CN103175873B - Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal - Google Patents
Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal Download PDFInfo
- Publication number
- CN103175873B CN103175873B CN201310031332.1A CN201310031332A CN103175873B CN 103175873 B CN103175873 B CN 103175873B CN 201310031332 A CN201310031332 A CN 201310031332A CN 103175873 B CN103175873 B CN 103175873B
- Authority
- CN
- China
- Prior art keywords
- dna
- signal
- electrode
- electrochemical sensor
- target
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention discloses the DNA electrochemical sensor that a kind of based target repetitive dna sequence self strengthens amplifying signal, pass through the repetitive sequence fragment modelled signal probe of detected object chain, the amount of the signal probe be attached on target sequence is increased, form compound, when capture probe and the target sequence hybridize of electrode surface, the signal probe of amplification is then incorporated into electrode surface, the affinity interaction of the Avidin that the end-labelled biotin of signal probe and horseradish peroxidase are modified, multiple enzyme is made to be attached in " sandwich " structure, finally by the efficient catalytic effect of enzyme, catalysis H
2o
2oxidation TMB, oxidation product produces the reduction current signal be exaggerated on electrode, by current signal size judge detect the concentration of target dna.This experiment utilizes repetitive sequence object chain self to strengthen the feature of amplifying signal, and test and detect the object chain containing two sections of repetitive sequences, the method has higher sensitivity.
Description
Technical field
The present invention relates to based target repetitive dna sequence self and strengthen DNA electrochemical sensor of amplifying signal and preparation method thereof and the quick detection for tubercle bacillus, belong to biosensor technique field.
Background technology
At present, utilize the galvanochemistry DNA electrochemical sensor built that combines with enzyme technology to be paid close attention to widely, and be applied to the related gene detect delay of the diseases such as tumour.The preparation method of the DNA electrochemical sensor that protein controls constructed by assembled interface has good repeatability, its principle builds protein control assembled interface for adopting in gold electrode surfaces, electrode surface is made to assemble the spherical BSA molecular layer of one deck, between these global molecular, the carat (measure of the purity of gold) point be not occupied is exposed, then probe is fixed in an orderly manner the carat (measure of the purity of gold) point of exposure, thus effectively control density and the distribution thereof of probe, DNA probe and target dna are hybridized completely, then combined with electrochemical enzyme connection ampere amplifying technique detect to object chain.Ultimate principle is: (1) assembles one deck BSA molecular layer at electrode surface; (2) capture probe is assembled in the orderly gap between BSA molecule; (3) capture probe and signal probe, target dna form " sandwich " structure by hybridizing, at signal probe end mark biotin, horseradish peroxidase modifies Avidin, makes enzyme be attached in " sandwich " structure by the interaction of biotin and Avidin; (4) sensor is placed in containing substrate TMB and H
2o
2mensuration solution in, under set potential, measure the reduction current signal of TMB catalytic oxidation product.If the row that check order can not hybridize with probe, then cannot form " sandwich " structure, namely not have enzyme to be attached on sensor, so cannot the oxidation of catalysis TMB, the current signal of generation be very weak.Therefore identification to complementary series and base mismatch sequence and detection can be realized by signal intensity stool and urine.
Summary of the invention
First object of the present invention is to provide a kind of probe design process strengthening amplification signal based on gene repeat sequence self.
Second object of the present invention is to provide a kind of DNA electrochemical sensor high based on the repeatability of gene repeat sequence self enhancing amplification signal.
3rd object of the present invention is to provide a kind of DNA electrochemical sensor based on gene repeat sequence self enhancing amplification signal to the detection method containing one section, two sections repetitive sequence target dna.
4th object of the present invention is to provide a kind of DNA electrochemical sensor for rapid detecting Mycobacterium tuberculosis to the detection method of M. tuberculosis genes sequence.
The object of the present invention is achieved like this, described based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal, comprise electrode, protein, capture probe DNA, signal probe DNA, target dna and horseradish peroxidase, electrode adopts gold electrode, protein adopts bovine serum albumin(BSA), capture probe DNA adopts the single stranded DNA of 5 ' end sulfydryl modification, signal probe DNA adopts 3 ' to hold biotin labeled single stranded DNA, target dna adopt Prof. Du Yucang containing one section of repetitive sequence or containing the single stranded DNA of two sections of repetitive sequences, horseradish peroxidase adopts the horseradish peroxidase of Avidin mark, it is characterized in that: at gold electrode surfaces ordered fabrication one deck bovine serum albumin(BSA) molecular layer, capture probe DNA is assembled in ordered pore between bovine serum albumin(BSA) molecule, there is abundant hybridization reaction in the repetitive sequence in signal probe DNA and target dna, form the dsDNA-ssDNA-dsDNA-ssDNA-that stable double-strand and strand are alternately arranged ...-ssDNA-dsDNA compound, target dna is made to combine upper multiple signal probe DNA, simultaneously in capture probe DNA and target dna mutually one section of complementation there is hybridization reaction, thus realize the identification of capture probe DNA to stable compound, can be introduced at electrode surface by hybridization reaction and multiplely be connected to the biotin on signal probe and the signal probe DNA having formed biotin end modified, utilize the interaction of biotin and Avidin, multiple horseradish peroxidase of being connected on horseradish peroxidase-Avidin can be introduced and the horseradish peroxidase having formed Avidin end modified.
Described based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal, it is characterized in that: signal probe DNA adopts the complementary series of tubercle bacillus gene repetitive sequence to design, then in hybridization reaction process, can in conjunction with multiple signal probe in a target dna, and then in conjunction with multiple enzyme, play the effect strengthening amplified current signal, realize highly sensitive genetic test, described capture probe DNA is 5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT
10-(CH
2)
6-SH-3 ', described signal probe DNA is 5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ', the described target dna containing one section of repetitive sequence is 5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAAC-3 ', the described target dna containing two sections of repetitive sequences is 5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCC GCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3 '.
Based target repetitive dna sequence of the present invention self strengthens the preparation method of the DNA electrochemical sensor of amplifying signal, comprises the steps:
(1) protein controls the structure of assembled interface: be immersed in by gold electrode in BSA solution, cleaning after assembling under room temperature, and nitrogen dries up;
(2) assembling of capture probe DNA: get capture probe DNA solution, drips the gold electrode surfaces be coated onto after assembling protein, and after room temperature is placed, rinse electrode surface, nitrogen dries up.
Described based target repetitive dna sequence self strengthens the preparation method of the DNA electrochemical sensor of amplifying signal, it is characterized in that:
(1) protein controls the structure of assembled interface: be immersed in by gold electrode in the BSA solution of 0.1wt%, and after at room temperature assembling 15min, with distilled water cleaning, nitrogen dries up;
(2) assembling of capture probe: get capture probe DNA solution, drips the gold electrode surfaces be coated onto after assembling protein, and after room temperature places 1h, rinse electrode surface with distilled water, nitrogen dries up.
Based target repetitive dna sequence of the present invention self strengthens the detection method of the DNA electrochemical sensor of amplifying signal, comprises the following steps:
(1) target dna is mixed with 50nmol/L signal probe DNA, be mixed with hybridization solution;
(2) be placed on by the sensor prepared in the hybridization solution that step (1) obtains, hybridize 60min under 44 ° of C after, taking-up distilled water cleans, and nitrogen dries up;
(3) drip 3 μ lHRP-avidin enzyme solutions at electrode surface, under room temperature, react 30min, with the PBS washing lotion stirring and washing 5min containing 0.05%Tween-20;
(4) sensor is immersed in 1ml containing H
2o
2tmb substrate solution in, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve.
The DNA electrochemical sensor of based target repetitive dna sequence of the present invention self enhancing amplifying signal is applied to and detects the sensitivity of target dna, it is characterized in that: when capture probe DNA detects target dna,
(1) when hybridization reaction occurs for the target dna and capture probe DNA and signal probe DNA that contain one section of repetitive sequence, one times of biotin can be introduced at electrode surface, utilize the interaction of biotin and Avidin, one times of horseradish peroxidase can be introduced; Sensor is placed in containing substrate TMB and H
2o
2mensuration solution in, TMB is oxidized by one times of horseradish peroxidase enzyme catalytic at sensor surface, can be measured to the reduction current signal of TMB catalytic oxidation product one times under 0V current potential;
(2) when hybridization reaction occurs for the target dna and capture probe DNA and signal probe DNA that contain two sections of repetitive sequences, twice biotin can be introduced at electrode surface, utilize the interaction of biotin and Avidin, twice horseradish peroxidase can be introduced; Sensor is placed in containing substrate TMB and H
2o
2mensuration solution in, TMB is oxidized by twice horseradish peroxidase enzyme catalytic at sensor surface, can be measured to the reduction current signal of TMB catalytic oxidation product twice under 0V current potential.
The DNA electrochemical sensor of described based target repetitive dna sequence self enhancing amplifying signal is applied to and detects the sensitivity of target dna, it is characterized in that: when the concentration of the target dna containing two sections of repetitive sequences is within the scope of 0.01pmol/L ~ 5nmol/L, current signal increases gradually along with the increase of target sequence concentration, detects and is limited to 3.3fmol/L.
The DNA electrochemical sensor that based target repetitive dna sequence of the present invention self strengthens amplifying signal is used for gene order specific detection, it is characterized in that: when capture probe DNA detects target dna,
(1) when repetitive sequence target dna and capture probe DNA and signal probe DNA complementation, there is hybridization reaction, biotin can be introduced at electrode surface, utilize the interaction of biotin and Avidin, can horseradish peroxidase be introduced; Sensor is placed in containing substrate TMB and H
2o
2mensuration solution in, TMB is oxidized by horseradish peroxidase enzyme catalytic at sensor surface, can be measured to the reduction current signal of TMB catalytic oxidation product under 0V current potential;
(2) when hybridization reaction does not occur for repetitive sequence target dna and capture probe DNA or signal probe DNA complementation, then horseradish peroxidase cannot be introduced at electrode surface; Sensor is placed in containing substrate TMB and H
2o
2mensuration solution in, the reduction current signal of TMB catalytic oxidation product cannot be measured under 0V current potential.
Preparation and determination methods principle of the present invention and testing process are as shown in Figure 1.
To achieve these goals, the present invention is by the following technical solutions:
(1) design of probe
Select according in target-gene sequence the sequence (containing 30 bases) that one section of specificity is high, its complementary series is designed to capture probe DNA; The complementary series of repetitive sequence is designed to signal probe DNA.
(2) protein controls the structure at assembling probe identification interface
Be immersed in by gold electrode in bovine serum albumin solution, at room temperature after assembling, rinse electrode surface with distilled water, nitrogen dries up.Protein assembly interface is dripped and is coated with capture probe solution, after ambient temperatare puts assembling, with distilled water cleaning electrode interface, nitrogen dries up.
(3) DNA hybridization and detection
By containing certain density signal probe DNA with containing one section of repetitive sequence target dna be mixed with hybridization solution, the sensor prepared is placed in hybridization solution and carries out DNA hybridization.Take out sensor and use distilled water cleaning sensor interface, nitrogen dries up, and drips horseradish peroxidase-Avidin solution, react under room temperature at electrode surface, with containing after the phosphate washing lotion stirring and washing of Tween-20, carries out Electrochemical Detection immediately.
By containing certain density signal probe DNA with containing two sections of repetitive sequences target dna be mixed with hybridization solution, the sensor prepared is placed in hybridization solution and carries out DNA hybridization.Take out sensor and use distilled water cleaning sensor interface, nitrogen dries up, and drips horseradish peroxidase-Avidin solution, react under room temperature at electrode surface, with containing after the phosphate washing lotion stirring and washing of Tween-20, carries out Electrochemical Detection immediately.
(4) Electrochemical Detection
Using prepared sensor as working electrode, platinum electrode is to electrode, and Ag/AgCl is contrast electrode.Working electrode is immersed in the tmb substrate solution containing hydrogen peroxide, record current time curve.
Advantage of the present invention is: 1) the present invention devises a kind of new method, using the repetitive sequence fragment of target gene as specific targets DNA, design a kind of sandwich type DNA electrochemical sensor self strengthening amplifying signal and target dna is detected.Repetitive sequence extensively exists in genome, plays an important role in gene expression, regulation and control and heredity etc., has height polymorphism simultaneously, namely has well-conserved, can be used for distinguishing multiple different target gene.According to multiple repetitive sequence modelled signal probes of tubercle bacillus autogene sequence D Zone R, make a small amount of tubercle bacillus sequence in conjunction with multiple signal probe, thus amplify galvanochemistry corresponding signal in conjunction with multiple enzyme, substantially increase the sensitivity of method.2) when target DNA concentration is identical, sensed current signal containing two sections of repetitive sequences is higher than the twice of the sensed current signal containing one section of repetitive sequence, shown by the result of embodiment 3,4,5: the Novel DNA electrochemical sensor constructed by method of the present invention has the effect that target dna self strengthens amplifying signal, can realize the highly sensitive detection to the target gene containing repetitive sequence.3) the Novel DNA electrochemical sensor that the present invention utilizes constructed target dna self to strengthen amplification signal quantitatively detects tubercle bacillus gene sequence, observes the change of current value with target DNA concentration.Within the scope of 0.01pmol/L ~ 5nmol/L, current signal increases gradually along with the increase of the target DNA concentration containing two repetitive sequences, detects and is limited to 3.3fmol/L.Result shows, the Novel DNA electrochemical sensor that this target dna self strengthens amplification signal has higher sensitivity to complementary gene sequences identification.
Accompanying drawing explanation
Fig. 1 is the schematic diagram that based target repetitive dna sequence self strengthens the Novel DNA electrochemical sensor of amplifying signal.
Fig. 2 is that the target dna of Novel DNA electrochemical sensor detection containing one section of repetitive sequence is with or without hybridization reaction figure.
Fig. 3 A is target DNA concentration when being 5nmol/L, detects the graph of a relation of current value and the target DNA concentration containing two sections of repetitive sequences; In figure: T1 is expressed as the target dna containing a repetitive sequence; T2 is expressed as the target dna containing two repetitive sequences.
Fig. 3 B is target DNA concentration when being 1nmol/L, detects the graph of a relation of current value and the target DNA concentration containing two sections of repetitive sequences; In figure: T1 is expressed as the target dna containing a repetitive sequence; T2 is expressed as the target dna containing two repetitive sequences.
Fig. 3 C is target DNA concentration when being 100pmol/L, detects the graph of a relation of current value and the target DNA concentration containing two sections of repetitive sequences; In figure: T1 is expressed as the target dna containing a repetitive sequence; T2 is expressed as the target dna containing two repetitive sequences.
Fig. 4 is that target gene repetitive sequence self strengthens amplification electrochemical response signal graph.
Embodiment
As shown in Figure 1, based target gene repeat sequence of the present invention self strengthens the Novel DNA electrochemical sensor of amplifying signal, comprise electrode, bovine serum albumin(BSA) 2, capture probe DNA3, signal probe DNA, target dna and horseradish peroxidase-Avidin, horseradish peroxidase-Avidin refers to that horseradish peroxidase adopts Avidin mark, the preferred gold electrode 1 of electrode, the single stranded DNA of the preferred sulfydryl modification of capture probe DNA, the single stranded DNA of the preferred biotin modification of signal probe DNA, target dna adopts the target dna 4 containing repetitive sequence, the target dna 4 of repetitive sequence preferably Prof. Du Yucang containing one section of repetitive sequence or the single stranded DNA containing two sections of repetitive sequences, Prof. Du Yucang be adopt prior art synthesis containing one section of repetitive sequence or containing the single stranded DNA of two sections of repetitive sequences, Prof. Du Yucang technology is the technology that those skilled in the art can realize, first at gold electrode surfaces ordered fabrication one deck bovine serum albumin(BSA) (BSA) molecular layer, utilize the ordered pore assembling capture probe between protein molecule.Target dna and signal probe DNA are mixed with hybridization solution by finite concentration ratio.Capture probe DNA is placed in hybridization solution, carry out hybridization reaction at a certain temperature, in the process, there is abundant hybridization reaction in the repetitive sequence in signal probe DNA and target dna, form the dsDNA-ssDNA-dsDNA-ssDNA-that stable double-strand and strand are alternately arranged ...-ssDNA-dsDNA compound, target dna is made to combine upper multiple signal probe DNA, simultaneously, one section complementary mutually in capture probe DNA and target dna there is hybridization reaction, thus realize the identification of capture probe DNA to stable compound, namely to the identification of target dna.Multiple end modified signal probe DNA5 of biotin be connected in biotin on signal probe and Fig. 1 can be introduced at electrode surface by hybridization reaction, utilize the interaction of biotin and Avidin, the end modified horseradish peroxidase 6 of Avidin be connected in multiple horseradish peroxidase on horseradish peroxidase-Avidin and Fig. 1 can be introduced.Sensor is placed in containing substrate TMB and H
2o
2mensuration solution in, TMB can amplify redox reaction at sensor surface by the catalysis of multiple horseradish peroxidase, under set potential, measure the reduction current signal of TMB catalytic oxidation product, then this current signal is amplified, and signal magnitude is relevant to the concentration of target dna.
Embodiment 1:
The preparation process strengthening the DNA electrochemical sensor of amplification signal based on gene repeat sequence self is as follows:
(1) gold electrode is in the Piranha solution (H of 30wt%
2o
2with the dense H of concentration 98wt%
2sO
4, mix with the volume ratio of 1:3) in room temperature leave standstill 5min, with deionized water ultrasonic cleaning 2 times, each 5min, then uses 0.3 μm, 0.05 μm Al respectively
2o
3be polished to minute surface with the potpourri of distilled water, use ethanol, distilled water ultrasonic cleaning successively.Ultrasonic good electrode is placed in 0.5MH
2sO
4in, at 0 ~ 1.6V potential range cyclic voltammetry scan to stable, with distilled water cleaning, N
2dry up rear stand-by;
(2) be immersed in the BSA solution of 0.1wt% by the naked gold electrode that step (1) is handled well, after at room temperature assembling 15min, with distilled water cleaning, nitrogen dries up, and gets 4 μ l capture probe DNA(5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT
10-(CH
2)
6-SH-3 ') solution (1 μm of ol/L, oligonucleotides are synthesized by Bao Sheng bioengineering company limited), drip and be coated onto electrode surface, after room temperature places 1h, rinse electrode surface with distilled water, nitrogen dries up.
Embodiment 2:
The detecting step of DNA electrochemical sensor to target dna strengthening amplification signal based on gene repeat sequence self is as follows:
(1) by signal probe DNA(5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ') (oligonucleotides, by Bao Sheng bioengineering company limited synthesize) with the target dna (5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAAC-3 ') containing one section of repetitive sequence at hybridization buffer (by 10mmol/LNa
2hPO
4-NaH
2pO
4with 1mol/LNaCl preparation, and use H
3pO
4regulate pH to 7.40 with NaOH, experimental water is distilled water) middle mixing, be mixed with hybridization solution.
(2) capture probe the DNA(5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT being fixed on electrode surface of embodiment 1 acquisition
10-(CH
2)
6-SH-3 ') hybridize 60min with step (1) gained hybridization solution 44 DEG C of water-baths, form double-stranded DNA, use the PBS damping fluid of pH7.40 successively, distilled water cleans, and nitrogen dries up.Drip 3 μ lHRP-avidin solution (1.0U/mL) at electrode surface, under room temperature, react 30min, with containing after the PBS washing lotion stirring and washing 5min of 0.05wt%Tween-20, carry out Electrochemical Detection immediately;
(3) be immersed in 1mlTMB substrate solution (K-blue, Neogencorporation) by the electrode that step (2) is obtained, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve (initial potential: 0 volt; Sampling interval: 0.1 second; Sampling time: 100 seconds).Measurement result is shown in Fig. 2.
Can find out that the hybridization reaction of Novel DNA electrochemical sensor to the target dna (10nmol/L) containing one section of repetitive sequence constructed by utilization detects from Fig. 2 result.A () is the electric current corresponding signal (109.6nA) not containing sensor during target dna, (b) is the electric current corresponding signal (3240nA) containing sensor during target dna.Result shows, constructed Novel DNA electrochemical sensor can be used for identifying target dna sequence.
Embodiment 3:
The detecting step of DNA electrochemical sensor to target dna strengthening amplification signal based on gene repeat sequence self is as follows:
(1) by signal probe DNA(5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ') (50nmol/L oligonucleotides, synthesized by Bao Sheng bioengineering company limited) with containing the target dna (5nmol/L of two sections of repetitive sequences, 5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCC GCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3 ') at hybridization buffer (by 10mmol/LNa
2hPO
4-NaH
2pO
4with 1mol/LNaCl preparation, and use H
3pO
4regulate pH to 7.40 with NaOH, experimental water is distilled water) middle mixing, be mixed with hybridization solution.
(2) capture probe the DNA(5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT being fixed on electrode surface of embodiment 1 acquisition
10-(CH
2)
6-SH-3 ') hybridize 60min with step (1) gained hybridization solution 44 DEG C of water-baths, form the dsDNA-ssDNA-dsDNA-ssDNA-dsDNA compound that stable double-strand and strand replace, use distilled water cleaning electrode, nitrogen dries up.Drip 3 μ lHRP-avidin solution (1.0U/mL) at electrode surface, under room temperature, react 30min, with containing after the PBS washing lotion stirring and washing 5min of 0.05wt%Tween-20, carry out Electrochemical Detection immediately;
(3) be immersed in 1mlTMB substrate solution (K-blue, Neogencorporation) by the electrode that step (2) is obtained, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve (initial potential: 0 volt; Sampling interval: 0.1 second; Sampling time: 100 seconds).Measurement result is shown in Fig. 3 A.
As can be seen from Fig. 3 A result, when target DNA concentration is 5nmol/L, be respectively 5576nA, 2582nA containing two sections of repetitive sequences and the sensed current signal containing one section of repetitive sequence; Result shows, when target DNA concentration is identical, the sensed current signal containing two sections of repetitive sequences is higher than the twice of the sensed current signal containing one section of repetitive sequence.Embodiment 4:
The detecting step of DNA electrochemical sensor to target dna strengthening amplification signal based on gene repeat sequence self is as follows:
(1) by signal probe DNA(5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ') (50nmol/L, oligonucleotides, synthesized by Bao Sheng bioengineering company limited) with containing the target dna (1nmol/L of two sections of repetitive sequences, 5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCC GCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3 ') at hybridization buffer (by 10mmol/LNa
2hPO
4-NaH
2pO
4with 1mol/LNaCl preparation, and use H
3pO
4regulate pH to 7.40 with NaOH, experimental water is distilled water) middle mixing, be mixed with hybridization solution.
(2) capture probe the DNA(5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT being fixed on electrode surface of embodiment 1 acquisition
10-(CH
2)
6-SH-3 ') hybridize 60min with step (1) gained hybridization solution 44 DEG C of water-baths, form the dsDNA-ssDNA-dsDNA-ssDNA-dsDNA compound that stable double-strand and strand replace, use distilled water cleaning electrode, nitrogen dries up.Drip 3 μ lHRP-avidin solution (1.0U/mL) at electrode surface, under room temperature, react 30min, with containing after the PBS washing lotion stirring and washing 5min of 0.05wt%Tween-20, carry out Electrochemical Detection immediately;
(3) be immersed in 1mlTMB substrate solution (K-blue, Neogencorporation) by the electrode that step (2) is obtained, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve (initial potential: 0 volt; Sampling interval: 0.1 second; Sampling time: 100 seconds).Measurement result is shown in Fig. 3 B.
As can be seen from Fig. 3 B result, when target DNA concentration is 1nmol/L, be respectively 2534nA, 1260nA containing two sections of repetitive sequences and the sensed current signal containing one section of repetitive sequence; Result shows, when target DNA concentration is identical, the sensed current signal containing two sections of repetitive sequences is higher than the twice of the sensed current signal containing one section of repetitive sequence.
Embodiment 5:
The detecting step of DNA electrochemical sensor to target dna strengthening amplification signal based on gene repeat sequence self is as follows:
(1) by signal probe DNA(5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ') (50nmol/L, oligonucleotides, synthesized by Bao Sheng bioengineering company limited) with containing the target dna (100pmol/L of two sections of repetitive sequences, 5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCC GCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3 ') at hybridization buffer (by 10mmol/LNa
2hPO
4-NaH
2pO
4with 1mol/LNaCl preparation, and use H
3pO
4regulate pH to 7.40 with NaOH, experimental water is distilled water) middle mixing, be mixed with hybridization solution.
(2) capture probe the DNA(5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT being fixed on electrode surface of embodiment 1 acquisition
10-(CH
2)
6-SH-3 ') hybridize 60min with step (1) gained hybridization solution 44 DEG C of water-baths, form the dsDNA-ssDNA-dsDNA-ssDNA-dsDNA compound that stable double-strand and strand replace, use distilled water cleaning electrode, nitrogen dries up.Drip 3 μ lHRP-avidin solution (1.0U/mL) at electrode surface, under room temperature, react 30min, with containing after the PBS washing lotion stirring and washing 5min of 0.05wt%Tween-20, carry out Electrochemical Detection immediately;
(3) be immersed in 1mlTMB substrate solution (K-blue, Neogencorporation) by the electrode that step (2) is obtained, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve (initial potential: 0 volt; Sampling interval: 0.1 second; Sampling time: 100 seconds).Measurement result is shown in Fig. 3 C.
As can be seen from Fig. 3 C result, when target DNA concentration is 100pmol/L, be respectively 1340nA, 618.2nA containing two sections of repetitive sequences and the sensed current signal containing one section of repetitive sequence.Result shows, when target DNA concentration is identical, the sensed current signal containing two sections of repetitive sequences is higher than the twice of the sensed current signal containing one section of repetitive sequence.
Above embodiment 3,4,5 shows: the Novel DNA electrochemical sensor constructed by the method has the effect that target dna self strengthens amplifying signal, can realize the highly sensitive detection to the target gene containing repetitive sequence.
Embodiment 6:
The preparation of DNA electrochemical sensor of amplification signal and as follows to the detecting step of repetitive sequence target dna is strengthened based on gene repeat sequence self:
(1) by signal probe DNA(5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ') (50nmol/L, oligonucleotides, by Bao Sheng bioengineering company limited synthesize) with variable concentrations (0.01pmol/L ~ 5nmol/L) target dna containing two sections of repetitive sequences (5 '-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGAC CCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCC GCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3 ') at hybridization buffer (by 10mmol/LNa
2hPO
4-NaH
2pO
4with 1mol/LNaCl preparation, and use H
3pO
4regulate pH to 7.40 with NaOH, experimental water is distilled water) middle mixing, be mixed with hybridization solution.
(2) capture probe the DNA(5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT being fixed on electrode surface of embodiment 1 acquisition
10-(CH
2)
6-SH-3 ') hybridize 60min with step (1) gained hybridization solution 44 DEG C of water-baths, form the dsDNA-ssDNA-dsDNA-ssDNA-dsDNA compound that stable double-strand and strand replace, use distilled water cleaning electrode, nitrogen dries up.Drip 3 μ lHRP-avidin solution (1.0U/mL) at electrode surface, under room temperature, react 30min, with containing after the PBS washing lotion stirring and washing 5min of 0.05wt%Tween-20, carry out Electrochemical Detection immediately;
(3) be immersed in 1mlTMB substrate solution (K-blue, Neogencorporation) by the electrode that step (2) is obtained, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve (initial potential: 0 volt; Sampling interval: 0.1 second; Sampling time: 100 seconds).The results are shown in Figure 4.
As can be seen from Fig. 4 result, the Novel DNA electrochemical sensor that the target dna constructed by utilization self strengthens amplification signal quantitatively detects tubercle bacillus gene sequence, observes the change of current value with target DNA concentration.Within the scope of 0.01pmol/L ~ 5nmol/L, current signal increases gradually along with the increase of the target DNA concentration containing two repetitive sequences, detects and is limited to 3.3fmol/L.Result shows, the Novel DNA electrochemical sensor that this target dna self strengthens amplification signal has higher sensitivity to complementary gene sequences identification.
Claims (1)
1. based target repetitive dna sequence self strengthens a detection method for the DNA electrochemical sensor of amplifying signal, comprises the following steps:
(1) target dna is mixed with 50nmol/L signal probe DNA, be mixed with hybridization solution;
(2) DNA electrochemical sensor is placed in the hybridization solution that step (1) obtains, 44
?after hybridizing 60min under C, taking-up distilled water cleans, and nitrogen dries up;
(3) drip 3 μ lHRP-avidin enzyme solutions at the electrode surface of the DNA electrochemical sensor processed through step (2), under room temperature, react 30min, with the PBS washing lotion stirring and washing 5min containing 0.05%Tween-20;
(4) the DNA electrochemical sensor processed through step (3) is immersed in 1ml containing H
2o
2tmb substrate solution in, be to electrode with platinum electrode, Ag/AgCl is contrast electrode, record current-time curve;
Described DNA electrochemical sensor is prepared as follows:
(1) protein controls the structure of assembled interface: be immersed in by gold electrode in the bovine serum albumin(BSA) BSA solution of 0.1wt%, and after at room temperature assembling 15min, with distilled water cleaning, nitrogen dries up;
(2) assembling of capture probe: get capture probe DNA solution, drips and is coated onto the gold electrode surfaces of assembling bovine serum albumin(BSA) BSA, and after room temperature places 1h, rinse electrode surface with distilled water, nitrogen dries up;
Described capture probe DNA is 5 '-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT
10-(CH
2)
6-SH-3 ', described signal probe DNA is 5 '-GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3 ', and described target dna is
5’-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCCGCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310031332.1A CN103175873B (en) | 2013-01-27 | 2013-01-27 | Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310031332.1A CN103175873B (en) | 2013-01-27 | 2013-01-27 | Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103175873A CN103175873A (en) | 2013-06-26 |
| CN103175873B true CN103175873B (en) | 2015-11-18 |
Family
ID=48635875
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310031332.1A Expired - Fee Related CN103175873B (en) | 2013-01-27 | 2013-01-27 | Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103175873B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3321376A1 (en) * | 2016-11-11 | 2018-05-16 | Genomica S.A.U. | Electrochemical dna detection |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104698043A (en) * | 2013-12-09 | 2015-06-10 | 重庆医科大学 | An electrochemical biosensor for detecting DNA of escherichia coli and a preparing method thereof |
| CN104020198B (en) * | 2014-06-18 | 2016-05-18 | 青岛科技大学 | A kind of signal amplification technique electrochemical sensor detects the method for DNA |
| CN106872541B (en) * | 2015-12-10 | 2019-10-01 | 中山和芯生物技术有限公司 | A kind of probe system and its application for bio-sensor signal amplification |
| CN106338539B (en) * | 2016-11-03 | 2019-07-12 | 上海市计量测试技术研究院 | DNA capture probe, biosensor and its detection method based on polyadenous purine |
| CN106596662B (en) * | 2016-12-08 | 2019-07-12 | 福州大学 | A kind of electrochemical DNA biosensor of temperature-controllable and preparation method thereof |
| CN106596675A (en) * | 2016-12-19 | 2017-04-26 | 福州大学 | Temperature-controllable enzymatic catalysis-based type electrochemical hydrogen peroxide sensor |
| CN110706738B (en) * | 2019-10-30 | 2020-11-20 | 腾讯科技（深圳）有限公司 | Method, device, equipment and storage medium for predicting structure information of protein |
| CN110988078B (en) * | 2019-11-25 | 2022-07-26 | 上海市计量测试技术研究院 | Electrochemical sensing detection system based on poly-adenine and multi-signal system and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102539494A (en) * | 2012-01-12 | 2012-07-04 | 福建医科大学 | Amperometric DNA (deoxyribonucleic acid) electrochemical sensor based on protein controlled assembling interface |
-
2013
- 2013-01-27 CN CN201310031332.1A patent/CN103175873B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102539494A (en) * | 2012-01-12 | 2012-07-04 | 福建医科大学 | Amperometric DNA (deoxyribonucleic acid) electrochemical sensor based on protein controlled assembling interface |
Non-Patent Citations (2)
| Title |
|---|
| Bovine Serum Albumin-Based Probe Carrier Platform for Electrochemical DNA Biosensing;Yin-Huan Liu, et al.;《Analytical Chemistry》;20121205;第85卷;第273-277页 * |
| 快速检测结核杆菌DNA电化学传感技术的研究;洪国粦 等;《中华实验外科杂志》;20121130;第29卷(第11期);第2286-2288页 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3321376A1 (en) * | 2016-11-11 | 2018-05-16 | Genomica S.A.U. | Electrochemical dna detection |
| WO2018087303A1 (en) * | 2016-11-11 | 2018-05-17 | Genomica, S.A.U. | Electrochemical dna detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103175873A (en) | 2013-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103175873B (en) | Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal | |
| US20220099613A1 (en) | Active-electrode integrated biosensor array and methods for use thereof | |
| Liu et al. | Sensitive electrochemical assay of alkaline phosphatase activity based on TdT-mediated hemin/G-quadruplex DNAzyme nanowires for signal amplification | |
| Gau et al. | Electrochemical molecular analysis without nucleic acid amplification | |
| WO2016062101A1 (en) | Modified electrode for detecting ndm-1 and preparation method therefor and use thereof | |
| Chen et al. | An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters | |
| Wu et al. | Heating enhanced sensitive and selective electrochemical detection of Hg2+ based on T-Hg2+-T structure and exonuclease III-assisted target recycling amplification strategy at heated gold disk electrode | |
| Kou et al. | DNA enzyme-decorated DNA nanoladders as enhancer for peptide cleavage-based electrochemical biosensor | |
| Zhuang et al. | Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction | |
| Deng et al. | A highly sensitive microRNA biosensor based on hybridized microRNA-guided deposition of polyaniline | |
| Mohan et al. | A highly sensitive graphene oxide based label-free capacitive aptasensor for vanillin detection | |
| CN101094923A (en) | Method for detecting DNA point mutations (single nucleotide polymorphism (SNP) analysis) and associated arrangement | |
| Bai et al. | Amperometric aptasensor for thrombin detection using enzyme-mediated direct electrochemistry and DNA-based signal amplification strategy | |
| Shen et al. | G‐Quadruplex‐Based DNAzymes Aptasensor for the Amplified Electrochemical Detection of Thrombin | |
| Wain et al. | Scanning electrochemical microscopy imaging of DNA microarrays using methylene blue as a redox-active intercalator | |
| Zhang et al. | Scanning electrochemical microscopy assay of DNA based on hairpin probe and enzymatic amplification biosensor | |
| CN106568820A (en) | Preparation method for synthesizing silver nanocluster electrochemical biosensor based on DNA signal amplification technique and application of electrochemical biosensor | |
| CN109613095A (en) | Terminal enzyme (DNA) electrochemica biological sensor preparation method and application based on i-motif change of configuration | |
| Liao et al. | Hybridization chain reaction triggered poly adenine to absorb silver nanoparticles for label-free electrochemical detection of Alzheimer's disease biomarkers amyloid β-peptide oligomers | |
| Song et al. | Electrochemical immunoassay for CD10 antigen using scanning electrochemical microscopy | |
| Tang et al. | Electrochemical detection of hepatitis C virus with signal amplification using Bam HI endonuclease and horseradish peroxidase-encapsulated nanogold hollow spheres | |
| Liu et al. | An antifouling interface integrated with HRP-based amplification to achieve a highly sensitive electrochemical aptasensor for lysozyme detection | |
| CN102539494B (en) | Amperometric DNA (deoxyribonucleic acid) electrochemical sensor based on protein controlled assembling interface | |
| Lu et al. | An electrochemical aptasensor based on dual-enzymes-driven target recycling strategy for patulin detection in apple juice | |
| Wang et al. | Coupling of background reduction with rolling circle amplification for highly sensitive protein detection via terminal protection of small molecule-linked DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151118 Termination date: 20190127 |