CN106872541B - A kind of probe system and its application for bio-sensor signal amplification - Google Patents

A kind of probe system and its application for bio-sensor signal amplification Download PDF

Info

Publication number
CN106872541B
CN106872541B CN201510909034.7A CN201510909034A CN106872541B CN 106872541 B CN106872541 B CN 106872541B CN 201510909034 A CN201510909034 A CN 201510909034A CN 106872541 B CN106872541 B CN 106872541B
Authority
CN
China
Prior art keywords
probe
signal
dna
electrode
amplification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510909034.7A
Other languages
Chinese (zh)
Other versions
CN106872541A (en
Inventor
李科铮
吴宇亮
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhongshan core Biotechnology Co., Ltd.
Original Assignee
Zhongshan Core Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhongshan Core Biotechnology Co Ltd filed Critical Zhongshan Core Biotechnology Co Ltd
Priority to CN201510909034.7A priority Critical patent/CN106872541B/en
Publication of CN106872541A publication Critical patent/CN106872541A/en
Application granted granted Critical
Publication of CN106872541B publication Critical patent/CN106872541B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28Electrolytic cell components
    • G01N27/30Electrodes, e.g. test electrodes; Half-cells

Abstract

The present invention is suitable for electrochemica biological sensor field, provide a kind of probe system for bio-sensor signal amplification, including connector probe and the signal enlarged structure being connect with the connector probe, wherein, the connector probe include 3 ' ends it is complementary with target gene in conjunction with first area and the second area that is connect with the signal enlarged structure, the second area includes 2-4 identical sequence units, is provided with base intervals between the sequence units;The signal enlarged structure includes 2-4 independent signal amplification units, the signal amplification unit is made of signal probe with the series connection marker that the signal probe 5 ' is held is connected to, signal probe connection complementary with the sequence units, the series connection marker are made of 2-4 concatenated markers.The present invention also provides a kind of detection methods of electrochemical signals amplification based on DNA/RNA hybridization concatenated probes.

Description

A kind of probe system and its application for bio-sensor signal amplification
Technical field
The invention belongs to electrochemica biological sensor field more particularly to a kind of spies for bio-sensor signal amplification Needle body system and its application.
Background technique
Hypersensitive nucleic acid detection technique is detected in virus, pathogen, genopathy etc. and its fields such as diagnosis are widely used. Such as fluorescent quantitative PCR technique, rolling circle amplification (RCA) trace dna detection technique is based on polymerase chain reaction and fluorescence Signal detecting method reaches trace dna quantitatively or detects, but there are operating procedure complexity, optical signallings to visit for these detection methods Needle is expensive, needs the problems such as particular detection instrument.Electrochemical sensing technology is always most widely used biomedical and chemistry Analysis test platform has the advantages such as simple, portable, inexpensive, high detection sensitivity.Novel electrochemica biological sensor Before the medical domains such as bedside care diagnostic (Point-Of-Care), minimally invasive detection, antibiotic usage guidance have huge application Scape.
Traditional electrochemical nucleic acid detection sensor is mainly based on " sandwich " basic structure detection mode, i.e. target base Because the one end of (TP) hybridizes with the capture probe (CP) containing its homologous complementary sequence, the other end and signal probe of target gene are mutual Hybridization is mended, the variation of front and back electrochemical parameter (electric current, potential, conductance, impedance, capacitor) is hybridized by detection to detect target DNA.Traditional " sandwich " electrochemical method, the corresponding target dna of a signal probe (DP), when target dna content mistake Low, the reasons such as limitation of sensing detection method sensitivity itself will lead to background signal and be difficult to distinguish with faint hybridization signal. In fields such as disease early diagnosis, minimally invasive detection, food safeties, highly sensitive biosensor is needed.The electrochemistry of DNA at present There are two main classes for amplification detecting process: target amplification and signal amplification.Target scale-up version DNA sensor mainly passes through nucleic acid body Outer amplification technique improves target DNA concentration and realizes Trace DNA analysis to detection level, but this method needs to be equipped with expensive instrument Device equipment and complicated operating procedure, the problems such as being easy to appear false positive.
Summary of the invention
The purpose of the present invention is to provide a kind of probe systems for bio-sensor signal amplification, it is intended to solve existing Low, the complicated for operation or expensive instrument and equipment problem of biosensor sensitivity.
Another object of the present invention is to provide a kind of electrochemical signals amplifications based on DNA/RNA hybridization concatenated probes Detection method.
The invention is realized in this way a kind of probe system for bio-sensor signal amplification, including connector probe The signal enlarged structure being connect with the connector probe,
Wherein, the connector probe include 3 ' end it is complementary with target gene in conjunction with first area and with the signal amplification knot The second area of structure connection, the second area include 2-4 identical sequence units, are provided with alkali between the sequence units Base interval;
The signal enlarged structure includes 2-4 independent signal amplification units, and the signal amplification unit is visited by signal Needle and the series connection marker composition for being connected to the end of signal probe 5 ', the signal probe is complementary with the sequence units to be connected It connects, the series connection marker is made of 2-4 concatenated markers.
And a kind of detection method of the electrochemical signals amplification based on DNA/RNA hybridization concatenated probes, including following step It is rapid:
Design provides capture probe, probe tip and the signal enlarged structure of sample to be tested;
Electrode group is provided, the electrode group includes working electrode, auxiliary electrode and reference electrode, and the electrode is lived Change processing is fixed after the capture probe on the working electrode and carries out mercaptoethanol closing to the working electrode, obtains The DNA/RNA detection chip of capture probe specific recognition target gene;
The target gene of sample to be tested, the probe tip and the signal enlarged structure are mixed to get detection liquid;
Liquid is detected described in drop coating in the DNA/RNA detection chip, processing is incubated for and forms DNA/RNA hybridization concatenated probes Chip, wherein the DNA/RNA hybridization concatenated probes includes the above-mentioned probe system for bio-sensor signal amplification, First area combination complementary with the target gene in the connector probe;
Detect the current signal of the DNA/RNA hybridization concatenated probes.
Provided by the present invention for the probe system of bio-sensor signal amplification, by the connector probe The signal enlarged structure of the second area binding signal probe hybridization series connection marker of (adapter probe, AP), and institute Stating signal enlarged structure includes 2-4 independent signal amplification units, and the series connection marker includes 2-4 concatenated labels Signal averaging enlarged structure is consequently formed in object, amplifies the electrochemical signals of the marker connected on the signal probe, thus Improve sensitivity.
The detection method of electrochemical signals amplification provided by the invention based on DNA/RNA hybridization concatenated probes, this method Have many advantages, such as that simply controllable, detection limit is low and signal is easy to acquire, can quickly detect the concentration of sample to be tested, and sensitivity It is high.
Detailed description of the invention
Fig. 1 is the probe system schematic diagram provided in an embodiment of the present invention for bio-sensor signal amplification;
Fig. 2 is the detection that the use that the embodiment of the present invention 1 provides is amplified based on the electrochemical signals of DNA hybridization concatenated probes The e. coli dna concentration map that method measures;
Fig. 3 is that tradition " sandwich formula " the DNA sensing chip detection bacillus coli gene detection method that comparative example provides is surveyed The e. coli dna fragment concentrations gradient map obtained.
Specific embodiment
In order to which technical problems, technical solutions and advantageous effects to be solved by the present invention are more clearly understood, below in conjunction with Accompanying drawings and embodiments, the present invention will be described in further detail.It should be appreciated that specific embodiment described herein is only used To explain the present invention, it is not intended to limit the present invention.
In conjunction with Fig. 1, the embodiment of the invention provides a kind of probe systems for bio-sensor signal amplification, including connect Head probe 3 and the signal enlarged structure 4 being connect with the connector probe 3, wherein the connector probe 3 includes 3 ' ends and target base Because 2 it is complementary in conjunction with first area 31 and the second area 32 that connect with the signal enlarged structure 4, the packet of second area 32 2-4 identical sequence units are included, are provided with base intervals between the sequence units;
The signal enlarged structure 4 includes 2-4 independent signal amplification units 41, and the signal amplification unit 41 is by believing Number probe 411 and the series connection markers 412 at 5 ' ends for being connected to the signal probe 411 form, the signal probe 411 and institute Sequence units complementation connection is stated, the series connection marker 412 is made of 2-4 concatenated markers.
Specifically, the connector probe 3 is divided into two regions according to the difference of connecting object in the embodiment of the present invention, tool Body, the first area 31 and 5 ' including 3 ' end combinations complementary with target gene 2 holds connect with the signal enlarged structure 4 second Region 32.5 ' ends of the connector probe 3 are arranged in the signal enlarged structure 4 by the embodiment of the present invention, main reason is that The signal enlarged structure 4 formed is closer with the aftermentioned electrode 5 mentioned, is easily obtained electrochemical signals.
As a preferred embodiment, the base number of first area 31 described in the embodiment of the present invention is 15-25.This is suitable Base number will not cause top-cross since length is too long because of the too long increase design difficulty of length, or in hybrid process;Also not Can be inadequate due to the too short binding force of length, it is not enough to carry the signal enlarged structure 4 of its 5 ' section connection.
The second area 32 is the region connecting with the signal enlarged structure 4.The second area 32 is according to 2-4 The corresponding complementary signal probe 411 includes 2-4 identical sequence units.As a preferred embodiment, the sequence units Sequence are as follows: 5'-CAACCTTCCCTCATTT-3'.
In order to weaken the space steric effect when signal probe series connection hybridization, it is provided between each sequence units Base intervals.As a preferred embodiment, the base intervals are made of two A bases.The preferred base number and base class Type can guarantee suitable space length between the sequence units, and can also guarantee hybridization efficiency when hybridization and accurate Property.
The signal enlarged structure 4 is the functional structure for amplifying biosensor electrochemical signals, and the signal is put The number of signal probe amplifying unit in big structure 4, is affected to the enlarging function of electrochemical signals, when the signal probe For the number of amplifying unit 41 in two or more, signal amplifies the test request that can satisfy various sample concentrations substantially, and The number of the signal probe amplifying unit 41 is more, and the biosensor test sensitivity is relatively higher;When the signal At four or more, signal amplification tends towards stability the number of probe amplifying unit 41 substantially.Therefore, as preferred implementation Example, the number of the signal probe amplifying unit 41 are preferably 2-4.Based on similar reason, the number of the marker When preferably 2-4, described and marker number are excessive, biggish steric hindrance easy to form influences test result.
As a preferred embodiment, the sequence of the signal probe 411 is corresponding are as follows: 5'-AAATGAGGGAAGGTTG-3'.Institute Stating marker is preferably at least one of ferrocene, fluorescein, biotin, methylene blue.Further, due to ferrocene Matter stabilization is not influenced by the variation of oxygen concentration in environment, and solubility in water is small, and electronics special delivery speed is fast, oxidation-reduction potential Low, it is preferable to use ferrocene as marker in the embodiment of the present invention.Using ferrocene as the label of the signal probe 411 Object, in conjunction with electrolyte intermediate ion after, oxidation-reduction potential changes, to realize the detection method of 2 segment of target gene.It is logical The electric signal superposition amplification for crossing the marker on multiple signal probes 411 that the connector probe 3 captures, realizes biology The detection sensitivity that sensing chip detects target nucleic acid fragment improves, up to below fM rank.
As a preferred embodiment, the second area 32 includes 4 identical sequence units, the signal amplification knot Structure 4 includes 4 independent signal amplification units 41, and the series connection marker 412 is made of 4 concatenated markers.
In addition, the probe system described in the embodiment of the present invention for bio-sensor signal amplification further includes target gene 2, catches Obtain probe 1 and electrode 5, the knot complementary with the target gene 1 respectively of first area 31 of the capture probe 1, the probe tip 3 It closes, described 1 one end of capture probe is connect with the electrode 5.The thus obtained probe body for bio-sensor signal amplification System, is by being fixed on the capture probe 1 of gold electrode surfaces and 2 complementary sequence hybridization of target gene, Acquisition Detection sample Target fragment in product, then pass through the hybridizing of the first area 31 of the connector probe 3 and the target gene 2, secondth area The signal enlarged structure 4 that domain 32 hybridizes with the connection of signal probe polymer forms multi signal superposition amplification multimeric structure.
Further, as a preferred embodiment, in order to enable the signal enlarged structure connected in the probe tip 3 4 with being closer of the electrode 5, to preferably obtain electrochemical signals, the capture probe 1, probe tip 3 respectively with 0-12 bp is differed between the binding site that the target gene 2 engages.Further, the electrode 5 is preferably gold electrode.
Probe system provided in an embodiment of the present invention for bio-sensor signal amplification, by the connector probe The signal enlarged structure of the second area binding signal probe hybridization series connection marker of (adapter probe, AP), and institute Stating signal enlarged structure includes 2-4 independent signal amplification units, and the series connection marker includes 2-4 concatenated labels Signal averaging enlarged structure is consequently formed in object, amplifies the electrochemical signals of the marker connected on the signal probe, thus Improve sensitivity.
Correspondingly, the embodiment of the invention also provides a kind of electrochemical signals based on DNA/RNA hybridization concatenated probes to put Big detection method, comprising the following steps:
S01. design provides capture probe, probe tip and the signal enlarged structure of sample to be tested;
S02., electrode group is provided, the electrode group includes working electrode, auxiliary electrode and reference electrode, by the electrode into Row is activated, and is fixed after the capture probe on the working electrode and is carried out mercaptoethanol closing to the working electrode, Obtain the DNA/RNA detection chip of capture probe specific recognition target gene;
S03. the target gene of sample to be tested, the probe tip and the signal enlarged structure are mixed to get detection Liquid;
S04. liquid is detected described in drop coating in the DNA/RNA detection chip, processing is incubated for and forms DNA/RNA hybridization series connection Probe chip, wherein the DNA/RNA hybridization concatenated probes includes the above-mentioned probe body for bio-sensor signal amplification It is that the first area in the connector probe is complementary with the target gene to combine;
S05. the current signal of the DNA/RNA hybridization concatenated probes is detected.
Specifically, the design of the capture probe, probe tip and signal enlarged structure can adopt in above-mentioned steps S01 With computer software process quality.The capture probe, probe tip and signal enlarged structure preferentially screen specific high, sensitivity and Reproducible best probe combinations.Wherein, firstth area that the capture probe, the probe tip are connect with target gene Domain should be designed according to the sequence of target gene.As specific embodiment, synthesis target-gene sequence, Jin Ertong can be first designed Cross the first area of probe tip described in the target gene Series Design.Wherein, the design of the synthesis target-gene sequence, can be with By having delivered related core reported in the literature to the existing sample to be tested gene order of Genebank database and both at home and abroad Acid sequence carries out sequence alignment analysis, with sample to be tested gene without secondary structure and highly conserved section, is visited according to primer Basic principle of the needle without mispairing, utilizes software process quality.
In above-mentioned steps S02, it is preferable to use film gold electrodes for the electrode group.The method of the activation processing can use Conventional method in that art is realized, concretely, electrode is immersed in the dilute sulfuric acid of 0.1M, and electrification is carried out within the scope of 0-1.2V Activation is learned, with ultrapure water electrode surface 10s, then thorough cleaning electrode happiness acid remained on surface is dried with nitrogen.
The method that the embodiment of the present invention fixes the capture probe on the working electrode is conventional method in that art.Make For a specific embodiment, the 1 μ L capture probe aqueous solution of drop coating on the working electrode, 25 DEG C of water-baths stand 2 hours, described After capture probe is fixed, with ultrapure water electrode surface 10 seconds, it is dried with nitrogen.The closed method of mercaptoethanol, Ability can also be used and conventional method is realized, concretely: 1 μ of drop coating on the working electrode for securing the capture probe The mercaptoethanol aqueous solution of L1mM, 25 DEG C of water-baths stand 2 hours, with being dried with nitrogen after ultrapure water, are formed in electrode surface Capture probe/mercaptoethanol composite layer.
In above-mentioned steps S03, it is described detection liquid should be include target gene, include signal probe signal amplification knot The mixed solution of structure, probe tip.
In above-mentioned steps S04, as a preferred embodiment, the temperature for being incubated for processing is 25-42 DEG C, time 10- 60min.Further, the temperature for being incubated for processing is 35 DEG C, time 15min.In detection method of the embodiment of the present invention, by In the probe system containing signal enlarged structure that forms, detection sensitivity is improved, and hybridization time is substantially shorter.
In above-mentioned steps S05, DNA/RNA hybridization concatenated probes chip is washed into 10s with electrolyte after hybridization, The NaClO of 1mol/L can be used in the electrolyte4(pH7.4).Then DNA/RNA hybridization concatenated probes chip is immersed in In electrolyte, particularly fresh electrolyte, the current signal for organizing electrode altogether is detected.As a preferred embodiment, institute is detected The current signal for stating DNA/RNA hybridization concatenated probes is realized using alternating voltammetry or differential pulse voltammetry.Specifically, when adopting When detecting the current signal of the working electrode with alternating voltammetry, voltage range is that voltage range is -0.3~0.4V, frequency For 100-2000Hz, sweep speed 0.01-0.05V/s.
The detection method of electrochemical signals amplification provided in an embodiment of the present invention based on DNA/RNA hybridization concatenated probes, This method has many advantages, such as that simply controllable, detection limit is low and signal is easy to acquire, and can quickly detect the concentration of sample to be tested, and spirit Sensitivity is high.
It is illustrated combined with specific embodiments below.
The detection method that embodiment 1, the electrochemical signals based on DNA hybridization concatenated probes amplify detects Escherichia coli base Cause, comprising the following steps:
S11. the design of probe: by the Escherichia coli in the existing bacterial genomes of Genebank database 16srRNA gene order and associated nucleic acid sequences reported in the literature have been delivered both at home and abroad carry out sequence alignment analysis, with big The conservative fragments of enterobacteria 16srRNA gene order are target gene, are selected without secondary structure and highly conserved section, according to drawing Basic principle of the physical prospecting needle without mispairing, using software, engineer's capture probe, target-gene sequence, signal probe, connector are visited Needle.Detect above-mentioned synthesis target-gene sequence respectively with the multiple groups probe of above-mentioned design, through repetition test, filter out specificity, Sensitivity and reproducible best probe combinations: the sequence difference of CP, AP, DP1, described CP, AP, DP1 are as follows:
AP sequence:
5'-CAACCTTCCCTCATTTAACAACCTTCCCTCATTTAACAACCTTCCC TCATTTAACAACCTTCCC TCATTTAACTTTACTCCCTTCC-3'。
CP sequence:
5'-S-S-C6-TCCCCGCTGAAAGTA CTTTACAACCCGAAGGCCTT-3'。
TP sequence:
5'-TGTATGAAGAAGGCCTTCGG GTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATA CCTTT GCTCATTGACGTTACCCGCAGAAGAAGCACC-3'。
DP1:
The end 5'-FcFcFcFc-AAATGAGGGAAGGTTG-3', 5'- is labeled as 4 continuous ferrocene (Fc).
The preparation of S12.DNA chip: it is membrane electrode that electrode, which is selected, and working electrode, auxiliary electrode and reference electrode are electricity Pole.Three electrodes are immersed in the dilute sulfuric acid of 0.1M, electrochemical activation is carried out within the scope of 0V-1.2V, uses ultrapure water Electrode surface 10 seconds, then thorough cleaning electrode diluted acid remained on surface is dried with nitrogen.CP is fixed: drop coating 1 on the working electrode (s μ L CP aqueous solution, 25 DEG C of water-baths stand 2 hours, after capture probe is fixed, with ultrapure water electrode surface 10 seconds, and nitrogen Air-blowing is dry.MCH closing: the MCH aqueous solution of 1 μ L1mM of drop coating on modified electrode, 25 DEG C of water-baths stand 2 hours, are rushed with ultrapure water It is dried with nitrogen after washing, electrode surface forms CP/ mercaptoethanol composite layer, obtains the DNA detection chip of specific recognition target gene.
S13 detection liquid preparation: detection liquid is the bacillus coli gene segment (TP) comprising various concentration, signal probe (DP1), 6 × SSC (pH7.4) hybridization solution of connector probe (AP).The concentration of TP include 1pM, 100fM, 10fM, 1fM, 100aM, 0aM.The concentration of DP and AP is respectively 1 μM.
S14. hybridization reaction: drop coating 1ul detects liquid, 35 DEG C of incubations on the DNA/ mercaptoethanol chip for modified CP 15 minutes.
S15. electrical signal detection: after hybridization, by DNA/ mercaptoethanol chip electrolyte (1M NaClO4, pH7.4) Washing 10 seconds.Then electrode is immersed in fresh electrolyte, using the electric current of alternating voltammetry (ACV) detection working electrode Signal, voltage range are -0.3~0.4V, frequency 250Hz, ac potential 25mV, sweep speed 20mV/s.
Comparative example detects target gene using traditional " sandwich formula " DNA sensing chip
The design of probe: CP, AP are identical as above-mentioned S11, and the sequence of signal probe DP2 is 5'-Fc- The end AACTTTACTCCCTTCC-3', 5'- is labeled as 1 ferrocene (Fc).
Detection liquid preparation: detection liquid is the bacillus coli gene segment (TP) comprising various concentration, signal probe (DP2) Bulk crossing liquid.The concentration of TP includes 10pM, 1pM, 100fM, 10fM, 0pM.The concentration of DP and AP is respectively 1 μM.
Hybridization reaction: drop coating 1ul detects liquid on DNA/MCH-SAM chip.35 DEG C are incubated for 15 minutes.
Electrical signal detection: after hybridization, DNA/MCH-SAM chip is washed with electrolyte (1M NaClO4, pH7.4) 10 seconds, then electrode is immersed in fresh electrolyte, using alternating voltammetry detecting electrode current signal, voltage range For -0.3~0.4V, frequency 250Hz, ac potential 25mV, sweep speed 20mV/s.
It is measured using the detection method that the embodiment of the present invention 1 is amplified based on the electrochemical signals of DNA hybridization concatenated probes E. coli dna concentration map is as shown in Figure 2.Traditional " sandwich formula " DNA sensing chip detects bacillus coli gene detection method The e. coli dna fragment concentrations gradient measured is as shown in Figure 3.As seen from the figure, provided in an embodiment of the present invention to be based on DNA hybridization The detection method of the electrochemical signals amplification of concatenated probes has higher sensitivity, can obtain more accurate result.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.

Claims (10)

1. a kind of probe system for bio-sensor signal amplification, which is characterized in that connect including connector probe and with described The signal enlarged structure of head probe connection,
Wherein, the connector probe include 3 ' end it is complementary with target gene in conjunction with first area and with the signal enlarged structure company The second area connect, the second area include 2-4 identical sequence units, are provided between base between the sequence units Every;
The signal enlarged structure includes 2-4 independent signal amplification units, the signal amplification unit by signal probe and It is connected to the series connection marker composition that the signal probe 5 ' is held, signal probe connection complementary with the sequence units, institute Series connection marker is stated to be made of 2-4 concatenated markers.
2. the probe system for bio-sensor signal amplification as described in claim 1, which is characterized in that the sequence list The sequence of member are as follows: 5'-CAACCTTCCCTCATTT-3';Or
The sequence of the signal probe are as follows: 5'-AAATGAGGGAAGGTTG-3'.
3. the probe system for bio-sensor signal amplification as described in claim 1, which is characterized in that between the base It is constituted every by two A bases.
4. the probe system a method according to any one of claims 1-3 for bio-sensor signal amplification, which is characterized in that described Marker is at least one of ferrocene, fluorescein, biotin, methylene blue.
5. the probe system a method according to any one of claims 1-3 for bio-sensor signal amplification, which is characterized in that also wrap Target gene, capture probe and electrode are included, the capture probe, the first area of the connector probe are mutual with the target gene respectively It mends and combines, described capture probe one end is connect with the electrode.
6. the probe system for bio-sensor signal amplification as claimed in claim 5, which is characterized in that the capture is visited Needle, probe tip differ 0-12 bp between the binding site of target gene engagement respectively.
7. the probe system for bio-sensor signal amplification as claimed in claim 5, which is characterized in that secondth area Domain includes 4 identical sequence units, and the signal enlarged structure includes 4 independent signal amplification units, the series connection mark Note object is made of 4 concatenated markers.
8. a kind of detection method of the electrochemical signals amplification based on DNA/RNA hybridization concatenated probes, comprising the following steps:
Design provides capture probe, probe tip and the signal enlarged structure of sample to be tested;
Electrode group is provided, the electrode group includes working electrode, auxiliary electrode and reference electrode, and the electrode is carried out at activation Reason fixes after the capture probe on the working electrode and carries out mercaptoethanol closing to the working electrode, captured The DNA/RNA detection chip of probe specificity identification target gene;
The target gene of sample to be tested, the probe tip and the signal enlarged structure are mixed to get detection liquid;
Liquid is detected described in drop coating in the DNA/RNA detection chip, processing is incubated for and forms DNA/RNA hybridization concatenated probes core Piece, wherein the DNA/RNA hybridization concatenated probes includes that the claims 1-7 is any described to be believed for biosensor The probe system of number amplification, the first area combination complementary with the target gene in the connector probe;
Detect the current signal of the DNA/RNA hybridization concatenated probes.
9. the detection method of the electrochemical signals amplification as claimed in claim 8 based on DNA/RNA hybridization concatenated probes, special Sign is that the current signal for detecting the DNA/RNA hybridization concatenated probes is real using alternating voltammetry or differential pulse voltammetry It is existing.
10. the detection method of the electrochemical signals amplification as claimed in claim 8 based on DNA/RNA hybridization concatenated probes, It is characterized in that, the temperature for being incubated for processing is 25-42 DEG C, time 10-60min.
CN201510909034.7A 2015-12-10 2015-12-10 A kind of probe system and its application for bio-sensor signal amplification Active CN106872541B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510909034.7A CN106872541B (en) 2015-12-10 2015-12-10 A kind of probe system and its application for bio-sensor signal amplification

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510909034.7A CN106872541B (en) 2015-12-10 2015-12-10 A kind of probe system and its application for bio-sensor signal amplification

Publications (2)

Publication Number Publication Date
CN106872541A CN106872541A (en) 2017-06-20
CN106872541B true CN106872541B (en) 2019-10-01

Family

ID=59236504

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510909034.7A Active CN106872541B (en) 2015-12-10 2015-12-10 A kind of probe system and its application for bio-sensor signal amplification

Country Status (1)

Country Link
CN (1) CN106872541B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108048916A (en) * 2017-12-20 2018-05-18 栾图 Genetic chip for nucleic acid enriching extraction and preparation method thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10163599B4 (en) * 2001-12-21 2006-06-29 Micronas Gmbh Method for the determination of nucleic acid analytes
US20120058547A1 (en) * 2006-08-11 2012-03-08 The Hong Kong University Of Science And Technology Method and system for nucleic acid detection using electroconductive or electrochemically active labels
CN103175873B (en) * 2013-01-27 2015-11-18 福州市第二医院 Based target repetitive dna sequence self strengthens the DNA electrochemical sensor of amplifying signal
CN104458842B (en) * 2014-12-03 2017-02-22 深圳鼎新融合科技有限公司 Ultrasensitive DNA electrochemical detection method, reagent and system
CN104730123A (en) * 2015-03-09 2015-06-24 福建医科大学 Method for detecting acute promyelocytic PML/RAR alpha gene sequence by using double-channel sensor based on 'Y'-node probe

Also Published As

Publication number Publication date
CN106872541A (en) 2017-06-20

Similar Documents

Publication Publication Date Title
RU2617535C2 (en) Measuring and monitoring electrodes with aptamer coating and methods of their application for biomarkers recognition
KR101454511B1 (en) Hairpin-type probe for detecting target material and method for detecting target material using the same
CN105784796B (en) A kind of sensitive determination method of the aptamer sensor based on gold/molybdenum disulfide/graphene nanocomposite material to lysozyme
CN103743802A (en) DNA biosensor based on three-dimensional ordered gold doped nano titanium dioxide electrode as well as preparation method and application of DNA biosensor
CN106872541B (en) A kind of probe system and its application for bio-sensor signal amplification
Sun et al. A label-free and high sensitive aptamer biosensor based on hyperbranched polyester microspheres for thrombin detection
Abdelhamid et al. Nanobiotechnology as a platform for the diagnosis of COVID-19: a review
CN106435039A (en) Primers, probe, kit and method for detecting PRRS (porcine reproductive and respiratory syndrome) NADC-30 strain
CN108445067A (en) A kind of signal amplification RNA nano biological sensors without enzyme of dual signal, preparation method and applications
Eloi et al. Toward a point-of-care diagnostic for specific detection of Mycobacterium tuberculosis from sputum samples
CN105445350A (en) Electrochemical DNA (Deoxyribose Nucleic Acid) biosensor based on peptide nucleic acid and preparation method of electrochemical DNA biosensor
CN105259227A (en) Thrombin detection method of molecularly imprinted electrochemical sensor
JPWO2008096757A1 (en) Biomolecule detection method and biomolecule detection chip
Ferreira et al. A novel polymer‐based genosensor for the detection and quantification of Streptococcus pneumoniae in genomic DNA sample
CN107422009B (en) A kind of non-enzymatic electrochemical biosensor method facilitating detection glucose
CN104297314A (en) Preparation method of electrochemical bladder cancer DNA sensor
CN108508068A (en) Method and the application of HER2 gene particular sequences are detected based on anion porphyrin-carbon nano tube modified electrode
CN107513494A (en) A kind of detection of nucleic acids card and its application method
CN107988361A (en) Diagnose cervix cancer or assess the method and kit of cervix cancer risk
KR20170000437A (en) Carbon nanotube-polymer composite electrodes and Electrochemical Method for Detecting DNA using the same
US11169140B2 (en) Electrochemical device for detection of selected quorum sensing signals
Tabata et al. Label-free Nucleic Acid Amplification Detection using Electrochemical Sensors for Liquid Biopsy
Sheng et al. Electrochemical Determination of 16s Ribosomal RNA of Mycobacterium Tuberculosis Using Magnetite on Silica with DNA-Functionalized Gold Nanoparticles
CN108424976A (en) Happen suddenly acute and severe infectious disease Emergent detection deposit kit and the method for inspection
US20180127813A1 (en) Nucleic Acid Sequencing using Indicating Polymerases

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20180628

Address after: 100000 Beijing Chaoyang District Tianlong garden C block 3 floor 03 business (Harvest incubator No. 2021)

Applicant after: Beijing Xinkang Biotechnology Co. Ltd and

Address before: 518000 Shenzhen, Nanshan District, Guangdong, Guangdong Province, Hainan Hainan street, No. 10 biological incubator 2 building 504B room

Applicant before: Shenzhen Maiqi Biotechnology Co. Ltd.

TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20180727

Address after: 528400, third floor of C building, Lin Hai Industrial Park, Cui Cheng Road, Zhongshan, Guangdong.

Applicant after: Zhongshan core Biotechnology Co., Ltd.

Address before: 100000 Beijing Chaoyang District Tianlong garden C block 3 floor 03 business (Harvest incubator No. 2021)

Applicant before: Beijing Xinkang Biotechnology Co. Ltd and

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant