacent to Hybridization Strategy, makes the cloth chip have the good versatility for detecting different target DNAs using " H " type.Use the chitosan-modified cloth chip working electrode of multi-walled carbon nanotube-, method of modifying is equally applicable to paper chip, but the porous capillary fiber properties of cloth material rest on MWCNTs-CS solution preferably on cloth surface, therefore good electrode face finish is easily operated, obtains, to improve detection sensitivity.In addition, before detection, signal probe marks luminophore without chemical modification, because the method is easy to operate, the modification of the tediously long complexity of signal probe is avoided.Working electrode is limited in side by three electrode cloth chip of three-dimensional of the invention, will be limited in the other side to electrode and reference electrode, and be avoided adversely affecting other electrodes when working electrode moditied processing.
Description
Technical field
The application that the present invention relates to micro-fluidic chips in genetic test, and in particular to one kind is based on three-dimensional foldable chip
Neighbouring hybridization-electrochemiluminescgene gene detection method.
Background technique
Traditional microfluidic chip mostly uses the materials such as silicon, glass, high polymer as substrate, but these substrate material prices
It is relatively expensive.In addition, the metals such as gold, platinum, tin indium oxide (ITO) are often used as chip electrode material, their good conductivities, still
Have the shortcomings that pre-processing is complicated, time-consuming.Therefore, various Fiber Materials (paper, cloth, line etc.) be substrate micro fluidic device with
And screen printing electrode technology is gradually by the very big concern of researchers.In particular, the flexibility of Fiber Materials, foldability
Better development prospect can be provided for Fiber Materials chip.Currently, being applied to Fiber Materials chip there are many detection method
On, such as electrochemical luminescence, electrochemistry, fluorescence analysis, colorimetric analysis, wherein electrochemical luminescence method combine chemiluminescence and
The advantages of electrochemistry, becomes strong detection means because of the inherent feature such as its highly selective, low background and wide detection range,
It is widely used in various genetic tests and immunoassay.
Document (Paper-based electrochemiluminescence origami device for pertein
detection using assembled cascade DNA-carbon dots nanotags based on rolling
Circle amplificationg [J] .Biosensors and Bioelectronics, 2015,68:413-420) it discloses
A kind of three-dimensional paper chip electrochemical luminescence albumen sensor based on rolling-circle replication signal amplification strategy.Made in document with quantum dot
For electrochemical luminescence substance, marked in one end of signal probe, therefore probe complicated design.In addition, being used in document
Rolling circle replication methods need that dNTPs is enzymatically transformed into single stranded DNA, reaction condition is stringent, and reaction reagent is various
And process is complicated, therefore has certain profession to require experimenter.
Chinese patent ZL 201510246434.4 discloses a kind of electroluminescent cell sensing of alloy nano particle modification
The preparation of paper chip.The patent is compound by cell to be measured and luminescent substance PtNi@CQDs, and then the aptamers by screening are special
Property combination tumour cell, which need to carry out at the electrode surface electrochemical luminescence detection for aptamers fixation, have good
Specificity and sensitivity.However, its shortcoming is that chip does not have versatility, namely when detecting other tumour cells, needs
Again aptamers are screened, chip is re-started and modifies layer by layer and self assembling process.
Electrochemical luminescence detects in the method for gene, has the most common strategy of two classes to be used to realize the combination of target and probe,
One type is that capture probe/target/signal probe is formed by " sandwich " structure, and another kind of is between capture probe and target
A step hybridization reaction realize genetic test.Such as document (Graphene functionalized porous Au-paper
based electrochemiluminescence device for detection of DNA using luminescent
silver nanoparticles coated calcium carbonate/carboxymethyl chitosan hybrid
microspheres as labels[J].2014 Biosensors and Bioelectronics,2014,59:307-313)
A kind of three-dimensional paper chip electrochemical luminescence sensor for being based on " sandwich " structure detection gene is disclosed, wherein signal probe mark
Remember luminescent substance CaCO3/CMC@AgNPS.But using paper fiber as the chip of substrate there are mechanical strengths it is low, wet it is strong it is poor, intolerant to
The problems such as using.In addition, " sandwich " structure makes the luminophore of signal probe spaced apart with electrode surface, it is unfavorable for
The electronic transfer process of electrochemical luminescence.
Summary of the invention
The purpose of the present invention is to provide one kind based on three-dimensional foldable chip adjacent to hybridization-electrochemical luminescence (PH-ECL)
Gene tester.On gene tester, using " H " type PH strategy, there is the cloth chip and detect different target DNAs
Good versatility.Cloth chip working electrode is modified using multi-walled carbon nanotube-chitosan (MWCNTs-CS), method of modifying is same
Porous capillary fiber properties suitable for paper chip, but cloth material allow MWCNTs-CS solution preferably to rest on cloth table
On face, therefore good electrode face finish is easily operated, obtains, to improve detection sensitivity.In addition, before detection, letter
Number probe marks luminophore without chemical modification, and because the method is easy to operate, it is tediously long complicated to avoid signal probe
Modification.
The purpose of the invention is achieved by the following technical solution:
A kind of gene tester based on three-dimensional foldable chip, comprising the following steps:
(1) design probe and auxiliary DNA sequence dna
For the tumoral character gene to be detected, its characteristic fragment is chosen as target DNA (T-DNA)；
The sequence of design capture hairpin probe DNA (HP-DNA) and two auxiliary DNA (H-DNA1, H-DNA2)；
Above-mentioned 4 DNA sequence dnas need to meet the following conditions:
5 ' the ends of H-DNA1 are complementary with the 3 ' ends of T-DNA；
3 ' the ends of H-DNA1 are complementary with the 5 ' ends of HP-DNA；
The intermediate sequence of H-DNA1 and the intermediate sequence of H-DNA2 are complementary；
5 ' the ends of H-DNA2 are complementary with the 3 ' ends of HP-DNA；
3 ' the ends of H-DNA2 are complementary with the 5 ' ends of T-DNA；
The HP-DNA, 3 ' end connection amino；
The complementary base logarithm of the H-DNA1 and H-DNA2 is preferably 8bp；PH-ECL signal strength and background intensity with
H-DNA1 and H-DNA2 complementary base logarithm increase and enhance, signal strength increase is unobvious after 8bp, but background signal
Increase obvious.
The tumoral character gene, what the present invention illustrated is K-ras gene and p53 gene, but this should not be to this hair
Bright protection scope causes to limit, and method of the invention is suitable for all characterizing gene segments；
(2) PH compound is formed
H-DNA1, H-DNA2 and sample to be tested (may contain T-DNA) are added in buffer, several minutes of incubation reaction,
If if sample to be tested contains T-DNA, just will form PH compound (PH complexes, PHC)；
The preferred TE buffer (pH value 8.5) of the buffer；
(3) sensing interface preparation and loading before chip folds
The working electrode surface in foldable three-dimensional chip is added dropwise in MWCNTs-CS solution, is placed at room temperature several minutes；
Glutaraldehyde (GA) solution is added dropwise on the working electrode of foldable three-dimensional chip, uses deionization after reacting at room temperature
Water rinses；Then HP-DNA is added drop-wise on the working electrode surface for having modified GA, is reacted under the conditions of constant temperature and humidity several minutes,
Then it rinsed using Tris-HCl buffer (containing certain SDS), dried at room temperature；Finally, bovine serum albumin Block buffer
(BSA-BB) it is added drop-wise to and has modified on HP-DNA working electrode surface, rinsed after being incubated at room temperature with PBS buffer solution, to make
Obtain sensing chip interface；
The foldable three-dimensional chip can use the three-dimensional chip of the prior art；
For example use document (Paper-based electrochemiluminescence origami device for
pertein detection using assembled cascade DNA-carbon dots nanotags based on
rolling circle amplificationg[J].Biosensors and Bioelectronics,2015,68:413-
420) the foldable three-dimensional chip disclosed in (is specifically shown in Scheme1:2.3.Design and fabrication of the
3D origami device)；
Its explanation (is for another example specifically shown in using foldable paper chip disclosed in Chinese patent ZL 201510246434.4
Book attached drawing and claims record related to specification)；
Cloth substrate or paper substrates, preferably cloth substrate can be used in the foldable three-dimensional chip；
As MWCNTs concentration increases, PH-ECL signal strength increases therewith, when concentration reaches 5g/L, PH-ECL intensity
Reach maximum value；When concentration further increases, PH-ECL signal strength is slowly reduced.Therefore, MWCNTs- in the method for the present invention
The preferred 5g/L of the concentration of MWCNTs in CS solution.
Then the HP-DNA is gradually cooled to 4 DEG C, is allowed to form stem using preceding 95 DEG C of heating 5min in PCR instrument
Ring structure；
Preferably 0.5 μM of the concentration of the HP-DNA；In the present invention, PH-ECL signal strength is with the increase of HP-DNA concentration
And first increase and reduce afterwards, background intensity variation is little.
Isometric PHC solution and tris (bipyridine) ruthenium (TBR) solution are added drop-wise to sensing obtained above after evenly mixing
On interface, it is incubated for a period of time under constant temperature and constant humidity, is then rushed with dcq buffer liquid (containing Tris-HCl and Tween-20)
It washes, dries at room temperature；
The preferred 1mM of concentration of the TBR solution；As TBR concentration increases, PH-ECL signal strength increases therewith, and carries on the back
Scape Strength Changes are little；When concentration is greater than 1mM, PH-ECL signal strength tends towards stability with TBR concentration.
The preferred 40min of the incubation time, because PH-ECL signal strength and background intensity increase with incubation time
And enhance, but signal strength increase is unobvious after 40min, and background intensity significantly improves.
(4) sample detection after chip folds
Chip is folded along fold line, keeps sample cell Chong Die with pond is assisted to constitute three electricity that can carry out PH-ECL detection
Pole structure；Then, tripropyl amine (TPA) (TPA) solution is added dropwise in auxiliary pond, is put into chip secretly after working electrode in sample cell is impregnated with
In case；Finally, starting CCD automated imaging function, and and then start potentiostat, if swollen containing what is detected in sample to be tested
Tumor characterizing gene can then trigger PH-ECL reaction；
As TPA concentration increases, PH-ECL signal strength increases therewith, and background intensity variation is little；When concentration is greater than
When 20mM, PH-ECL intensity tends towards stability.Therefore, in order to obtain maximum signal to noise ratio, the preferred 20mM of the concentration of TPA solution.
The luminous video that CCD is acquired in real time is saved into WMA format；Video is become into JPG picture format using VGIF software；
Then, using nEO iMAGING4.4.1 (Shenzhen Thunder Net Culture Co., Ltd., Shenzhen,
China working electrode light emitting region) is intercepted；It measures and schemes finally by Matlab R2012a (MathWorks company, USA)
Piece average gray value simultaneously uses Origin7.0 (Microcal Software Inc., Newark, USA) software to imaging data
Perform an analysis processing.
Electrochemical luminescence intensity=average gray value × pixel；
Average gray value is calculated by image analysis software；
The CCD refers to portable CCD digital imaging apparatus, is Guangzhou Ming Mei Science and Technology Ltd. product, model
For MC15；
Described TBR, TPA and the GA is dissolved in PBS buffer solution (pH value 7.5)；CS solution is by acetate buffer solution (pH value
6.0) it prepares；MWCNTs is dissolved in CS solution.
Basic principle of the invention is:
MWCNTs-CS is modified in working electrode surface, then uses GA activating surface, wherein MWCNTs can be used to improve electronics
Transfer velocity and increase specific surface area, to improve detection sensitivity；There is CS film forming characteristics to provide amino simultaneously, into one
The upper amino of GA and CS for walking modification, which carries out condensation reaction, makes a large amount of aldehyde radicals of working electrode surface exposure, these aldehyde radicals on HP-DNA
Amino carries out covalent bond, to keep HP-DNA fixed at the electrode surface required sensing interface is made.
In the presence of T-DNA, T-DNA and two auxiliary DNA (H-DNA1 and H-DNA2) can be carried out hybridization reaction to generate
PHC, then PHC and TBR is added drop-wise to working electrode surface after being appropriately mixed so that PHC opens HP- on working electrode
DNA, while a large amount of TBR are inserted into DNA double chain.Coreagent TPA is added after chip folding, then by potentiostat
Power supply is to trigger PH-ECL.
So-called PH refers to a pair of of affinity probe simultaneously and neighboringly identification target molecule and in combination, to make a pair
Also mutually adjacent generation hybridization reaction forms T-shape structure to the tail of affinity probe.Compared with traditional sandwich structure, the party
Method can guarantee that institute's labelling groups are substantial access to electrode, and electron transfer efficiency improves, and then improve detection sensitivity.And this is specially
In benefit application, T-shape PHC forms " H " type structure with HP-DNA on working electrode in conjunction with, " H " type contain more double-stranded DNAs thus
More TBR are caused to be inserted into, this improves reaction sensitivity.At the same time, this method detection range is wide, and selectivity is high, and can
Identify single base or double alkali yl mutation.
The present invention has the following advantages and effects with respect to the prior art:
(1) compared to other chip substrate materials (such as silicon, glass and high polymer), the present invention processes cloth substrate
At chip be applied in genetic test, develop cheap, easy, strong operability DNA sensor.
(2) compared to two-dimentional three electrode cloth chips, working electrode is limited in one by three electrode cloth chip of three-dimensional of the invention
Side will be limited in the other side to electrode and reference electrode, make when avoiding working electrode modification or processing to other two electrodes
It at adverse effect, while also avoiding spilling over reaction tank outside modification solution, reaction tank is polluted.
(3) DNA sensor of the present invention is based on label-free type electrochemical luminescence, so as to avoid the signal of tediously long complexity
Probe labeling process, the solution materialization factor (such as pH, temperature) in labeling process that also avoids cause bad shadow to DNA molecular
It rings.
(4) relative to other gene method for sensing, PH-ECL method of the present invention has its own advantage: it can not only make to shine
Group has the potentiality applied to Protein Detection to greatest extent adjacent to electrode to improve detection sensitivity and selectivity.
(5) genetic chip that the present invention is developed has good versatility, needs when avoiding detecting different target sequence
The problem of chip is modified again is carried out, therefore efficiently solves the problems, such as the waste of chip material, there is resource utilization height, cost
Low advantage.
(6) compared to other costly and complicated optical imaging systems, the present invention is imaged using simple CCD equipment
Detection；Amplify strategy in conjunction with the signal of carbon nanotube, greatly improves the DNA detection sensitivity of cloth chip electrochemical luminescence.
Detailed description of the invention
Fig. 1 is reaction tank shape of the present invention, wherein 1 is sample cell, 2 be auxiliary pond, and 3 be fold line.
Fig. 2 is electrode shape of the present invention, wherein 1 is working electrode, 2 be reference electrode, and 3 is to electrodes.
Fig. 3 be in the method for the present invention cloth chip wire mark processing after array pictorial diagram.
Fig. 4 is that T-DNA with the neighbouring of two H-DNA hybridizes schematic diagram in the method for the present invention.
Fig. 5 is that chip folds preceding sensing interface preparation and loading schematic diagram in the method for the present invention.
Fig. 6 is two-dimentional cloth chip form (including outside chip and the inside) of the invention and its folds schematic diagram.
Fig. 7 is the relational graph of electrochemical luminescence intensity and H-DNA1 and H-DNA2 complementary base logarithm in the method for the present invention.
Fig. 8 is the relational graph of electrochemical luminescence intensity and HP-DNA concentration in the method for the present invention.
Fig. 9 is the relational graph of electrochemical luminescence intensity and incubation time in the method for the present invention.
Figure 10 is the relational graph of electrochemical luminescence intensity and TBR concentration in the method for the present invention.
Figure 11 is the relational graph of electrochemical luminescence intensity and TPA concentration in the method for the present invention.
Figure 12 is the relational graph of electrochemical luminescence intensity and sweep speed in the method for the present invention.
Figure 13 is the relational graph of electrochemical luminescence intensity and MWCNTs concentration in the method for the present invention.
Figure 14 is the relational graph of electrochemical luminescence intensity and T-DNA concentration in the method for the present invention.
Figure 15 is cloth chip PH-ECL selective evaluation in the method for the present invention.
Figure 16 is that cloth chip PH-ECL versatility is evaluated in the method for the present invention.
Figure 17 is that PH-ECL shines comparison diagram under the same conditions for cloth chip and paper chip in the method for the present invention.
Specific embodiment
Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited
In this.
Embodiment 1
The preparation of foldable three-dimensional cloth chip, includes the following steps:
(1) three-dimensional cloth chip design and processing
Reaction tank and electrode shape are designed using mapping software Adobe Illustrator CS5；Reaction tank shape such as Fig. 1
It is shown, including sample cell 1 (diameter 6.5mm) and auxiliary pond 2 (diameter 14mm), and it is the folding of 1mm that design, which has width, between two ponds
Line 3；
Electrode shape as shown in Fig. 2, electrode be three electrodes, including working electrode (circle) 1, to electrode 3 and reference electrode
(part-toroidal) 2.
Corresponding 200 mesh nylon web plates (i.e. reaction tank web plate and electrode web plate) is processed into according to above-mentioned design shape；It will
Electrode web plate (containing 4 rows, 2 column electrode patterns) is pressed on pieces of cloth (150mm × 150mm), and wire mark carbon is starched on web plate；Then cloth
Piece is put into 90 DEG C of oven drying 30min after separating with web plate.Then, reaction tank web plate (containing 4 rows, 2 column reaction tank patterns) pressure
At the pieces of cloth back side for printing electrode, it is close to web plate and pieces of cloth, and waxed on reaction tank web plate with pink colour wax crayon, and with putting down
Sliding spoon of milling firmly uniformly is milled.Then web plate and pieces of cloth are put on hot plate together, are heated under the conditions of 90 DEG C about 3 seconds,
Then pieces of cloth are removed and is cooled to room temperature from reaction tank web plate, so that cloth chip array (Fig. 3) be made.
Embodiment 2
Application of the foldable three-dimensional cloth chip PH-ECL in detection K-ras gene, includes the following steps:
(1) design DNA sequence dna
Designed DNA sequence dna is following (5'-3'):
T-DNA:agttggagctggtggcgtaggc(SEQ ID NO.1)；K-ras full length gene about 35kb, T-DNA sequence
Column include the codon GGT of the most common mutational site 12；
HP-DNA:cggagacataacaatagatccg(SEQ ID NO.2)-(CH2)6-NH2；
H-DNA1:gcctacgccaccaggatgagtgtgttatgtc(SEQ ID NO.3)；
H-DNA2:cggatctatcactcatcgtccaact(SEQ ID NO.4)。
(2) the PH reaction process of T-DNA
Neighbouring hybridization schematic diagram is as shown in figure 4, by 10 μ L H-DNA1 and H-DNA2 (each 10 μM) and various concentration T-DNA
Mixing；Then addition TE buffer to total volume be 100 μ L；Finally, the incubation reaction 30min at 37 DEG C, that is, it is compound to form PH
Object (PH complexes, PHC).
(3) sensing interface preparation and loading before chip folds
8 independent cloth chips are suitably cut out from the cloth chip array of embodiment 1, then as shown in figure 5, to each cloth
Chip processing process is as follows: 2.5 μ L MWCNTs-CS solution being added dropwise in working electrode surface, place 30min at room temperature；By 2 μ
L2.5%GA solution is added dropwise on the working electrode (s, is rinsed 3 times after reacting 60min at room temperature with deionized water；Then by 5 μ L HP-
DNA (0.5 μM) is added drop-wise on the working electrode surface for having modified GA, reacts 30min under the conditions of 37 DEG C of constant temperature and constant humidity, then
It flushed three times using Tris-HCl buffer (10mM) (containing 1%SDS), dried at room temperature；Finally, 2 μ L BSA-BB (0.1%)
It is added drop-wise to and has modified on HP-DNA working electrode surface, flushed three times after being incubated at room temperature 30min with PBS buffer solution, thus
Cloth chip sensing interface is made.
5 μ L are taken to be added drop-wise to above-mentioned be made after evenly mixing the PHC solution of certain volume and isometric TBR (2mM) solution
Sensing interface on, the incubation reaction 40min under 37 DEG C of constant temperature and constant humidity then (contains 50mM Tris- with dcq buffer liquid
HCl and 0.02% Tween-20) it flushes three times, it dries at room temperature.
(4) sample detection after chip folds
As shown in fig. 6, two-dimentional cloth chip is folded into three-dimensional cloth chip along fold line, keep sample cell Chong Die with auxiliary pond
To constitute the three-electrode structure that can carry out PH-ECL detection；Then, 40 μ LTPA solution (20mM) are added dropwise in auxiliary pond, to sample
Chip is put into camera bellows after working electrode is impregnated in pond；Finally, starting CCD automated imaging function, and the and then permanent electricity of starting
Position instrument is with cyclic voltammetric method scanning power supply (current potential and sweep speed be respectively 0~2V and 60mV/s) triggering PH-ECL reaction.
Embodiment 3
To several key factor (H-DNA1 for influencing three-dimensional cloth chip PH-ECL gene sensing luminous intensity in embodiment 2
It is dense with H-DNA2 complementary base logarithm, HP-DNA concentration, incubation time, TBR concentration, TPA concentration, sweep speed and MWCNTs
Degree) it carries out preferably:
A) preferred H-DNA1 and H-DNA2 complementary base logarithm
1, T-DNA (K-ras genetic fragment) concentration 25pM, H-DNA1 and H-DNA2 complementary base logarithm to be measured is undetermined, HP-
0.4 μM of DNA concentration, incubation time 40min, TBR concentration 1mM, TPA concentration 20mM, sweep speed 100mV s-1, MWCNTs concentration
5g L-1。
2, several experimental groups are set: H-DNA1 and H-DNA2 complementary base logarithm be set as several different values (5bp,
6bp、7bp、8bp、9bp)。
3, step and other materials are same as Example 2, and test results are shown in figure 7.
It can be seen that PH-ECL signal strength and background intensity are with H-DNA1 and H-DNA2 complementary base from experimental result
Base logarithm increases and enhances, and signal strength increases unobvious after 8bp, but background signal increases obviously.Generate this phenomenon
The reason of when may be greater than 8bp H-DNA1 and H-DNA2 in the presence of there is no T-DNA hybridization reaction so that opening
HP-DNA on working electrode.In order to obtain maximum signal to noise ratio, the method for the present invention H-DNA1 and H-DNA2 complementary base logarithm is preferred
For 8bp.
B) preferred HP-DNA concentration
1, T-DNA (K-ras genetic fragment) concentration 25pM, H-DNA1 and H-DNA2 complementary base logarithm 8bp, HP- to be measured
DNA concentration is undetermined, incubation time 40min, TBR concentration 1mM, TPA concentration 20mM, sweep speed 100mV s-1, MWCNTs concentration
5g L-1。
2, several experimental groups are arranged: HP-DNA concentration is set as several different values (0.2 μM, 0.4 μM, 0.5 μM, 0.6 μ
M、0.8μM)。
3, step and other materials are same as Example 2, and test results are shown in figure 8.
It can be seen that PH-ECL signal strength first increases and reduces afterwards as HP-DNA concentration increases from experimental result,
Background intensity variation is little.The possible cause for generating this phenomenon is that the high density HP-DNA being fixed on working electrode surface is produced
Raw steric effect, prevents more PHC and HP-DNA that hybridization reaction occurs.Based on the fact that the method for the present invention selects 0.5 μM
For HP-DNA optimal concentration.
C) preferred incubation time
1, T-DNA (K-ras genetic fragment) concentration 25pM, H-DNA1 and H-DNA2 complementary base logarithm 8bp, HP- to be measured
DNA concentration is 0.5 μM, and incubation time is undetermined, TBR concentration 1mM, TPA concentration 20mM, sweep speed 100mV s-1, MWCNTs is dense
Spend 5g L-1。
2, several experimental groups are set: incubation time be set as several different values (10min, 20min, 30min, 40min,
50min)。
3, step and other materials are same as Example 2, and test results are shown in figure 9.
It can be seen that PH-ECL signal strength and background intensity enhance as incubation time increases from experimental result,
But signal strength increase is unobvious after 40min, and background intensity significantly improves.The possible cause for generating this phenomenon is electricity
With in PHC, with positive charge TBR is not inserted into Electrostatic Absorption occurs for the negative electrical charge BSA having in pole surface, so as to cause
Excessive TBR is difficult to rinse well.Therefore, the preferred incubation time of the method for the present invention is 40min.
D) preferred TBR concentration
1, T-DNA (K-ras genetic fragment) concentration 25pM, H-DNA1 and H-DNA2 complementary base logarithm 8bp, HP- to be measured
DNA concentration is 0.5 μM, and incubation time 40min, TBR concentration is undetermined, TPA concentration 20mM, sweep speed 100mV s-1, MWCNTs
Concentration 5g L-1。
2, be provided with several experimental groups: TBR concentration be set as several different values (0.6mM, 0.8mM, 0.9mM, 1mM,
1.1mM、1.2mM)。
3, step and other materials are same as Example 2, and test results are shown in figure 10.
It can be seen that PH-ECL signal strength increases therewith, and background is strong as TBR concentration increases from experimental result
Degree variation is little；When concentration is greater than 1mM, PH-ECL signal strength tends towards stability with TBR concentration.Therefore, the method for the present invention
The preferred 1mM of TBR concentration.
E) preferred TPA concentration
1, T-DNA (K-ras genetic fragment) concentration 25pM, H-DNA1 and H-DNA2 complementary base logarithm 8bp, HP- to be measured
DNA concentration is 0.5 μM, and incubation time 40min, TBR concentration is 1mM, and TPA concentration is undetermined, sweep speed 100mV s-1, MWCNTs
Concentration 5g L-1。
2, be provided with several experimental groups: TPA concentration be set as several different values (10mM, 15mM, 18mM, 20mM, 22mM,
25mM、30mM)。
3, step and other materials are same as Example 2, and test result is as shown in figure 11.
It can be seen that PH-ECL signal strength increases therewith, and background is strong as TPA concentration increases from experimental result
Degree variation is little；When concentration is greater than 20mM, PH-ECL intensity tends towards stability.Therefore, in order to obtain maximum signal to noise ratio, TPA is dense
Degree is preferably 20mM.
F) preferred sweep speed
1, T-DNA (K-ras genetic fragment) concentration 25pM, H-DNA1 and H-DNA2 complementary base logarithm 8bp, HP- to be measured
DNA concentration is 0.5 μM, and incubation time 40min, TBR concentration is 1mM, and TPA concentration 20mM, sweep speed is undetermined, MWCNTs concentration
5g L-1。
2, be provided with several experimental groups: sweep speed is set as several different values (10mV s-1、30mV s-1、40mV s-1、
50mV s-1、60mV s-1、70mV s-1、80mV s-1、100mV s-1)。
3, step and other materials are same as Example 2, and test result is as shown in figure 12.
It can be seen that working as sweep speed from 10mV s from experimental result-1Increase to 60mV s-1When, PH-ECL signal is strong
Degree increases therewith；When sweep speed is further change in 100mV s-1When, PH-ECL signal strength is in be gradually reduced trend.Cause
This, sweep speed is preferably 60mV s-1。
G) preferred MWCNTs concentration
1, T-DNA (K-ras genetic fragment) concentration 10fM, H-DNA1 and H-DNA2 complementary base logarithm 8bp, HP- to be measured
DNA concentration is 0.5 μM, and incubation time 40min, TBR concentration is 1mM, TPA concentration 20mM, sweep speed 60mV s-1, MWCNTs
Concentration is undetermined.
2, be provided with several experimental groups: MWCNTs concentration is set as several different value (0g/L, 3g/L, 4g/L, 5g/L, 6g/
L、7g/L)。
3, step and other materials are same as Example 2, and test result is as shown in figure 13.
It can be seen that PH-ECL signal strength increases therewith as MWCNTs concentration increases from experimental result, work as concentration
When reaching 5g/L, PH-ECL intensity reaches maximum value；When concentration further increases, PH-ECL signal strength is slowly reduced.It produces
The possible cause of raw this phenomenon is that high concentration MWCNTs generates reunion, and which prevent the transfers of MWCNTs surface electronic, to drop
Low PH-ECL signal.Therefore, MWCNTs concentration is preferably 5g/L in the method for the present invention.
Embodiment 4
Cloth chip PH-ECL detection T-DNA (K-ras genetic fragment) is carried out with some optimal conditions that embodiment 3 is groped:
1, the parameter optimized using embodiment 3: complementary base logarithm 8bp, HP-DNA concentration 0.5 of H-DNA1 and H-DNA2
μM, incubation time 40min, TBR concentration 1mM, TPA concentration 20mM, sweep speed 60mV s-1, MWCNTs concentration 5g L-1。
2, several experimental groups are set: the concentration of T-DNA to be measured be set as several different values (2.5nM, 50pM, 5pM,
0.5pM、50fM、10fM、1fM)。
3, step and other materials are same as Example 2, and measurement result is as shown in figure 14.
From experimental result it can be seen that PH-ECL signal strength enhances with the raising of T-DNA concentration.ECL intensity (uses Y
Indicate) it with T-DNA log concentration (being indicated with X) is in some linear, linear equation can be expressed as Y=3.641X+17.182,
Coefficient R2=0.994.The calculation method that detection limit uses is: XL=Xb+3Sb, signal is strong when wherein Xb is blank control
Degree, Sb are the standard deviation of blank control (5 repetitions are tested)；Detection limit is obtained by the corresponding T-DNA concentration of gained XL value.
The detection of this method is limited to 0.35fM.
Embodiment 5
Cloth chip PH-ECL is carried out with some optimal conditions that embodiment 3 is groped selectively to test:
1, the parameter optimized using embodiment 3: the complementary base logarithm of target sequence concentration 5pM, H-DNA1 and H-DNA2
0.5 μM of 8bp, HP-DNA concentration, incubation time 40min, TBR concentration 1mM, TPA concentration 20mM, sweep speed 60mV s-1、
MWCNTs concentration 5g L-1。
2, several mutating experiment groups of T-DNA: complete complementary group (T-DNA), single base mutation group are setG12A(the 12nd G
Sport A), single base mutation groupG12T(the 12nd G sports T), two base mutation groups, four base mutation groups, arbitrary sequence group
And blank control.
3, step and other materials are same as Example 2, and measurement result is as shown in figure 15.
From experimental result it can be seen that compared with complete complementary condition, there is ECL intensity under the conditions of two groups of single base mutations
It is substantially reduced.ECL intensity caused by two base mutations is higher than blank control group, but is below ECL intensity when single base mutation.
The PH-ECL intensity of four base mutation groups and arbitrary sequence group difference compared with blank control is little.Therefore, the method for the present invention can
Good detection is carried out to the single base of T-DNA and two base mutations to realize.
Embodiment 6
The experiment of cloth chip PH-ECL versatility is carried out with some optimal conditions that embodiment 3 is groped, this experiment uses p53 base
Because segment is as target sequence, and (for the sake of difference, new sequence code name is H-DNAa to redesign H-DNA1 and H-DNA2 sequence
And H-DNAb):
1, the parameter optimized using embodiment 3, complementary base logarithm 8bp, HP-DNA concentration 0.5 of H-DNAa and H-DNAb
μM, incubation time 40min, TBR concentration 1mM, TPA concentration 20mM, sweep speed 60mV s-1, MWCNTs concentration 5g L-1。
2, several experimental groups are arranged: p53 mrna concentration to be measured is set as several different values (0pM, 0.05pM, 5pM).
3, step and other materials are same as Example 2, and measurement result is as shown in figure 16.
The DNA sequence dna of redesign is following (5 ' -3 '):
T-DNA:ccaggacaggcacaaacacgcacctc (SEQ ID NO.5)；P53 full length gene about 20kb, T-DNA
Sequence includes the codon ACG of the most common mutational site 273；
H-DNAa:gaggtgcgtgtttgtgcggatgagtgtgttatgtc (SEQ ID NO.6)；
H-DNAb:cggatctatcactcatcggtcctgg (SEQ ID NO.7)；
From experimental result it can be seen that ECL intensity enhances with the increase of p53 mrna concentration.For different target sequence
The detection of column, the method for the present invention need to only redesign a pair of of H-DNA sequence, in two H-DNA with HP-DNA complementary portion
Without changing, therefore HP-DNA is not required to redesign, without re-starting the preparation of cloth chip sensing interface.Therefore, originally
Inventive method has good versatility.
Embodiment 7
Cloth chip and paper chip PH-ECL comparative experiments are carried out with some optimal conditions that embodiment 3 is groped:
1, the parameter optimized using embodiment 3: the complementary base logarithm of target sequence concentration 5pM, H-DNA1 and H-DNA2
0.5 μM of 8bp, HP-DNA concentration, incubation time 40min, TBR concentration 1mM, TPA concentration 20mM, sweep speed 60mV s-1、
MWCNTs concentration 5g L-1。
2, cloth chip and paper chip control experiment group are set: making paper chip and cloth chip sensing interface respectively, and in phase
T-DNA is detected under the conditions of.The paper chip uses Whatman1 chromatographic paper for substrate material.
3, step and other materials are same as Example 2, and measurement result is as shown in figure 17.
From experimental result it can be seen that the method for the present invention is equally applicable to paper substrates, but it is strong poor compared to wet, it is short-life
For paper fiber material, has well-regulated porous capillary fibre structure, wet strong good fibre materials can preferably adhere to and receive
Rice material, shows better luminescent properties.Therefore the method for the present invention uses substrate material of the measuring fiber as chip.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Sequence table
<110>South China Normal University
<120>a kind of foldable chip of three-dimensional is adjacent to hybridization-electrochemiluminescgene gene detection method
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> T-DNA
<400> 1
agttggagct ggtggcgtag gc 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> HP-DNA
<400> 2
cggagacata acaatagatc cg 22
<210> 3
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> H-DNA1
<400> 3
gcctacgcca ccaggatgag tgtgttatgt c 31
<210> 4
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> H-DNA2
<400> 4
cggatctatc actcatcgtc caact 25
<210> 5
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> T-DNA
<400> 5
ccaggacagg cacaaacacg cacctc 26
<210> 6
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> H-DNAa
<400> 6
gaggtgcgtg tttgtgcgga tgagtgtgtt atgtc 35
<210> 7
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> H-DNAb
<400> 7
cggatctatc actcatcggt cctgg 25
Claims (10)
1. a kind of gene tester based on three-dimensional foldable chip, it is characterised in that the following steps are included:
(1) design probe and auxiliary DNA sequence dna
For the tumoral character gene to be detected, its characteristic fragment is chosen as target DNA (T-DNA)；
The sequence of design capture hairpin probe DNA (HP-DNA) and two auxiliary DNA (H-DNA1, H-DNA2)；
Above-mentioned 4 DNA sequence dnas need to meet the following conditions:
5 ' the ends of H-DNA1 are complementary with the 3 ' ends of T-DNA；
3 ' the ends of H-DNA1 are complementary with the 5 ' ends of HP-DNA；
The intermediate sequence of H-DNA1 and the intermediate sequence of H-DNA2 are complementary；
5 ' the ends of H-DNA2 are complementary with the 3 ' ends of HP-DNA；
3 ' the ends of H-DNA2 are complementary with the 5 ' ends of T-DNA；
The HP-DNA, 3 ' end connection amino；
(2) PH compound is formed
H-DNA1, H-DNA2 and sample to be tested are added in buffer, several minutes of incubation reaction, if sample to be tested contains T-DNA
If, it just will form PH compound；
(3) sensing interface preparation and loading before chip folds
The working electrode surface in foldable three-dimensional chip is added dropwise in MWCNTs-CS solution, is placed at room temperature several minutes；
Glutaraldehyde solution is added dropwise on the working electrode of foldable three-dimensional chip, is rinsed after reacting at room temperature with deionized water；
Then HP-DNA is added drop-wise on the working electrode surface for having modified GA, reacts under the conditions of constant temperature and humidity several minutes, then adopts
It rinsed with Tris-HCl buffer, dried at room temperature；Finally, bovine serum albumin Block buffer, which is added drop-wise to, has modified HP-DNA work
Make on electrode surface, rinsed after being incubated at room temperature with PBS buffer solution, so that sensing chip interface be made；
Isometric PHC solution and terpyridyl ruthenium solution are added drop-wise to after evenly mixing on sensing interface obtained above,
It is incubated under constant temperature and constant humidity, is then rinsed with dcq buffer liquid, dried at room temperature；
(4) sample detection after chip folds
Foldable three-dimensional chip is folded along fold line, PH-ECL detection can be carried out by overlapping sample cell and auxiliary pond
Three-electrode structure；Then, tripropyl amine (TPA) solution is added dropwise in auxiliary pond, chip is put into camera bellows after working electrode in sample cell is impregnated with
In；Finally, starting CCD automated imaging function, and and then start potentiostat, if containing the tumour to be detected in sample to be tested
Characterizing gene can then trigger PH-ECL reaction.
2. gene tester according to claim 1, it is characterised in that: step (1) H-DNA1's and H-DNA2
Complementary base logarithm is 8bp.
3. gene tester according to claim 1, it is characterised in that: tumoral character gene packet described in step (1)
Include K-ras gene and p53 gene.
4. gene tester according to claim 1, it is characterised in that: foldable three-dimensional chip described in step (3)
For cloth substrate.
5. gene tester according to claim 1, it is characterised in that: in step (3), the MWCNTs-CS solution
The concentration of middle MWCNTs is 5g/L.
6. gene tester according to claim 1, it is characterised in that: in step (3), the concentration of the HP-DNA is
0.5μM。
7. gene tester according to claim 1, it is characterised in that: in step (3), the terpyridyl ruthenium solution
Concentration be 1mM.
8. gene tester according to claim 1, it is characterised in that: in step (3), the incubation, the time
For 40min.
9. gene tester according to claim 1, it is characterised in that: in step (4), the tripropyl amine (TPA) solution it is dense
Degree is 20mM.
10. gene tester according to claim 1, it is characterised in that: in step (4), what CCD was acquired in real time shines
Video is saved into WMA format；Video is become into JPG picture format using VGIF software；Then, using nEO iMAGING
4.4.1 (Shenzhen Thunder Net Culture Co., Ltd., Shenzhen, China) intercepts working electrode luminous zone
Domain；Picture average gray value is measured finally by Matlab R2012a (MathWorks company, USA) and is used
Origin7.0 (Microcal Software Inc., Newark, USA) software performs an analysis processing to imaging data.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910326207.0A CN110042149B (en) | 2019-04-23 | 2019-04-23 | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910326207.0A CN110042149B (en) | 2019-04-23 | 2019-04-23 | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110042149A true CN110042149A (en) | 2019-07-23 |
| CN110042149B CN110042149B (en) | 2022-12-13 |
Family
ID=67278573
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910326207.0A Active CN110042149B (en) | 2019-04-23 | 2019-04-23 | Three-dimensional foldable chip adjacent hybridization-electrochemiluminescence gene detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110042149B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111830107A (en) * | 2020-07-13 | 2020-10-27 | 济南大学 | Method for detecting prostate specific antigen based on enzyme biofuel cell |
| CN113151403A (en) * | 2021-04-06 | 2021-07-23 | 中国科学技术大学 | DNA and methylation level detection kit thereof, and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004850A (en) * | 2014-06-11 | 2014-08-27 | 华南师范大学 | Paper-based micro-fluidic chip enhancement type chemiluminescence gene sensing method |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
-
2019
- 2019-04-23 CN CN201910326207.0A patent/CN110042149B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004850A (en) * | 2014-06-11 | 2014-08-27 | 华南师范大学 | Paper-based micro-fluidic chip enhancement type chemiluminescence gene sensing method |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
Non-Patent Citations (3)
| Title |
|---|
| XIAOMING ZHOU 等: "Amplified electrochemiluminescence detection of nucleic acids by hairpin probe-based isothermal amplification", 《THE ROYAL SOCIETY OF CHEMISTRY》 * |
| ZHONGYUAN LIU 等: "Recent advances in electrochemiluminescence", 《CHEMICAL SOCIETY REVIEWS》 * |
| 刘晋峰等: "电化学发光PCR技术检测转基因植物", 《生物化学与生物物理进展》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111830107A (en) * | 2020-07-13 | 2020-10-27 | 济南大学 | Method for detecting prostate specific antigen based on enzyme biofuel cell |
| CN113151403A (en) * | 2021-04-06 | 2021-07-23 | 中国科学技术大学 | DNA and methylation level detection kit thereof, and preparation method and application thereof |
| CN113151403B (en) * | 2021-04-06 | 2023-06-16 | 中国科学技术大学 | DNA and methylation level detection kit, preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110042149B (en) | 2022-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Abrego-Martinez et al. | Aptamer-based electrochemical biosensor for rapid detection of SARS-CoV-2: Nanoscale electrode-aptamer-SARS-CoV-2 imaging by photo-induced force microscopy | |
| Tang et al. | Fabrication of immunosensor microwell arrays from gold compact discs for detection of cancer biomarker proteins | |
| Ozer et al. | based analytical devices for virus detection: Recent strategies for current and future pandemics | |
| Ge et al. | Lab-on-paper-based devices using chemiluminescence and electrogenerated chemiluminescence detection | |
| CN107677719B (en) | A method of alpha-fetoprotein is detected based on graphene, thionine and aptamer | |
| CN103901089B (en) | The detection sensor of neurocyte electricity physiological signal and manufacture method and detection method | |
| Ueno et al. | Fabrication and electrochemical characterization of interdigitated nanoelectrode arrays | |
| CN103048462B (en) | Multi-parameter electrochemical immunosensor based on electrode array and preparation method thereof | |
| CN103308675B (en) | The preparation of the screen printing electrode immunosensor of quick detection Microcystin and detection method | |
| Zhu et al. | Simultaneous detection of four biomarkers with one sensing surface based on redox probe tagging strategy | |
| CN101413958B (en) | Method for quantitatively detecting protein through immune print marked by avidin fluorescent quantum | |
| CN113447547B (en) | Prostate cancer tumor marker detection method based on molybdenum disulfide/nano platinum-coated gold triangle/polydopamine | |
| CN110042149A (en) | A kind of foldable chip of three-dimensional is adjacent to hybridization-electrochemiluminescgene gene detection method | |
| CN105334253A (en) | Method of testing PML/RAR alpha genes through electrochemical biosensor of carbon dot @ graphene oxide composite material | |
| Feng et al. | Disposable paper-based bipolar electrode array for multiplexed electrochemiluminescence detection of pathogenic DNAs | |
| Arduini et al. | Based electrochemical devices in biomedical field: recent advances and perspectives | |
| Tran et al. | Micro-patterning of single-walled carbon nanotubes and its surface modification with gold nanoparticles for electrochemical paper-based non-enzymatic glucose sensor | |
| CN106018390B (en) | The preparation of Ratio-type electrochemical luminescence paper chip and the application in lead ion detection | |
| CN110530853A (en) | Method for detecting aflatoxin B1 based on visual BPE-ECL technology | |
| Su et al. | A three-dimensional cloth-based microfluidic label-free proximity hybridization-electrochemiluminescence biosensor for ultrasensitive detection of K-ras gene | |
| Wang et al. | Time-resolution addressable photoelectrochemical strategy based on hollow-channel paper analytical devices | |
| CN109507256A (en) | A kind of unmarked electrochemical luminescence aptamer sensor and preparation method thereof and application method detecting carcinomebryonic antigen | |
| Liu et al. | Electrochemiluminescent biosensor with DNA link for selective detection of human IgG based on steric hindrance | |
| CN204882454U (en) | Invertible field effect transistor biosensor of light | |
| Gao et al. | Sensitive and facile electrochemiluminescent immunoassay for detecting genetically modified rapeseed based on novel carbon nanoparticles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |