CN110029118B - Method for synthesizing quercetin-4' -glucoside - Google Patents
Method for synthesizing quercetin-4' -glucoside Download PDFInfo
- Publication number
- CN110029118B CN110029118B CN201910316885.9A CN201910316885A CN110029118B CN 110029118 B CN110029118 B CN 110029118B CN 201910316885 A CN201910316885 A CN 201910316885A CN 110029118 B CN110029118 B CN 110029118B
- Authority
- CN
- China
- Prior art keywords
- quercetin
- leu
- ile
- glu
- glucoside
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1062—Sucrose synthase (2.4.1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/44—Preparation of O-glycosides, e.g. glucosides
- C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01013—Sucrose synthase (2.4.1.13)
Abstract
The invention discloses a method for synthesizing quercetin-4' -glucoside, which comprises the steps of constructing recombinant bacteria containing a double-enzyme system by using glycosyltransferase UGT88A1 or a mutant gene thereof and a sucrose synthase gene, using IPTG as an inducer for inducing the recombinant bacteria at 16-37 ℃ for 12-24 hours, centrifugally collecting bacterial sludge, crushing bacterial sludge by using an ultrasonic crushing method, centrifugally collecting supernatant, and obtaining crude enzyme liquid; dissolving quercetin in DMSO, adding crude enzyme solution and sucrose, reacting at 20-40deg.C for 8-30 hr, stopping reaction with methanol, and centrifuging to obtain quercetin-4' -glucoside. The amino acid sequence of the glycosyltransferase mutant is that the amino acid sequence shown in SEQ ID NO.1 is mutated, and the mutated amino acid site is selected from one or more of V18, I118, G181 and S271. The mutant is simple to prepare, and the yield of quercetin-4' -glucoside is improved.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a biosynthesis method of quercetin glycoside.
Background
Quercetin is a natural flavonoid compound, and is widely existing in tissues such as flowers, leaves, fruits and the like of plants in a glycoside form. Quercetin and its derivatives have antioxidant, antiinflammatory, and anticancer effects, and also have effects in preventing diabetes, reducing blood lipid, and lowering blood pressure. The content factor of quercetin is related to the growth environment and tissue site, and its distribution is mostly in the fruit and vegetable epidermis. Quercetin is insoluble in water, and in view of absorption problems, it is required to enhance its water solubility so that it acts better on the human body. Glycosylation can be used to increase its hydrophilic groups, resulting in increased solubility. However, the conversion rate and yield of quercetin derivatives synthesized by glycosidase conversion are relatively low, and the problem of water solubility limits research development. Quercetin-4' -glucoside is a product of quercetin Pi Sutang glycosylation, and has better water solubility and pharmacological action than quercetin. Quercetin-4' -glucoside, also called spiradin, is present in onion, and has a dry weight of 0.036-23.92g/kg, and has low content, and is not easy to extract. However, the quercetin components are widely available in natural sources, the novel glycosidase is utilized in genetic engineering, and the quercetin-4' -glucoside is produced by a one-step conversion method, so that the method has great process advantages and raw material advantages.
Disclosure of Invention
The invention aims to provide a method for synthesizing quercetin-4 '-glucoside, which adopts a novel mutant of quercetin glycosidase to realize glycosylation modification of quercetin, and prepares the quercetin-4' -glucoside.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
a glycosyltransferase mutant suitable for quercetin glycoside synthesis has an amino acid sequence shown in SEQ ID NO.1, and the mutated amino acid site is selected from one or more of V18, I118, G181 and S271.
Further, the mutation at the mutated amino acid site includes any one or more of the following: V18R/K/N, I118G, G181N, S271K wherein "/" means "OR".
V18R/K/N is that the 18 th amino acid in the sequence of SEQ ID NO.1 is mutated from valine (V) to arginine (R) or lysine (K) or asparagine (N); I118G is the mutation of isoleucine (I) to glycine (G) at amino acid 118 in the sequence ID NO.1, G181N is the mutation of glycine (G) to asparagine (N) at amino acid 181 in the sequence ID NO.1, and S271K is the mutation of serine (S) to lysine (K) at amino acid 271 in the sequence ID NO. 1.
An expressed gene encoding any one of the glycosyltransferase mutants described above.
A recombinant plasmid having the above-mentioned expressed gene and sucrose synthase gene SUS linked thereto.
A recombinant cell comprising the recombinant expression vector described above or the expressed gene of the glycosyltransferase mutant described above.
The glycosyltransferase mutant is applied to preparation of quercetin-4' -glucoside.
A biosynthesis method of quercetin-4' -glucoside comprises the following steps:
1) Constructing recombinant bacteria with a double-enzyme system: connecting the gene of glycosyltransferase UGT88A1 or a mutant thereof with a sucrose synthase gene to obtain a recombinant plasmid, and transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) by adopting a heat shock method to obtain recombinant bacteria containing a double-enzyme system;
2) Induction of recombinant bacteria to produce enzymes: inoculating the recombinant bacteria into LB liquid culture medium, sampling at 25-40 ℃ to make OD 600 When the temperature is between 0.4 and 0.5, using IPTG as an inducer, inducing for 12 to 24 hours at the temperature of between 16 and 37 ℃ under the condition of 150 to 300r/min, centrifugally collecting bacterial sludge, crushing bacterial cells by using an ultrasonic crushing method, centrifugally collecting supernatant under the condition of 8000r/min, and obtaining crude enzyme liquid;
3) Dissolving quercetin in DMSO, adding crude enzyme solution and sucrose, reacting at 20-40deg.C for 8-30 hr, stopping reaction with methanol, and centrifuging to obtain quercetin-4' -glucoside.
The gene sequence of the glycosyltransferase UGT88A1 is shown in SEQ ID.3, and the sequence of the sucrose synthase gene is shown in SEQ ID.4.
The final concentration of quercetin dissolved in DMSO is 20-40 mM; the final concentration of sucrose is 300-500 mM; the addition amount of the crude enzyme solution is 5-10 g/L.
The invention is derived fromArabidopsis thalianaThe glycosyltransferase UGT88A1 is based, the key amino acid of the active center is subjected to saturation mutation by using a bioinformatics method, and the glycosyltransferase mutant is obtained after screening mutant strains. The glycosyltransferase mutant and sucrose synthase are subjected to double enzyme coupling, quercetin is taken as a substrate, and a proper amount of sucrose is added to catalyze and generate quercetin-4' -glucoside. The mutant is simple to prepare and high in yield, the yield of quercetin-4 '-glucoside is improved, the activity of the mutant is improved by 2.5 times compared with that of the original enzyme under the same condition, and the conversion rate of quercetin-4' -glucoside is obviously improved compared with that of the original enzyme.
The invention improves the enzyme activity of glycosyltransferase UGT88A1 through mutation, and realizes the one-step conversion of quercetin-4' -glucoside by utilizing the mutant.
Drawings
FIG. 1 shows a liquid chromatographic profile of the detection of the substrate product of the reaction system.
Detailed Description
The detection methods used in the following examples are as follows:
HPLC assay method: chromatographic column: agilent TC-C18 (4.6 mm. Times.250 mm); mobile phase (a): water + 1%o trifluoroacetic acid, (B): acetonitrile+1%o trifluoroacetic acid;
gradient elution was carried out at a flow rate of 1.0mL/min, a detection wavelength of 350nm, a sample introduction amount of 20. Mu.L and a column temperature of 40 ℃.
Method of confirming mutants employed in the following examples:
the research adopts the BLASTP method of NCBI, screens according to conserved sites, obtains a plurality of known crystal structure sequences similar to the homology UGT88A1, and carries out analysis and homology modeling. Modeling was performed using pymol homology and docking with the substrate UDPG, energy calculations and optimization were performed using amber plug-in. The 18 th amino acid valine (V) close to the active center site is selected, the distance between the valine and the active site is 5A, and hydrogen bonding can exist between valine and a substrate. A saturation mutation is carried out on valine (V) at position 18, and the valine (V) is effectively mutated into arginine (R), lysine (K) or asparagine (N). Other amino acid site mutations are similar to this approach.
Example 1
Preparation of glycosyltransferase mutants: the glycosyltransferase UGT88A1 mutant V18R, V18N and V18K from arabidopsis thaliana is subjected to saturation mutation according to the gene sequence of the glycosyltransferase UGT88A1, the DNA coding sequence is determined, and the mutant glycosyltransferase is obtained by introducing the mutant glycosyltransferase into escherichia coli for expression, and single mutations V18R, V18N and V18K are synthesized and constructed on pRSFDuet vectors by gold biosciences.
The V18R mutation primer is as follows:
forward primer: GGTCACCTGCGCTCGATGGTGGAACTGGGTAAAACCA
Reverse primer: CGAGCGCAGGTGACCGATCGGCGG
The V18K mutation primer is as follows:
forward primer: GGTCACCTGAAATCGATGGTGGAACTGGGTAAAACCA
Reverse primer: CGATTTCAGGTGACCGATCGGCGG
The V18N mutation primer is as follows:
forward primer: GGTCACCTGAACTCGATGGTGGAACTGGGTAAAACCA
Reverse primer: CGAGTTCAGGTGACCGATCGGCGG
Transforming the constructed plasmid intoE.coliBL21 (DE 3) competent cells were selected with LB solid medium containing 50. Mu.g/mL kanamycin and cultured overnight at 37 ℃. The 100mL LB solid medium formula is: 1g yeast extract, 1g peptone, 1g NaCl,2g agarose, dissolved in 100mL deionized water, sterilized and poured into a petri dish. Single colonies were randomly picked into shake tubes of 5mL LB liquid medium containing 50. Mu.g/mL kanamycin, cultured overnight, and sequenced to verify that the sequences were correct.
Coupling mutant and sucrose synthase to construct a dual enzyme system
Cloning UGT88A1 directly into pRSFDuetNdeI andXhothe recombinant plasmid pRSFDuet-88a1 (pRSFDuet plasmid was obtained from Kirsrui Co.) was obtained between the cleavage sites.
Recombinant plasmid pRSFDuet-88a1 was usedNcoI andEcoRi cleavage to give linearized vector for plasmid pETDuet_SUS (from Kirschner Co.) carrying sucrose synthaseNcoI andEcoRi, cleavage treatment to obtain SUS gene fragment. The SUS gene fragment and the linearized vector were subjected to gel recovery, and the mutated UGT fragment and the SUS gene fragment were ligated overnight at 16 ℃. The connection product is transformed into competent cells of escherichia coli BL21 (DE 3) by a heat shock method, positive clones are obtained by screening, a new recombinant plasmid sus_pRSFDuet-88a1_6HIS is obtained, and then the recombinant plasmid sus_pRSFDuet-88a1_6HIS is introduced into competent cells BL21 (DE 3) to obtain recombinant bacteria containing a double enzyme system.
EXAMPLE 2 mutant Strain Induction
BL21 (DE 3) 100mL of LB liquid medium containing sus_pRSFDuet-88a1_6HIS of recombinant plasmid was sampled at 37℃to obtain OD 600 When the temperature is between 0.4 and 0.5, IPTG is used as an inducer, and induction is carried out for 22 hours under the conditions of 16 ℃ and 200 r/min. The formula of 100mL LB liquid medium is as follows: 1g yeast extract, 1g peptone, 1g NaCl,2g agarose, was dissolved in 100mL deionized water. After the cells were resuspended in 100mM potassium phosphate buffer (pH 8.0), the cells were centrifuged and collected. Centrifugation conditions: 4 ℃, 6000/min, 3min.
Crushing thalli by using an ultrasonic crushing method, wherein the crushing conditions are as follows: 300W, working time of 1s, intermittence of 2s and whole course of 20min.
After the completion of the crushing, the supernatant was collected by centrifugation. Centrifugation conditions: 8000r/min,25min.
Example 3 measurement method
The conversion rate determination method of glycosyltransferase mutant and sucrose synthase coupling double enzyme and the glycosyltransferase enzyme activity determination method are as follows: the total reaction mixture was 220. Mu.l, which contained 0.5. 0.5 mM quercetin (soluble in 15% DMSO), 5 mM UDPG, and pH 6.8 potassium phosphate buffer, with a final protein concentration of 0.1 mg/mL. After 30 min of reaction at 37℃180. Mu.l of methanol was used to terminate the reaction.
Centrifugation conditions: room temperature, 12000 r/min,1 min. The quantitative method comprises the following steps: HPLC was performed to analyze the supernatant.
The enzyme activity units are defined as: the amount of enzyme required to catalyze the formation of 1. Mu. Mol quercetin-4' -glucoside for 1 min was 1 activity unit (U).
The enzyme activity determination method of sucrose synthase comprises the following steps: the total reaction was 3mL, containing 500mM sucrose, 10mM UDP, pH 7.2 potassium phosphate buffer, and 6mg protein was added. After reaction at 30℃for 1 h, 1mL of the reaction mixture was boiled at 95℃for 10 minutes.
Centrifugation conditions: room temperature, 12000 r/min,1 min. The quantitative method comprises the following steps: the supernatant was measured by DNS method.
The enzyme activity units are defined as: the amount of enzyme that releases 1. Mu. Mol of reducing sugar per minute is one viability unit (U).
The method for detecting the content of the quercetin-4' -glucoside comprises the following steps:
in a 10mL system, an enzyme solution was added at a final concentration of 5mg/mL, quercetin (dissolved in 5% DMSO) was converted to a substrate final concentration of 32mM, sucrose was 320mM at pH 7.2, and reacted at 30℃for 12 h.
100. Mu.l of the reaction mixture was taken and 900. Mu.l of methanol was added to terminate the reaction.
Centrifugation conditions: room temperature, 12000 r/min,1 min. The quantitative method comprises the following steps: HPLC (high Performance liquid chromatography) detection of quercetin, and quercetin-4' -glucoside content in the conversion system. The yield of the original enzyme was defined as 100%.
Compared with the original enzyme, the mutant enzyme obtained by expressing the mutant has the advantages of greatly improving the enzyme activity of the mutant, improving the yield of quercetin to quercetin-4' -glucoside by the mutant, being environment-friendly and environment-friendly in production, low in energy consumption, high in content and the like. The mutant enzyme takes quercetin as a substrate, and the yield of quercetin-4' -glucoside is improved to 243%,200% and 169% relative to the original enzyme. The measurement results are shown in Table 1.
TABLE 1
| Sample name | Enzyme activity (mU/mg) | Yield (mg/L) |
| Primordial enzyme | 227.6 | 100%(290.2) |
| V18R | 552.3 | 208%(630.1) |
| V18K | 454.7 | 130%(380.5) |
| V18N | 384.6 | 153%(450) |
Example 3 other mutation sites
The mutation was performed in the same manner as described above, I118G, G181N, S271K located in the vicinity of the active center, and screening culture was performed in the same manner as described above, and detection was performed by the same method. These mutation points all increase quercetin-4' -glucose yield by 110-150%. The measurement results are shown in Table 2.
TABLE 2
| Sample name | Enzyme activity (mU/mg) | Yield (mg/L) |
| Primordial enzyme | 227.6 | 100% (290.2) |
| I118G | 319.3 | 145% (421) |
| G181N | 257.2 | 130% (377.8) |
| S271K | 279.9 | 128% (371.2) |
Example 4 production of quercetin-4' -glucoside
Dissolving quercetin in 5% DMSO aqueous solution, wherein the final concentration of sucrose is 320mM, the final concentration of quercetin is 32mM, adding crude enzyme solution, and reacting at 30deg.C for 12 hr, stopping reaction with methanol, and centrifuging to obtain quercetin-4' -glucoside. 100. Mu.l of the reaction mixture was taken and 900. Mu.l of methanol was added to terminate the reaction. The substrate product was used for detection by HPLC.
The measuring method comprises the following steps: chromatographic column: agilent TC-C18 (4.6 mm. Times.250 mm); mobile phase (a): water + 1%o trifluoroacetic acid, (B): acetonitrile+1%o trifluoroacetic acid;
gradient elution was carried out at a flow rate of 1.0mL/min, a detection wavelength of 350nm, a sample introduction amount of 20. Mu.L and a column temperature of 40 ℃.
Centrifugation conditions: room temperature, 12000 r/min,1 min.
The liquid chromatogram of the detection of the substrate products of the reaction system is shown in figure 1, the retention time of quercetin is about 20.5min, and the retention time of quercetin-4' -glucoside is about 14 min.
Sequence listing
<110> university of Nanjing Industrial science
<120> a method for synthesizing quercetin-4' -glucoside
<141> 2019-04-19
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 462
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
Met Gly Glu Glu Ala Ile Val Leu Tyr Pro Ala Pro Pro Ile Gly His
1 5 10 15
Leu Val Ser Met Val Glu Leu Gly Lys Thr Ile Leu Ser Lys Asn Pro
20 25 30
Ser Leu Ser Ile His Ile Ile Leu Val Pro Pro Pro Tyr Gln Pro Glu
35 40 45
Ser Thr Ala Thr Tyr Ile Ser Ser Val Ser Ser Ser Phe Pro Ser Ile
50 55 60
Thr Phe His His Leu Pro Ala Val Thr Pro Tyr Ser Ser Ser Ser Thr
65 70 75 80
Ser Arg His His His Glu Ser Leu Leu Leu Glu Ile Leu Cys Phe Ser
85 90 95
Asn Pro Ser Val His Arg Thr Leu Phe Ser Leu Ser Arg Asn Phe Asn
100 105 110
Val Arg Ala Met Ile Ile Asp Phe Phe Cys Thr Ala Val Leu Asp Ile
115 120 125
Thr Ala Asp Phe Thr Phe Pro Val Tyr Phe Phe Tyr Thr Ser Gly Ala
130 135 140
Ala Cys Leu Ala Phe Ser Phe Tyr Leu Pro Thr Ile Asp Glu Thr Thr
145 150 155 160
Pro Gly Lys Asn Leu Lys Asp Ile Pro Thr Val His Ile Pro Gly Val
165 170 175
Pro Pro Met Lys Gly Ser Asp Met Pro Lys Ala Val Leu Glu Arg Asp
180 185 190
Asp Glu Val Tyr Asp Val Phe Ile Met Phe Gly Lys Gln Leu Ser Lys
195 200 205
Ser Ser Gly Ile Ile Ile Asn Thr Phe Asp Ala Leu Glu Asn Arg Ala
210 215 220
Ile Lys Ala Ile Thr Glu Glu Leu Cys Phe Arg Asn Ile Tyr Pro Ile
225 230 235 240
Gly Pro Leu Ile Val Asn Gly Arg Ile Glu Asp Arg Asn Asp Asn Lys
245 250 255
Ala Val Ser Cys Leu Asn Trp Leu Asp Ser Gln Pro Glu Lys Ser Val
260 265 270
Val Phe Leu Cys Phe Gly Ser Leu Gly Leu Phe Ser Lys Glu Gln Val
275 280 285
Ile Glu Ile Ala Val Gly Leu Glu Lys Ser Gly Gln Arg Phe Leu Trp
290 295 300
Val Val Arg Asn Pro Pro Glu Leu Glu Lys Thr Glu Leu Asp Leu Lys
305 310 315 320
Ser Leu Leu Pro Glu Gly Phe Leu Ser Arg Thr Glu Asp Lys Gly Met
325 330 335
Val Val Lys Ser Trp Ala Pro Gln Val Pro Val Leu Asn His Lys Ala
340 345 350
Val Gly Gly Phe Val Thr His Cys Gly Trp Asn Ser Ile Leu Glu Ala
355 360 365
Val Cys Ala Gly Val Pro Met Val Ala Trp Pro Leu Tyr Ala Glu Gln
370 375 380
Arg Phe Asn Arg Val Met Ile Val Asp Glu Ile Lys Ile Ala Ile Ser
385 390 395 400
Met Asn Glu Ser Glu Thr Gly Phe Val Ser Ser Thr Glu Val Glu Lys
405 410 415
Arg Val Gln Glu Ile Ile Gly Glu Cys Pro Val Arg Glu Arg Thr Met
420 425 430
Ala Met Lys Asn Ala Ala Glu Leu Ala Leu Thr Glu Thr Gly Ser Ser
435 440 445
His Thr Ala Leu Thr Thr Leu Leu Gln Ser Trp Ser Pro Lys
450 455 460
<210> 2
<211> 806
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Pro Glu Leu Ile Gln Thr Leu Leu Asp Ser Glu Glu Lys Ser Asp
1 5 10 15
Leu Arg Ser Phe Val Ser Glu Leu Arg Gln Gln Glu Lys Lys Tyr Leu
20 25 30
Leu Arg Asn Asp Ile Val Asn Val Tyr Ser Glu Tyr Cys Ser Lys Tyr
35 40 45
Gln Lys Ser Glu Lys Phe His Thr Ser Ser Asn Leu Gly Lys Leu Ile
50 55 60
Tyr Tyr Thr Gln Glu Ile Ile Gln Glu Asp Ser Asn Leu Tyr Phe Ile
65 70 75 80
Ile Arg Ser Lys Ile Ala Ser Gln Gln Val Tyr Arg Leu Thr Asp Asp
85 90 95
Leu Ser Ile Glu Ser Ile Thr Ile Gln Glu Leu Leu Asp Val Arg Asp
100 105 110
Arg Phe Val Asn Arg Tyr Gln Pro Asn Glu Gly Asp Leu Leu Glu Leu
115 120 125
Asp Phe Gly Pro Phe Tyr Asp Tyr Ser Pro Val Ile Arg Asp Pro Lys
130 135 140
Asn Ile Gly Lys Gly Val Gln Tyr Leu Asn Arg Tyr Leu Ser Ser Lys
145 150 155 160
Leu Phe Gln Asp Ala Lys Gln Trp Leu Glu Ser Leu Phe Gly Phe Leu
165 170 175
Arg Leu His Gln Tyr Asn Gly Ile Gln Leu Leu Ile Asn Asp Arg Ile
180 185 190
Lys Thr Gln Gln Gln Leu Ser Glu Gln Val Lys Lys Ala Ile Ala Ile
195 200 205
Val Ser Asp Arg Pro Arg Asp Glu Pro Tyr Glu Glu Phe Arg Phe Ala
210 215 220
Leu Gln Thr Ile Gly Phe Glu Pro Gly Trp Gly Asn Thr Ala Gln Arg
225 230 235 240
Val Gln Glu Thr Leu Ser Ile Leu Asp Glu Leu Ile Asp Ser Pro Asp
245 250 255
Pro Gln Thr Leu Glu Ala Phe Ile Ser Arg Ile Pro Met Ile Phe Arg
260 265 270
Ile Val Leu Val Ser Ala His Gly Trp Phe Gly Gln Glu Gly Val Leu
275 280 285
Gly Arg Pro Asp Thr Gly Gly Gln Val Val Tyr Val Leu Asp Gln Ala
290 295 300
Lys Asn Leu Glu Lys Gln Leu Gln Glu Asp Val Ile Leu Ala Gly Leu
305 310 315 320
Glu Arg Leu Asn Val Gln Pro Lys Val Ile Ile Leu Thr Arg Leu Ile
325 330 335
Pro Asn Ser Asp Gly Thr Leu Cys His Gln Arg Leu Glu Lys Val His
340 345 350
Gly Thr Glu Asn Ala Trp Ile Leu Arg Val Pro Leu Arg Asp Phe Asn
355 360 365
Pro Asn Met Thr Gln Asn Trp Ile Ser Arg Phe Glu Phe Trp Pro Tyr
370 375 380
Leu Glu Thr Tyr Ala Ile Asp Ala Glu Lys Glu Leu Arg Ala Glu Leu
385 390 395 400
Gln Gly Arg Pro Asp Leu Ile Val Gly Asn Tyr Ser Asp Gly Asn Leu
405 410 415
Val Ala Phe Leu Leu Ala Arg His Met Lys Val Thr Gln Cys Asn Ile
420 425 430
Ala His Ala Leu Glu Lys Ser Lys Tyr Leu Phe Ser Asn Leu Tyr Trp
435 440 445
Gln Asp Leu Asp Asp Lys Tyr His Phe Ser Leu Gln Phe Thr Ala Asp
450 455 460
Leu Ile Ala Met Asn Ala Ala Asn Phe Val Ile Ser Ser Thr Tyr Gln
465 470 475 480
Glu Ile Val Gly Thr Pro Asp Ser Ile Gly Gln Tyr Glu Ser Tyr Lys
485 490 495
Cys Phe Thr Met Pro Asp Leu Tyr His Val Val Asn Gly Ile Glu Leu
500 505 510
Phe Ser Pro Lys Phe Asn Val Val Pro Pro Gly Val Ser Glu Asn Tyr
515 520 525
Tyr Phe Pro Tyr Phe Gln Thr Gln Asp Arg Val Glu Ser Asp Arg Gln
530 535 540
Arg Ile Thr Glu Leu Leu Phe Thr Leu Asp Asp Pro Thr Gln Ile Phe
545 550 555 560
Gly Gln Leu Asp Asn Pro Asn Lys Arg Pro Ile Phe Ser Met Ala Arg
565 570 575
Leu Asp Arg Ile Lys Asn Leu Thr Gly Leu Ala Glu Cys Phe Gly Lys
580 585 590
Ser Gln Glu Leu Gln Glu His Cys Asn Leu Ile Leu Val Ala Gly Lys
595 600 605
Leu Arg Val Glu Glu Ser Gly Asp Asn Glu Glu Arg Asp Glu Ile Val
610 615 620
Lys Leu Tyr Gln Ala Ile Glu Gln Tyr Asn Leu His Gly Lys Ile Arg
625 630 635 640
Trp Leu Gly Val Arg Leu Ser Lys Asn Asp Ser Gly Glu Ile Tyr Arg
645 650 655
Val Ile Ala Asp His Lys Gly Val Phe Val Gln Pro Ala Leu Phe Glu
660 665 670
Ala Phe Gly Leu Thr Ile Leu Glu Ala Met Ile Ser Gly Leu Pro Thr
675 680 685
Phe Gly Thr Gln Phe Gly Gly Pro Leu Glu Ile Ile Gln Asp Arg Val
690 695 700
Asn Gly Phe Tyr Ile Asn Pro Thr Asn Leu Glu Glu Thr Ala Ala Lys
705 710 715 720
Ile Leu Asp Phe Val Ile Lys Cys Glu Glu Arg Pro Asn Ser Trp Asn
725 730 735
Glu Ile Ser Gln Gln Gly Ile Asp Arg Val Tyr Ser Thr Tyr Thr Trp
740 745 750
Lys Ile His Thr Thr Lys Leu Leu Ser Leu Ala Arg Ile Tyr Gly Phe
755 760 765
Trp Asn Phe Thr Ser Gln Glu Asn Arg Glu Asp Leu Leu Arg Tyr Ile
770 775 780
Glu Ala Leu Phe Tyr Leu Ile Tyr Lys Pro Arg Ala Gln Gln Leu Leu
785 790 795 800
Glu Gln His Lys Tyr Arg
805
<210> 3
<211> 1386
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atgggcgaag aagcaattgt gctgtatccg gctccgccga tcggtcacct ggtctcgatg 60
gtggaactgg gtaaaaccat tctgagcaaa aacccgtccc tgtcaatcca tattatcctg 120
gttccgccgc cgtatcagcc ggaatctacc gcaacgtaca ttagctctgt gagttcctca 180
tttccgagta tcaccttcca tcacctgccg gctgttaccc cgtatagcag cagcagcacg 240
tcgcgtcatc accatgaaag cctgctgctg gaaattctgt gcttttccaa tccgtcagtc 300
caccgcaccc tgttttcgct gagccgtaac ttcaatgtgc gcgcaatgat tatcgatttc 360
ttttgcaccg cggtgctgga tattaccgcc gactttacgt tcccggttta tttcttttat 420
acctctggcg cggcctgtct ggcttttagt ttctatctgc cgacgatcga tgaaaccacg 480
ccgggtaaaa acctgaaaga cattccgacc gtccatatcc cgggtgtgcc gccgatgaaa 540
ggttctgata tgccgaaagc ggtgctggaa cgtgatgacg aagtttatga cgtctttatt 600
atgttcggca aacagctgag taaatcctca ggtattatca ttaacacctt tgatgccctg 660
gaaaatcgtg cgattaaagc catcacggaa gaactgtgtt tccgcaacat ttacccgatc 720
ggcccgctga ttgttaatgg tcgtatcgaa gatcgcaacg acaataaagc ggtcagctgc 780
ctgaactggc tggattctca accggaaaaa agtgtggttt ttctgtgttt cggctccctg 840
ggtctgtttt caaaagaaca ggttatcgaa attgccgtcg gcctggaaaa aagcggtcaa 900
cgtttcctgt gggtcgtgcg caatccgccg gaactggaaa aaaccgaact ggatctgaaa 960
tccctgctgc cggaaggctt tctgtcacgt acggaagaca agggtatggt tgtcaaatcc 1020
tgggcaccgc aggtgccggt tctgaaccac aaagccgttg gcggttttgt cacccattgc 1080
ggctggaata gcattctgga agcagtgtgt gctggtgtgc cgatggttgc gtggccgctg 1140
tacgccgaac agcgttttaa ccgcgtcatg atcgtggatg aaatcaaaat cgcaatctcg 1200
atgaacgaaa gcgaaaccgg cttcgtgtcg agcacggaag tggaaaaacg cgttcaagaa 1260
atcattggtg aatgcccggt tcgtgaacgc accatggcaa tgaaaaatgc agctgaactg 1320
gctctgaccg aaacgggttc tagtcacacg gccctgacca cgctgctgca atcttggagt 1380
ccgaaa 1386
<210> 4
<211> 2418
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
atggccgaac gtgtcctgac ccgtgtccat agtctgcgtg aacgtgttga tgctaccctg 60
gctgcccacc gtaatgaaat cctgctgttt ctgagtcgta ttgaaagcca cggcaaaggt 120
atcctgaaac cgcacgaact gctggcagaa tttgatgcta ttcgccagga tgacaaaaac 180
aaactgaacg aacatgcatt cgaagaactg ctgaaaagca cccaagaagc tatcgtcctg 240
ccgccgtggg tggcactggc aattcgtctg cgcccgggcg tttgggaata catccgtgtt 300
aacgtcaatg cgctggttgt ggaagaactg agtgtgccgg aatatctgca gtttaaagaa 360
gaactggtcg atggcgcgtc caacggtaat ttcgtgctgg aactggactt tgaaccgttc 420
accgcctcat ttccgaaacc gaccctgacg aaatcgattg gcaacggtgt tgaatttctg 480
aatcgtcatc tgagcgccaa aatgttccac gataaagaat ctatgacccc gctgctggaa 540
tttctgcgcg cacatcacta taaaggtaaa accatgatgc tgaacgatcg tattcagaac 600
agcaatacgc tgcaaaatgt gctgcgcaaa gcggaagaat acctgatcat gctgccgccg 660
gaaaccccgt acttcgaatt tgaacataaa ttccaggaaa ttggcctgga aaaaggctgg 720
ggtgatacgg cagaacgtgt gctggaaatg gtttgcatgc tgctggatct gctggaagct 780
ccggacagct gtaccctgga aaaatttctg ggtcgcattc cgatggtttt caacgtcgtg 840
atcctgtctc cgcacggcta ttttgcgcag gaaaatgtcc tgggttaccc ggataccggc 900
ggtcaggttg tctatattct ggaccaagtg ccggccctgg aacgtgaaat gctgaaacgc 960
atcaaagaac agggcctgga tattatcccg cgtattctga tcgtcacccg tctgctgccg 1020
gacgcagtgg gcaccacgtg cggtcaacgt attgaaaaag tgtatggcgc tgaacattca 1080
cacatcctgc gtgttccgtt tcgcaccgaa aaaggtattg tccgtaaatg gatctcgcgc 1140
tttgaagtgt ggccgtacat ggaaacgttc attgaagatg ttgcaaaaga aatctcagcg 1200
gaactgcagg ccaaaccgga cctgattatc ggcaactata gcgaaggtaa tctggcggcc 1260
tctctgctgg cccataaact gggcgtgacc caatgtacga ttgcacacgc tctggaaaaa 1320
accaaatatc cggattcgga catctactgg aaaaaattcg atgaaaaata ccatttcagc 1380
tctcagttca ccgcagatct gattgctatg aaccacacgg actttattat caccagtacg 1440
ttccaggaaa tcgcgggctc caaagatacc gtgggtcaat acgaaagtca tatggccttt 1500
acgatgccgg gcctgtatcg cgtggttcac ggtatcaacg ttttcgatcc gaaattcaac 1560
attgtctccc cgggtgcaga catcaatctg tatttttcat actcggaaac cgaaaaacgt 1620
ctgacggctt tccatccgga aatcgatgaa ctgctgtata gcgatgtgga aaacgacgaa 1680
cacctgtgcg ttctgaaaga tcgcaccaaa ccgattctgt ttacgatggc gcgtctggac 1740
cgcgttaaaa atctgaccgg cctggtcgaa tggtacgcca aaaacccgcg tctgcgcggt 1800
ctggtgaatc tggtcgtggt tggcggtgat cgtcgcaaag aatctaaaga cctggaagaa 1860
caggcggaaa tgaagaaaat gtacgaactg atcgaaaccc ataacctgaa tggccagttc 1920
cgttggatca gttcccaaat gaaccgtgtt cgcaatggcg aactgtatcg ctacatcgca 1980
gatacgaaag gtgcttttgt ccagccggcg ttttacgaag ccttcggcct gaccgtcgtg 2040
gaagcgatga cgtgcggtct gccgaccttc gcaacgaatc atggcggccc ggcagaaatt 2100
atcgttcacg gcaaaagtgg ttttcatatt gatccgtatc acggcgaaca ggcagctgat 2160
ctgctggccg actttttcga aaaatgtaaa aaagacccgt cacattggga aaccatttcg 2220
atgggcggtc tgaaacgcat cgaagaaaaa tatacctggc aaatttacag cgaatctctg 2280
ctgacgctgg cggccgtgta cggtttctgg aaacacgttt ctaaactgga tcgtctggaa 2340
attcgtcgct atctggaaat gttttatgcg ctgaaatacc gcaaaatggc ggaagccgtg 2400
ccgctggcag ctgaataa 2418
<210> 5
<211> 37
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
ggtcacctgc gctcgatggt ggaactgggt aaaacca 37
<210> 6
<211> 24
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
cgagcgcagg tgaccgatcg gcgg 24
<210> 7
<211> 37
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ggtcacctga aatcgatggt ggaactgggt aaaacca 37
<210> 8
<211> 24
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cgatttcagg tgaccgatcg gcgg 24
<210> 9
<211> 37
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ggtcacctga actcgatggt ggaactgggt aaaacca 37
<210> 10
<211> 24
<212> DNA/RNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
cgagttcagg tgaccgatcg gcgg 24
Claims (8)
1. A method for synthesizing quercetin-4' -glucoside, which is characterized by comprising the following steps:
1) Constructing recombinant bacteria with a double-enzyme system: connecting the gene of the glycosyltransferase UGT88A1 mutant with the sucrose synthase gene to obtain a recombinant plasmid, and transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) by adopting a heat shock method to obtain recombinant bacteria containing a double-enzyme system;
2) Induction of recombinant bacteria to produce enzymes: inoculating the recombinant bacteria into LB liquid culture medium, sampling at 25-40 ℃ to make OD 600 When the bacterial sludge is in a range of 0.4 to 0.5, using IPTG as an inducer, inducing for 12 to 24 hours at the temperature of 16 to 37 ℃ and the speed of 150 to 300r/min, centrifugally collecting bacterial sludge, crushing bacterial sludge by using an ultrasonic crushing method, centrifugally collecting supernatant, and obtaining crude enzyme liquid;
3) Dissolving quercetin in DMSO, adding crude enzyme solution and sucrose, reacting at 20-40deg.C for 8-30 hr, stopping reaction with methanol, and centrifuging to obtain quercetin-4' -glucoside;
the amino acid sequence of the glycosyltransferase UGT88A1 is shown as SEQ ID NO.1, the mutant is obtained by mutation of the SEQ ID NO.1, and the mutation is selected from any one of V18R/K/N, I118G, G181N, S271K, wherein "/" represents "or".
2. The method for synthesizing quercetin-4' -glucoside according to claim 1, wherein the sucrose synthase sequence is shown in SEQ ID NO. 2.
3. The method for synthesizing quercetin-4' -glucoside according to claim 1, wherein the concentration of inducer IPTG is 0.1mM and the induction period is 22h.
4. The method for synthesizing quercetin-4' -glucoside according to claim 1, wherein the final concentration of quercetin dissolved in DMSO is 20-40 mm; the final concentration of sucrose is 300-500 mM; the addition amount of the crude enzyme solution is 5-10 g/L.
5. A glycosyltransferase mutant suitable for use in the synthesis of quercetin-4' -glucoside, wherein the glycosyltransferase mutant is derived from a mutation in SEQ ID No.1 selected from any one of V18R/K/N, I118G, G181N, S271K, wherein "/" means "or".
6. An expressed gene encoding the glycosyltransferase mutant of claim 5.
7. A recombinant plasmid, wherein the expression gene according to claim 6 and sucrose synthase gene SUS are linked.
8. A recombinant cell comprising the expressed gene of claim 6 or the recombinant plasmid of claim 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910316885.9A CN110029118B (en) | 2019-04-19 | 2019-04-19 | Method for synthesizing quercetin-4' -glucoside |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910316885.9A CN110029118B (en) | 2019-04-19 | 2019-04-19 | Method for synthesizing quercetin-4' -glucoside |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110029118A CN110029118A (en) | 2019-07-19 |
| CN110029118B true CN110029118B (en) | 2023-10-10 |
Family
ID=67239216
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910316885.9A Active CN110029118B (en) | 2019-04-19 | 2019-04-19 | Method for synthesizing quercetin-4' -glucoside |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110029118B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110872594B (en) * | 2019-12-09 | 2021-04-06 | 四川农业大学 | Blackberry glycosyltransferase gene and application thereof |
| CN111662831A (en) * | 2020-06-12 | 2020-09-15 | 浙江工业大学 | Aspergillus niger Rha-N1 and application thereof |
| CN113322219B (en) * | 2021-02-19 | 2023-01-17 | 南京工业大学 | Method for synthesizing curcumin glucoside compound by biological method catalysis |
| CN116445441B (en) * | 2022-11-30 | 2023-11-03 | 东北农业大学 | Soybean glycosyltransferase and encoding gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589702A (en) * | 2013-11-19 | 2014-02-19 | 南京市第一医院 | Application of heat-resistant beta-glucosidase and mutants thereof |
| WO2015028324A2 (en) * | 2013-08-30 | 2015-03-05 | Evolva Sa | A method for producing modified resveratrol |
| CN109234337A (en) * | 2018-09-14 | 2019-01-18 | 南京工业大学 | A kind of biological synthesis method of quercetin glycoside |
-
2019
- 2019-04-19 CN CN201910316885.9A patent/CN110029118B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015028324A2 (en) * | 2013-08-30 | 2015-03-05 | Evolva Sa | A method for producing modified resveratrol |
| CN103589702A (en) * | 2013-11-19 | 2014-02-19 | 南京市第一医院 | Application of heat-resistant beta-glucosidase and mutants thereof |
| CN109234337A (en) * | 2018-09-14 | 2019-01-18 | 南京工业大学 | A kind of biological synthesis method of quercetin glycoside |
Non-Patent Citations (2)
| Title |
|---|
| Arabidopsis Glycosyltransferases as Biocatalysts in Fermentation for Regioselective Synthesis of Diverse Quercetin Glucosides;Lim et al.;《Biotechnology and Bioengineering》;20040806;摘要、Table 2 * |
| Expression, characterization, and site-directed mutagenesis of UDP-glycosyltransferase UGT88A1 from Arabidopsis thaliana;Weng et al.;《Bioengineered》;20190509;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110029118A (en) | 2019-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110029118B (en) | Method for synthesizing quercetin-4' -glucoside | |
| KR101200571B1 (en) | Ginsenoside glycosidase from terrabacter sp and use thereof | |
| CN107236696B (en) | A kind of sucrose phosphorylase recombined bacillus subtilis for expressing the source L.mesenteroides | |
| CN104762281B (en) | A kind of α rhamnosidases and its preparation method and application | |
| KR101098027B1 (en) | Ginsenoside glycosidase from Rhodanobacter ginsenosidimutans KCTC22231T and use thereof | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN113621593B (en) | Polyketide synthases EnPKS1 and EnPKS2 from lithocarpus as well as genes and applications thereof | |
| CN109957555B (en) | Glycosyl transferase mutant and application thereof in catalyzing biosynthesis of gastrodin | |
| CN109796516B (en) | A method for synthesizing natural and unnatural protopanaxatriol type ginsenoside | |
| CN111662831A (en) | Aspergillus niger Rha-N1 and application thereof | |
| CN113736763B (en) | Myrosinase Rmmr and application thereof in preparation of sulforaphane and sulforaphane | |
| CN114231477B (en) | Genetically engineered strain for high yield of beta-nicotinamide mononucleotide, construction and application thereof | |
| CN111690630A (en) | Beta-glucosidase, encoding gene thereof, expression and application thereof | |
| CN109402092B (en) | Chitinase derived from marine environment and gene thereof | |
| CN109234337B (en) | Biosynthesis method of quercetin glycoside | |
| CN108531470B (en) | Fucoidin lyase TFLFM and preparation method and application thereof | |
| KR101919105B1 (en) | A Novel alpha-neoagarobiose hydrolase from Gayadomonas joobiniege G7 and use thereof | |
| CN106566824B (en) | A kind of glucose isomerase, gene, carrier, engineering bacteria and its application | |
| CN109402080B (en) | Protein UGT142 and coding gene and application thereof | |
| CN109628476B (en) | Method for producing 4-hydroxyisoleucine by using whole cell transformation | |
| CN114836398B (en) | Application of glycosyltransferase mutant in directional synthesis of non-natural ginsenoside | |
| CN113980931B (en) | Application of glucuronic acid hydrolase and mutant thereof in preparation of oleanolic acid-beta-D-glucopyranosyl ester | |
| CN113980932B (en) | Site-directed mutagenesis alpha-glucosidase | |
| CN113862290B (en) | Isoflavone 4' -O-methyltransferase from liquorice and application thereof | |
| CN105154457B (en) | A kind of sorbitol dehydrogenase gene and its application from pseudomonas syringae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |