CN110029118A - Method for synthesizing quercetin-4' -glucoside - Google Patents

Method for synthesizing quercetin-4' -glucoside Download PDF

Info

Publication number
CN110029118A
CN110029118A CN201910316885.9A CN201910316885A CN110029118A CN 110029118 A CN110029118 A CN 110029118A CN 201910316885 A CN201910316885 A CN 201910316885A CN 110029118 A CN110029118 A CN 110029118A
Authority
CN
China
Prior art keywords
quercetin
leu
ile
glu
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910316885.9A
Other languages
Chinese (zh)
Other versions
CN110029118B (en
Inventor
贾红华
李艳
唐可馨
翁婧媛
严明
陈可泉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Tech University
Original Assignee
Nanjing Tech University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Tech University filed Critical Nanjing Tech University
Priority to CN201910316885.9A priority Critical patent/CN110029118B/en
Publication of CN110029118A publication Critical patent/CN110029118A/en
Application granted granted Critical
Publication of CN110029118B publication Critical patent/CN110029118B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1062—Sucrose synthase (2.4.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01013—Sucrose synthase (2.4.1.13)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention discloses a method for synthesizing quercetin-4' -glucoside, which comprises the steps of connecting genes of glycosyltransferase UGT88A1 or mutants thereof with sucrose synthase genes to obtain recombinant plasmids, constructing recombinant bacteria containing a double-enzyme system, inoculating the recombinant bacteria into 100mL LB liquid culture medium, sampling at 25-40 ℃, and enabling OD to be OD600When the temperature is 0.4-0.5 ℃, IPTG is used as an inducer, induction is carried out for 12-24 hours at the temperature of 16-37 ℃ under the condition of 150-300 r/min, bacterial sludge is collected centrifugally, thalli are crushed by an ultrasonic crushing method, and supernatant is collected centrifugally under the condition of 8000r/min, so as to obtain crude enzyme liquid; dissolving quercetin in DMSO, adding crude enzyme solution and sucrose, reacting at 20-40 deg.C for 8-30h, terminating reaction with methanol, and centrifuging to obtain quercetin-4' -glucoside. The amino acid sequence of the glycosyltransferase mutant is the amino acid sequence of the amino acid sequence shown in SEQ ID NO.1, and the mutated amino acid position is selected from one or more of V18, I118, G181 and S271. The mutant is simple to prepare, and the yield of the quercetin-4' -glucoside is improved.

Description

A method of synthesis Quercetin -4 '-glucoside
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of biological synthesis method of quercetin glycoside.
Background technique
Quercetin is a kind of natural flavonoid compound, mostly in the form of glycoside, is widely present in the flower, leaf, fruit of plant In the tissue such as real.Quercetin and its derivative have the effect of anti-oxidant, anti-inflammatory, anticancer, at the same also have diabetes mellitus prevention and Blood lipid, the effect that blood pressure reduces.The content factor of Quercetin is related with its growing environment and tissue site, is distributed many places in fruit Vegetable epidermis.Quercetin is not soluble in water, it is contemplated that absorbs problem, needs to enhance its water solubility, so that it preferably acts on human body. Using glycosylated method, increase its hydrophilic radical, so that solubility increases.But now, glycosidase Synthesis is utilized Quercetin derivative conversion ratio and yield it is relatively low, and water-soluble problem limits research and development.Quercetin -4 '-Portugal Polyglycoside is the glycosylated product of Quercetin, is known as preferably water-soluble and pharmacological action than quercitrin.Quercetin -4 '-glucose Glycosides is called helicine, it is present in onion, and in dry weight in 0.036-23.92g/kg, content is less, is not easy to be mentioned It takes.Since still quercetin component natural origin is extensive, pass through one step conversion using novel glycoside enzyme using genetic engineering Quercetin -4 '-glucoside is produced, there is great process advantage and raw material advantage.
Summary of the invention
The object of the present invention is to provide a kind of methods for synthesizing Quercetin -4 '-glucoside, using novel quercetin glycoside The mutant of enzyme realizes the glycosylation modified of Quercetin, and Quercetin -4 '-glucoside is prepared.
To achieve the goals above, the technical solution adopted by the present invention are as follows:
A kind of glycosyl transferase mutant suitable for quercetin glycoside synthesis, the amino acid sequence of glycosyl transferase mutant are The amino acid sequence to mutate shown in SEQ ID NO.1, the amino acid sites of mutation are in V18, I118, G181, S271 One or more.
Further, the mutation that the amino acid sites of mutation occur include it is following any one or more: V18R/K/N, Wherein, "/" indicates "or" by I118G, G181N, S271K.
V18R/K/N be SEQ ID NO.1 sequence in the 18th amino acids by valine (V) sport arginine (R) or Lysine (K) or asparagine (N)；I118G is sported for the 118th amino acids in ID NO.1 sequence by isoleucine (I) sweet Propylhomoserin (G), G181N sport asparagine (N) by glycine (G) for the 181st amino acids in ID NO.1 sequence, and S271K is The 271st amino acids sport lysine (K) by serine (S) in ID NO.1 sequence.
A kind of expressing gene, the gene encode any of the above-described kind of glycosyl transferase mutant.
A kind of recombinant plasmid, the recombinant plasmid are connected with above-mentioned expressing gene and sucrose synthase gene SUS.
A kind of recombinant cell, the recombinant cell include above-mentioned recombinant expression carrier or above-mentioned glycosyl transferase mutant Expressing gene.
Above-mentioned glycosyl transferase mutant is in the application for preparing Quercetin -4 '-glucoside.
The biological synthesis method of Quercetin -4 '-glucoside:
1) building has the recombinant bacterium of dual-enzyme system: by glycosyl transferase UGT88A1 or the gene and sucrose synthase of its mutant Gene connects to obtain recombinant plasmid, using heat shock method by recombinant plasmid transformed to e. coli bl21 (DE3) competent cell, Obtain the recombinant bacterium containing dual-enzyme system；
2) the induction producing enzyme of recombinant bacterium: recombinant bacterium being inoculated in LB liquid medium, 25 ~ 40 DEG C, and sampling makes OD600It is in When 0.4~0.5, use IPTG as inducer, induction 12 ~ for 24 hours is carried out at 16 ~ 37 DEG C, under conditions of 150 ~ 300r/min, from The heart collects bacterium mud, is crushed thallus using sonioation method, supernatant is collected by centrifugation under the conditions of 8000r/min, obtains crude enzyme liquid；
3) Quercetin is dissolved in DMSO, crude enzyme liquid, sucrose is added, reacts 8-30h under the conditions of 20-40 DEG C, use methanol end It only reacts, centrifugation obtains Quercetin -4 '-glucoside.
The gene order of glycosyl transferase UGT88A1 is as shown in SEQ ID.3, the sequence of sucrose synthase gene such as SEQ Shown in ID.4.
Quercetin is dissolved in final concentration of 20 ~ 40mM in DMSO；Final concentration of 300 ~ the 500mM of sucrose；Crude enzyme liquid additional amount is 5 ~10g/L.
The present invention is to derive fromArabidopsis thalianaBased on glycosyl transferase UGT88A1, believed using biology Method analysis is ceased, saturation mutation is carried out to its activated centre key amino acid, after screening mutant strain, obtains glycosyl transfer Enzyme mutant.The glycosyl transferase mutant and the double enzymes of sucrose synthase progress is coupled, and using Quercetin as substrate, addition is appropriate Sucrose, catalysis generate Quercetin -4 '-glucoside.Mutant preparation is simple, and yield is big, realizes Quercetin -4 '-grape The raising of the yield of glucosides, under the same terms, mutant activity improves 2.5 times compared with protoenzyme, produces Quercetin -4 '-grape The conversion ratio of glucosides increases significantly compared with protoenzyme.
The present invention improves the enzyme activity of glycosyl transferase UGT88A1 by mutation, realizes Quercetin-using the mutant The one-step conversion of 4 '-glucosides.
Detailed description of the invention
Fig. 1 reaction system substrate product detects liquid chromatogram map.
Specific embodiment
Detection method employed in following embodiment is as follows:
HPLC measuring method: chromatographic column: Agilent TC-C18 (4 .6mm × 250mm)；Mobile phase (A): the trifluoro of water+1 ‰ Acetic acid, (B): the trifluoroacetic acid of acetonitrile+1 ‰;
It is 1.0mL/min with flow velocity, Detection wavelength 350nm, sample volume 20 μ L under conditions of 40 DEG C of column temperature, carry out gradient and wash It is de-.
The method of mutant is confirmed employed in following embodiment:
This research uses the BLASTP method of NCBI, is screened according to conserved positions, obtains a plurality of similar to homology The known crystalline structure sequence of UGT88A1, by analysis, homologous modeling.Using the homologous modeling of pymol, and with substrate UDPG's Docking, is made energy calculation and is optimized using amber plug-in unit.It selects to obtain the 18th amino acids figured silk fabrics close to activated centre site Propylhomoserin (V) is 5 with active site distance, can have hydrogen bond action with substrate.18th valine (V) is saturated Mutation, effectively sports arginine (R) or lysine (K) or asparagine (N).Other amino acid sites mutation and this method It is similar.
Embodiment 1
The preparation of glycosyl transferase mutant: from glycosyl transferase UGT88A1 mutant V18R, the V18N of arabidopsis, V18K carries out saturation mutation according to the gene order of glycosyl transferase UGT88A1, measures DNA encoding sequence, and import large intestine It is expressed in bacillus, obtains mutation glycosyl transferase, single mutation V18R, V18N, V18K is limited by Jin Sirui biotechnology Company's synthesis is building up on pRSFDuet carrier.
The mutant primer of V18R are as follows:
Forward primer: GGTCACCTGCGCTCGATGGTGGAACTGGGTAAAACCA
Reverse primer: CGAGCGCAGGTGACCGATCGGCGG
The mutant primer of V18K are as follows:
Forward primer: GGTCACCTGAAATCGATGGTGGAACTGGGTAAAACCA
Reverse primer: CGATTTCAGGTGACCGATCGGCGG
The mutant primer of V18N are as follows:
Forward primer: GGTCACCTGAACTCGATGGTGGAACTGGGTAAAACCA
Reverse primer: CGAGTTCAGGTGACCGATCGGCGG
The plasmid built is transformed intoE.coliIn BL21 (DE3) competent cell, the LB of 50 μ g/mL kanamycins is utilized Solid medium is screened, and 37 DEG C are incubated overnight.100mL LB solid culture based formulas are as follows: 1g yeast extract, 1g albumen Peptone, 1g NaCl, 2g agarose, is dissolved in 100mL deionized water, and culture dish is poured into sterilizing later.Random picking single colonie To shaking in pipe for the 5mL LB liquid medium containing 50 μ g/mL kanamycins, it is incubated overnight, sequence verification sequence is correct.
By mutant and the coupled building dual-enzyme system of sucrose synthase
By UGT88A1 Direct Cloning to pRSFDuet'sNdeI andXhoBetween I restriction enzyme site, recombinant plasmid pRSFDuet- is obtained 88a1(pRSFDuet plasmid origin is in Jin Sirui company).
Recombinant plasmid pRSFDuet-88a1 is usedNcoI andEcoRI digestion, obtains linearized vector, to sucrose The plasmid pETDuet_SUS (coming from Jin Sirui company) of synthase is usedNcoI andEcoRI digestion processing, obtains SUS gene piece Section.Glue recycling is carried out to SUS genetic fragment and linearized vector, by the UGT segment and SUS genetic fragment after mutation, in 16 DEG C Connection overnight.Connection product is transformed into e. coli bl21 (DE3) competent cell using heat shock method, screening obtains the positive Clone, obtains new recombinant plasmid sus_pRSFDuet-88a1_6HIS, is then introduced into competent cell BL21(DE3) in, Obtain the recombinant bacterium containing dual-enzyme system.
The induction of 2 mutant strain of embodiment
By in the BL21(DE3 of the sus_pRSFDuet-88a1_6HIS containing recombinant plasmid) 100mL LB liquid medium, 37 DEG C, sampling makes OD600When in 0.4~0.5, IPTG is used to be lured under conditions of 200r/min as inducer at 16 DEG C Lead 22h.100mL LB liquid medium formula are as follows: 1g yeast extract, 1g peptone, 1g NaCl, 2g agarose are dissolved in In 100mL deionized water.After thallus is resuspended using 100mM potassium phosphate buffering (pH8 .0), it is centrifuged, collects bacterium Body.Centrifugal condition: 4 DEG C, 6000/min, 3min.
It is crushed thallus using sonioation method, broken condition: 300W, working time 1s, interval 2s, whole 20min.
After broken, supernatant is collected by centrifugation.Centrifugal condition: 8000r/min, 25min.
3 measuring method of embodiment
The conversion ratio measuring method and glycosyl transferase enzyme activity determination side of glycosyl transferase mutant and the coupled double enzymes of sucrose synthase Method are as follows: reaction solution total system is 220 μ l, contains 0.5 mM Quercetin (being dissolvable in water 15%DMSO), 5 mM UDPG, 6.8 pH phosphoric acid Potassium buffering, final concentration of protein are 0.1 mg/mL.After 37 DEG C of 30 min of reaction, 180 μ l methanol terminate reaction.
Centrifugal condition: room temperature, 12000 r/min, 1 min.Quantitative approach: HPLC carries out analysis supernatant.
Enzyme activity unit is defined as: it is 1 that 1 min, which is catalyzed enzyme amount required for forming 1 μm of ol Quercetin -4 '-glucoside, A unit of activity (U).
The enzyme activity determination method of sucrose synthase: reaction solution total system is 3mL, sucrose containing 500mM, 10mM UDP, pH 7.2 potassium phosphates buffering, is added 6mg albumen.After 30 DEG C of 1 h of reaction, 1mL reaction solution is taken, is boiled at 95 DEG C 10 minutes.
Centrifugal condition: room temperature, 12000 r/min, 1 min.Quantitative approach: DNS method measures supernatant.
Enzyme activity unit is defined as: the enzyme amount of 1 μm of ol reduced sugar of release is a unit of activity (U) per minute.
Quercetin -4 '-glucoside detection method of content:
In 10ml system, the enzyme solution of final concentration of 5mg/mL is added, the Quercetin of conversion of substrate final concentration 32mM (is dissolved in 5% DMSO), the sucrose final concentration 320mM of pH 7.2, reacts 12 h under the conditions of 30 °C.
100 μ l reaction solutions are taken, 900 μ l methanol are added and terminate reaction.
Centrifugal condition: room temperature, 12000 r/min, 1 min.Quantitative approach: HPLC detects Quercetin in transformation system, Mongolian oak Pi Su -4 '-glucoside content.The yield for defining protoenzyme is 100%.
Compared with protoenzyme, mutant enzyme activity greatly improves the mutant enzyme that the expression of above-mentioned mutant is obtained, meanwhile, mutation Body realizes the raising of Quercetin to Quercetin -4 '-glucoside yield, compared with chemical leaching test, has environment-friendly and green raw It produces, low energy consumption, the advantages such as high-content.Mutant enzyme is substrate Quercetin -4 '-glucoside yield relative to protoenzyme using Quercetin It improves to 243%, 200%, 169%.Measurement result is as shown in table 1.
Table 1
Sample name Enzyme activity (mU/mg) Yield (mg/L)
Protoenzyme 227.6 100%(290.2)
V18R 552.3 208%(630.1)
V18K 454.7 130%(380.5)
V18N 384.6 153%(450)
Other mutational sites of embodiment 3
According to the method described above, it will be similarly positioned in I118G near activated centre, G181N, S271K are mutated, according to the method described above Screening and culturing is carried out, is detected using same procedure.These catastrophe points improve Quercetin -4 '-glucose yield 110- 150%.Measurement result is as shown in table 2.
Table 2
Sample name Enzyme activity (mU/mg) Yield (mg/L)
Protoenzyme 227.6 100% (290.2)
I118G 319.3 145% (421)
G181N 257.2 130% (377.8)
S271K 279.9 128% (371.2)
The production of 4 Quercetin -4 ' of embodiment-glucoside
Quercetin is dissolved in 5%DMSO aqueous solution, the final concentration of 320mM of sucrose, the final concentration of 32mM of Quercetin, is added thick The final concentration of 5mg/mL of enzyme solution reacts 12h under the conditions of 30 DEG C, is terminated and is reacted using methanol, and centrifugation obtains Quercetin -4 '-Portugal Grape sugar glucosides.100 μ l reaction solutions are taken, 900 μ l methanol are added and terminate reaction.It is detected using substrate product using HPLC.
Measuring method: chromatographic column: Agilent TC-C18 (4 .6mm × 250mm)；Mobile phase (A): the trifluoro of water+1 ‰ Acetic acid, (B): the trifluoroacetic acid of acetonitrile+1 ‰;
It is 1.0mL/min with flow velocity, Detection wavelength 350nm, sample volume 20 μ L under conditions of 40 DEG C of column temperature, carry out gradient and wash It is de-.
Centrifugal condition: room temperature, 12000 r/min, 1 min.
Reaction system substrate product detects liquid chromatogram as shown in Figure 1, the retention time of Quercetin is before 20.5min Afterwards, Quercetin -4 '-glucoside retention time is before and after 14min.
Sequence table
<110>Nanjing University of Technology
<120>a kind of method for synthesizing Quercetin -4 '-glucoside
<141> 2019-04-19
<160> 10
<170> SIPOSequenceListing 1.0
<210> 2
<211> 462
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Gly Glu Glu Ala Ile Val Leu Tyr Pro Ala Pro Pro Ile Gly His
1 5 10 15
Leu Val Ser Met Val Glu Leu Gly Lys Thr Ile Leu Ser Lys Asn Pro
20 25 30
Ser Leu Ser Ile His Ile Ile Leu Val Pro Pro Pro Tyr Gln Pro Glu
35 40 45
Ser Thr Ala Thr Tyr Ile Ser Ser Val Ser Ser Ser Phe Pro Ser Ile
50 55 60
Thr Phe His His Leu Pro Ala Val Thr Pro Tyr Ser Ser Ser Ser Thr
65 70 75 80
Ser Arg His His His Glu Ser Leu Leu Leu Glu Ile Leu Cys Phe Ser
85 90 95
Asn Pro Ser Val His Arg Thr Leu Phe Ser Leu Ser Arg Asn Phe Asn
100 105 110
Val Arg Ala Met Ile Ile Asp Phe Phe Cys Thr Ala Val Leu Asp Ile
115 120 125
Thr Ala Asp Phe Thr Phe Pro Val Tyr Phe Phe Tyr Thr Ser Gly Ala
130 135 140
Ala Cys Leu Ala Phe Ser Phe Tyr Leu Pro Thr Ile Asp Glu Thr Thr
145 150 155 160
Pro Gly Lys Asn Leu Lys Asp Ile Pro Thr Val His Ile Pro Gly Val
165 170 175
Pro Pro Met Lys Gly Ser Asp Met Pro Lys Ala Val Leu Glu Arg Asp
180 185 190
Asp Glu Val Tyr Asp Val Phe Ile Met Phe Gly Lys Gln Leu Ser Lys
195 200 205
Ser Ser Gly Ile Ile Ile Asn Thr Phe Asp Ala Leu Glu Asn Arg Ala
210 215 220
Ile Lys Ala Ile Thr Glu Glu Leu Cys Phe Arg Asn Ile Tyr Pro Ile
225 230 235 240
Gly Pro Leu Ile Val Asn Gly Arg Ile Glu Asp Arg Asn Asp Asn Lys
245 250 255
Ala Val Ser Cys Leu Asn Trp Leu Asp Ser Gln Pro Glu Lys Ser Val
260 265 270
Val Phe Leu Cys Phe Gly Ser Leu Gly Leu Phe Ser Lys Glu Gln Val
275 280 285
Ile Glu Ile Ala Val Gly Leu Glu Lys Ser Gly Gln Arg Phe Leu Trp
290 295 300
Val Val Arg Asn Pro Pro Glu Leu Glu Lys Thr Glu Leu Asp Leu Lys
305 310 315 320
Ser Leu Leu Pro Glu Gly Phe Leu Ser Arg Thr Glu Asp Lys Gly Met
325 330 335
Val Val Lys Ser Trp Ala Pro Gln Val Pro Val Leu Asn His Lys Ala
340 345 350
Val Gly Gly Phe Val Thr His Cys Gly Trp Asn Ser Ile Leu Glu Ala
355 360 365
Val Cys Ala Gly Val Pro Met Val Ala Trp Pro Leu Tyr Ala Glu Gln
370 375 380
Arg Phe Asn Arg Val Met Ile Val Asp Glu Ile Lys Ile Ala Ile Ser
385 390 395 400
Met Asn Glu Ser Glu Thr Gly Phe Val Ser Ser Thr Glu Val Glu Lys
405 410 415
Arg Val Gln Glu Ile Ile Gly Glu Cys Pro Val Arg Glu Arg Thr Met
420 425 430
Ala Met Lys Asn Ala Ala Glu Leu Ala Leu Thr Glu Thr Gly Ser Ser
435 440 445
His Thr Ala Leu Thr Thr Leu Leu Gln Ser Trp Ser Pro Lys
450 455 460
<210> 2
<211> 806
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Pro Glu Leu Ile Gln Thr Leu Leu Asp Ser Glu Glu Lys Ser Asp
1 5 10 15
Leu Arg Ser Phe Val Ser Glu Leu Arg Gln Gln Glu Lys Lys Tyr Leu
20 25 30
Leu Arg Asn Asp Ile Val Asn Val Tyr Ser Glu Tyr Cys Ser Lys Tyr
35 40 45
Gln Lys Ser Glu Lys Phe His Thr Ser Ser Asn Leu Gly Lys Leu Ile
50 55 60
Tyr Tyr Thr Gln Glu Ile Ile Gln Glu Asp Ser Asn Leu Tyr Phe Ile
65 70 75 80
Ile Arg Ser Lys Ile Ala Ser Gln Gln Val Tyr Arg Leu Thr Asp Asp
85 90 95
Leu Ser Ile Glu Ser Ile Thr Ile Gln Glu Leu Leu Asp Val Arg Asp
100 105 110
Arg Phe Val Asn Arg Tyr Gln Pro Asn Glu Gly Asp Leu Leu Glu Leu
115 120 125
Asp Phe Gly Pro Phe Tyr Asp Tyr Ser Pro Val Ile Arg Asp Pro Lys
130 135 140
Asn Ile Gly Lys Gly Val Gln Tyr Leu Asn Arg Tyr Leu Ser Ser Lys
145 150 155 160
Leu Phe Gln Asp Ala Lys Gln Trp Leu Glu Ser Leu Phe Gly Phe Leu
165 170 175
Arg Leu His Gln Tyr Asn Gly Ile Gln Leu Leu Ile Asn Asp Arg Ile
180 185 190
Lys Thr Gln Gln Gln Leu Ser Glu Gln Val Lys Lys Ala Ile Ala Ile
195 200 205
Val Ser Asp Arg Pro Arg Asp Glu Pro Tyr Glu Glu Phe Arg Phe Ala
210 215 220
Leu Gln Thr Ile Gly Phe Glu Pro Gly Trp Gly Asn Thr Ala Gln Arg
225 230 235 240
Val Gln Glu Thr Leu Ser Ile Leu Asp Glu Leu Ile Asp Ser Pro Asp
245 250 255
Pro Gln Thr Leu Glu Ala Phe Ile Ser Arg Ile Pro Met Ile Phe Arg
260 265 270
Ile Val Leu Val Ser Ala His Gly Trp Phe Gly Gln Glu Gly Val Leu
275 280 285
Gly Arg Pro Asp Thr Gly Gly Gln Val Val Tyr Val Leu Asp Gln Ala
290 295 300
Lys Asn Leu Glu Lys Gln Leu Gln Glu Asp Val Ile Leu Ala Gly Leu
305 310 315 320
Glu Arg Leu Asn Val Gln Pro Lys Val Ile Ile Leu Thr Arg Leu Ile
325 330 335
Pro Asn Ser Asp Gly Thr Leu Cys His Gln Arg Leu Glu Lys Val His
340 345 350
Gly Thr Glu Asn Ala Trp Ile Leu Arg Val Pro Leu Arg Asp Phe Asn
355 360 365
Pro Asn Met Thr Gln Asn Trp Ile Ser Arg Phe Glu Phe Trp Pro Tyr
370 375 380
Leu Glu Thr Tyr Ala Ile Asp Ala Glu Lys Glu Leu Arg Ala Glu Leu
385 390 395 400
Gln Gly Arg Pro Asp Leu Ile Val Gly Asn Tyr Ser Asp Gly Asn Leu
405 410 415
Val Ala Phe Leu Leu Ala Arg His Met Lys Val Thr Gln Cys Asn Ile
420 425 430
Ala His Ala Leu Glu Lys Ser Lys Tyr Leu Phe Ser Asn Leu Tyr Trp
435 440 445
Gln Asp Leu Asp Asp Lys Tyr His Phe Ser Leu Gln Phe Thr Ala Asp
450 455 460
Leu Ile Ala Met Asn Ala Ala Asn Phe Val Ile Ser Ser Thr Tyr Gln
465 470 475 480
Glu Ile Val Gly Thr Pro Asp Ser Ile Gly Gln Tyr Glu Ser Tyr Lys
485 490 495
Cys Phe Thr Met Pro Asp Leu Tyr His Val Val Asn Gly Ile Glu Leu
500 505 510
Phe Ser Pro Lys Phe Asn Val Val Pro Pro Gly Val Ser Glu Asn Tyr
515 520 525
Tyr Phe Pro Tyr Phe Gln Thr Gln Asp Arg Val Glu Ser Asp Arg Gln
530 535 540
Arg Ile Thr Glu Leu Leu Phe Thr Leu Asp Asp Pro Thr Gln Ile Phe
545 550 555 560
Gly Gln Leu Asp Asn Pro Asn Lys Arg Pro Ile Phe Ser Met Ala Arg
565 570 575
Leu Asp Arg Ile Lys Asn Leu Thr Gly Leu Ala Glu Cys Phe Gly Lys
580 585 590
Ser Gln Glu Leu Gln Glu His Cys Asn Leu Ile Leu Val Ala Gly Lys
595 600 605
Leu Arg Val Glu Glu Ser Gly Asp Asn Glu Glu Arg Asp Glu Ile Val
610 615 620
Lys Leu Tyr Gln Ala Ile Glu Gln Tyr Asn Leu His Gly Lys Ile Arg
625 630 635 640
Trp Leu Gly Val Arg Leu Ser Lys Asn Asp Ser Gly Glu Ile Tyr Arg
645 650 655
Val Ile Ala Asp His Lys Gly Val Phe Val Gln Pro Ala Leu Phe Glu
660 665 670
Ala Phe Gly Leu Thr Ile Leu Glu Ala Met Ile Ser Gly Leu Pro Thr
675 680 685
Phe Gly Thr Gln Phe Gly Gly Pro Leu Glu Ile Ile Gln Asp Arg Val
690 695 700
Asn Gly Phe Tyr Ile Asn Pro Thr Asn Leu Glu Glu Thr Ala Ala Lys
705 710 715 720
Ile Leu Asp Phe Val Ile Lys Cys Glu Glu Arg Pro Asn Ser Trp Asn
725 730 735
Glu Ile Ser Gln Gln Gly Ile Asp Arg Val Tyr Ser Thr Tyr Thr Trp
740 745 750
Lys Ile His Thr Thr Lys Leu Leu Ser Leu Ala Arg Ile Tyr Gly Phe
755 760 765
Trp Asn Phe Thr Ser Gln Glu Asn Arg Glu Asp Leu Leu Arg Tyr Ile
770 775 780
Glu Ala Leu Phe Tyr Leu Ile Tyr Lys Pro Arg Ala Gln Gln Leu Leu
785 790 795 800
Glu Gln His Lys Tyr Arg
805
<210> 3
<211> 1386
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 3
atgggcgaag aagcaattgt gctgtatccg gctccgccga tcggtcacct ggtctcgatg 60
gtggaactgg gtaaaaccat tctgagcaaa aacccgtccc tgtcaatcca tattatcctg 120
gttccgccgc cgtatcagcc ggaatctacc gcaacgtaca ttagctctgt gagttcctca 180
tttccgagta tcaccttcca tcacctgccg gctgttaccc cgtatagcag cagcagcacg 240
tcgcgtcatc accatgaaag cctgctgctg gaaattctgt gcttttccaa tccgtcagtc 300
caccgcaccc tgttttcgct gagccgtaac ttcaatgtgc gcgcaatgat tatcgatttc 360
ttttgcaccg cggtgctgga tattaccgcc gactttacgt tcccggttta tttcttttat 420
acctctggcg cggcctgtct ggcttttagt ttctatctgc cgacgatcga tgaaaccacg 480
ccgggtaaaa acctgaaaga cattccgacc gtccatatcc cgggtgtgcc gccgatgaaa 540
ggttctgata tgccgaaagc ggtgctggaa cgtgatgacg aagtttatga cgtctttatt 600
atgttcggca aacagctgag taaatcctca ggtattatca ttaacacctt tgatgccctg 660
gaaaatcgtg cgattaaagc catcacggaa gaactgtgtt tccgcaacat ttacccgatc 720
ggcccgctga ttgttaatgg tcgtatcgaa gatcgcaacg acaataaagc ggtcagctgc 780
ctgaactggc tggattctca accggaaaaa agtgtggttt ttctgtgttt cggctccctg 840
ggtctgtttt caaaagaaca ggttatcgaa attgccgtcg gcctggaaaa aagcggtcaa 900
cgtttcctgt gggtcgtgcg caatccgccg gaactggaaa aaaccgaact ggatctgaaa 960
tccctgctgc cggaaggctt tctgtcacgt acggaagaca agggtatggt tgtcaaatcc 1020
tgggcaccgc aggtgccggt tctgaaccac aaagccgttg gcggttttgt cacccattgc 1080
ggctggaata gcattctgga agcagtgtgt gctggtgtgc cgatggttgc gtggccgctg 1140
tacgccgaac agcgttttaa ccgcgtcatg atcgtggatg aaatcaaaat cgcaatctcg 1200
atgaacgaaa gcgaaaccgg cttcgtgtcg agcacggaag tggaaaaacg cgttcaagaa 1260
atcattggtg aatgcccggt tcgtgaacgc accatggcaa tgaaaaatgc agctgaactg 1320
gctctgaccg aaacgggttc tagtcacacg gccctgacca cgctgctgca atcttggagt 1380
ccgaaa 1386
<210> 4
<211> 2418
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 4
atggccgaac gtgtcctgac ccgtgtccat agtctgcgtg aacgtgttga tgctaccctg 60
gctgcccacc gtaatgaaat cctgctgttt ctgagtcgta ttgaaagcca cggcaaaggt 120
atcctgaaac cgcacgaact gctggcagaa tttgatgcta ttcgccagga tgacaaaaac 180
aaactgaacg aacatgcatt cgaagaactg ctgaaaagca cccaagaagc tatcgtcctg 240
ccgccgtggg tggcactggc aattcgtctg cgcccgggcg tttgggaata catccgtgtt 300
aacgtcaatg cgctggttgt ggaagaactg agtgtgccgg aatatctgca gtttaaagaa 360
gaactggtcg atggcgcgtc caacggtaat ttcgtgctgg aactggactt tgaaccgttc 420
accgcctcat ttccgaaacc gaccctgacg aaatcgattg gcaacggtgt tgaatttctg 480
aatcgtcatc tgagcgccaa aatgttccac gataaagaat ctatgacccc gctgctggaa 540
tttctgcgcg cacatcacta taaaggtaaa accatgatgc tgaacgatcg tattcagaac 600
agcaatacgc tgcaaaatgt gctgcgcaaa gcggaagaat acctgatcat gctgccgccg 660
gaaaccccgt acttcgaatt tgaacataaa ttccaggaaa ttggcctgga aaaaggctgg 720
ggtgatacgg cagaacgtgt gctggaaatg gtttgcatgc tgctggatct gctggaagct 780
ccggacagct gtaccctgga aaaatttctg ggtcgcattc cgatggtttt caacgtcgtg 840
atcctgtctc cgcacggcta ttttgcgcag gaaaatgtcc tgggttaccc ggataccggc 900
ggtcaggttg tctatattct ggaccaagtg ccggccctgg aacgtgaaat gctgaaacgc 960
atcaaagaac agggcctgga tattatcccg cgtattctga tcgtcacccg tctgctgccg 1020
gacgcagtgg gcaccacgtg cggtcaacgt attgaaaaag tgtatggcgc tgaacattca 1080
cacatcctgc gtgttccgtt tcgcaccgaa aaaggtattg tccgtaaatg gatctcgcgc 1140
tttgaagtgt ggccgtacat ggaaacgttc attgaagatg ttgcaaaaga aatctcagcg 1200
gaactgcagg ccaaaccgga cctgattatc ggcaactata gcgaaggtaa tctggcggcc 1260
tctctgctgg cccataaact gggcgtgacc caatgtacga ttgcacacgc tctggaaaaa 1320
accaaatatc cggattcgga catctactgg aaaaaattcg atgaaaaata ccatttcagc 1380
tctcagttca ccgcagatct gattgctatg aaccacacgg actttattat caccagtacg 1440
ttccaggaaa tcgcgggctc caaagatacc gtgggtcaat acgaaagtca tatggccttt 1500
acgatgccgg gcctgtatcg cgtggttcac ggtatcaacg ttttcgatcc gaaattcaac 1560
attgtctccc cgggtgcaga catcaatctg tatttttcat actcggaaac cgaaaaacgt 1620
ctgacggctt tccatccgga aatcgatgaa ctgctgtata gcgatgtgga aaacgacgaa 1680
cacctgtgcg ttctgaaaga tcgcaccaaa ccgattctgt ttacgatggc gcgtctggac 1740
cgcgttaaaa atctgaccgg cctggtcgaa tggtacgcca aaaacccgcg tctgcgcggt 1800
ctggtgaatc tggtcgtggt tggcggtgat cgtcgcaaag aatctaaaga cctggaagaa 1860
caggcggaaa tgaagaaaat gtacgaactg atcgaaaccc ataacctgaa tggccagttc 1920
cgttggatca gttcccaaat gaaccgtgtt cgcaatggcg aactgtatcg ctacatcgca 1980
gatacgaaag gtgcttttgt ccagccggcg ttttacgaag ccttcggcct gaccgtcgtg 2040
gaagcgatga cgtgcggtct gccgaccttc gcaacgaatc atggcggccc ggcagaaatt 2100
atcgttcacg gcaaaagtgg ttttcatatt gatccgtatc acggcgaaca ggcagctgat 2160
ctgctggccg actttttcga aaaatgtaaa aaagacccgt cacattggga aaccatttcg 2220
atgggcggtc tgaaacgcat cgaagaaaaa tatacctggc aaatttacag cgaatctctg 2280
ctgacgctgg cggccgtgta cggtttctgg aaacacgttt ctaaactgga tcgtctggaa 2340
attcgtcgct atctggaaat gttttatgcg ctgaaatacc gcaaaatggc ggaagccgtg 2400
ccgctggcag ctgaataa 2418
<210> 5
<211> 37
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggtcacctgc gctcgatggt ggaactgggt aaaacca 37
<210> 6
<211> 24
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cgagcgcagg tgaccgatcg gcgg 24
<210> 7
<211> 37
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 7
ggtcacctga aatcgatggt ggaactgggt aaaacca 37
<210> 8
<211> 24
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cgatttcagg tgaccgatcg gcgg 24
<210> 9
<211> 37
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ggtcacctga actcgatggt ggaactgggt aaaacca 37
<210> 10
<211> 24
<212> DNA/RNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cgagttcagg tgaccgatcg gcgg 24

Claims (10)

1. a kind of method for synthesizing Quercetin -4 '-glucoside, which comprises the steps of:
1) building has the recombinant bacterium of dual-enzyme system: by glycosyl transferase UGT88A1 or the gene and sucrose synthase of its mutant Gene connects to obtain recombinant plasmid, using heat shock method by recombinant plasmid transformed to e. coli bl21 (DE3) competent cell, Obtain the recombinant bacterium containing dual-enzyme system；
2) the induction producing enzyme of recombinant bacterium: recombinant bacterium being inoculated in LB liquid medium, 25 ~ 40 DEG C, and sampling makes OD600It is in When 0.4~0.5, use IPTG as inducer, induction 12 ~ for 24 hours is carried out at 16 ~ 37 DEG C, under conditions of 150 ~ 300r/min, from The heart collects bacterium mud, is crushed thallus using sonioation method, supernatant is collected by centrifugation, obtain crude enzyme liquid；
3) Quercetin is dissolved in DMSO, crude enzyme liquid, sucrose is added, reacts 8-30h under the conditions of 20-40 DEG C, use methanol end It only reacts, centrifugation obtains Quercetin -4 '-glucose glycoside.
2. the method for synthesis Quercetin -4 '-glucoside according to claim 1, which is characterized in that the glycosyl transfer For the amino acid sequence of enzyme UGT88A1 as shown in SEQ ID NO.1, the amino acid sequence of mutant is SEQ ID NO.1 mutation Amino acid sequence, the amino acid sites of mutation are selected from V18, I118, G181, one or more of S271.
3. the method for synthesis Quercetin -4 '-glucoside according to claim 1, which is characterized in that the sucrose synthase Sequence is as shown in SEQ ID NO.2.
4. the method for synthesis Quercetin -4 '-glucoside according to claim 1, which is characterized in that inducer IPTG's Concentration is 0.1mM, when induction a length of 22h.
5. the method for synthesis Quercetin -4 '-glucoside according to claim 1, which is characterized in that Quercetin is dissolved in Final concentration of 20 ~ 40mM in DMSO；Final concentration of 300 ~ the 500mM of sucrose；Crude enzyme liquid additional amount is 5~10g/L.
6. the method for synthesis Quercetin -4 '-glucoside according to claim 2, which is characterized in that the amino acid of mutation The mutation that site occurs include it is following any one or more: wherein, "/" indicates by V18R/K/N, I118G, G181N, S271K "or".
7. one kind is suitable for the glycosyl transferase mutant of Quercetin -4 '-glucoside synthesis, the ammonia of glycosyl transferase mutant Base acid sequence is the amino acid sequence to mutate shown in SEQ ID NO.1, and the amino acid sites of mutation select V18, I118, One or more of G181, S271.
8. a kind of expressing gene, which encodes glycosyl transferase mutant as claimed in claim 7.
9. a kind of recombinant plasmid, which is connected with expressing gene and sucrose synthase gene SUS according to any one of claims 8.
10. a kind of recombinant cell, which includes above-mentioned recombinant expression carrier or above-mentioned glycosyl transferase mutant Expressing gene.
CN201910316885.9A 2019-04-19 2019-04-19 Method for synthesizing quercetin-4' -glucoside Active CN110029118B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910316885.9A CN110029118B (en) 2019-04-19 2019-04-19 Method for synthesizing quercetin-4' -glucoside

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910316885.9A CN110029118B (en) 2019-04-19 2019-04-19 Method for synthesizing quercetin-4' -glucoside

Publications (2)

Publication Number Publication Date
CN110029118A true CN110029118A (en) 2019-07-19
CN110029118B CN110029118B (en) 2023-10-10

Family

ID=67239216

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910316885.9A Active CN110029118B (en) 2019-04-19 2019-04-19 Method for synthesizing quercetin-4' -glucoside

Country Status (1)

Country Link
CN (1) CN110029118B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110872594A (en) * 2019-12-09 2020-03-10 四川农业大学 Blackberry glycosyltransferase gene and application thereof
CN111662831A (en) * 2020-06-12 2020-09-15 浙江工业大学 Aspergillus niger Rha-N1 and application thereof
CN113322219A (en) * 2021-02-19 2021-08-31 南京工业大学 Method for synthesizing curcumin glucoside compound by biological method catalysis
CN116445441A (en) * 2022-11-30 2023-07-18 东北农业大学 Soybean glycosyltransferase and encoding gene and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103589702A (en) * 2013-11-19 2014-02-19 南京市第一医院 Application of heat-resistant beta-glucosidase and mutants thereof
WO2015028324A2 (en) * 2013-08-30 2015-03-05 Evolva Sa A method for producing modified resveratrol
CN109234337A (en) * 2018-09-14 2019-01-18 南京工业大学 Biosynthesis method of quercetin glycoside

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015028324A2 (en) * 2013-08-30 2015-03-05 Evolva Sa A method for producing modified resveratrol
CN103589702A (en) * 2013-11-19 2014-02-19 南京市第一医院 Application of heat-resistant beta-glucosidase and mutants thereof
CN109234337A (en) * 2018-09-14 2019-01-18 南京工业大学 Biosynthesis method of quercetin glycoside

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIM ET AL.: "Arabidopsis Glycosyltransferases as Biocatalysts in Fermentation for Regioselective Synthesis of Diverse Quercetin Glucosides", 《BIOTECHNOLOGY AND BIOENGINEERING》 *
WENG ET AL.: "Expression, characterization, and site-directed mutagenesis of UDP-glycosyltransferase UGT88A1 from Arabidopsis thaliana", 《BIOENGINEERED》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110872594A (en) * 2019-12-09 2020-03-10 四川农业大学 Blackberry glycosyltransferase gene and application thereof
CN110872594B (en) * 2019-12-09 2021-04-06 四川农业大学 Blackberry glycosyltransferase gene and application thereof
CN111662831A (en) * 2020-06-12 2020-09-15 浙江工业大学 Aspergillus niger Rha-N1 and application thereof
CN113322219A (en) * 2021-02-19 2021-08-31 南京工业大学 Method for synthesizing curcumin glucoside compound by biological method catalysis
CN116445441A (en) * 2022-11-30 2023-07-18 东北农业大学 Soybean glycosyltransferase and encoding gene and application thereof
CN116445441B (en) * 2022-11-30 2023-11-03 东北农业大学 Soybean glycosyltransferase and encoding gene and application thereof

Also Published As

Publication number Publication date
CN110029118B (en) 2023-10-10

Similar Documents

Publication Publication Date Title
CN110029118A (en) Method for synthesizing quercetin-4&#39; -glucoside
US10428364B2 (en) Enzymatic method for preparing rebaudioside M
CN103710318B (en) Method for producing stevioside compounds by using microorganisms
CN109750071A (en) Method for synthesizing rebaudioside M through biocatalysis
CN107236696B (en) A kind of sucrose phosphorylase recombined bacillus subtilis for expressing the source L.mesenteroides
CN104762281B (en) A kind of α rhamnosidases and its preparation method and application
CN106754595B (en) Recombinant bacterium and application thereof in catalyzing rebaudioside A to generate rebaudioside D
CN108929878A (en) The encoding gene of algin catenase and its application
CN106190938A (en) The recombination bacillus coli of a kind of structure and the method for biosynthesis 3 &#39; saliva lactose
CN104312996B (en) Alpha-L-rhamnosidase Rha1 as well as expressed gene and application of alpha-L-rhamnosidase Rha1
CN111662831A (en) Aspergillus niger Rha-N1 and application thereof
CN106834389A (en) Method for preparing rebaudioside M2 by catalyzing rebaudioside A through recombinant bacteria
CN105505899A (en) Preparation method and application of inulinase
CN109957555A (en) A kind of glycosyl transferase mutant and its application in catalysis Gastrodin biosynthesis
CN109652481A (en) A kind of application of cyclodextrin glycosyl transferases in production alpha-glycosyl aurantiamarin
US11976312B2 (en) Enzymatic method for preparing Rebaudioside C
CN114107341B (en) Application of fungal source alpha-L-rhamnosidase in icariin production
CN110452916A (en) Henbane aldehyde reductase and its application
CN106916838A (en) It is catalyzed gene C sRHMb and its encoding proteins and the application of UDP rhamnose biosynthesis
CN109234337B (en) Biosynthesis method of quercetin glycoside
CN112852843A (en) Flavonol 3-O-galactosyltransferase gene and encoding protein and application thereof
CN104651337B (en) A kind of zytase, its encoding gene xyn lxy and its application
CN114875054B (en) Method for preparing glycosylated stevioside compound by enzymatic method and derivative thereof
CN114214296B (en) Maitake mushroom UDP glucosyltransferase as well as encoding gene and application thereof
CN104293758B (en) A kind of Panax Japonicus Var. Major β armomadendrins synthase gene and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant