CN110016498A - The method of single nucleotide polymorphism is determined in the sequencing of Sanger method - Google Patents
The method of single nucleotide polymorphism is determined in the sequencing of Sanger method Download PDFInfo
- Publication number
- CN110016498A CN110016498A CN201910332899.XA CN201910332899A CN110016498A CN 110016498 A CN110016498 A CN 110016498A CN 201910332899 A CN201910332899 A CN 201910332899A CN 110016498 A CN110016498 A CN 110016498A
- Authority
- CN
- China
- Prior art keywords
- sequence
- base
- value
- kmer
- measured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the method that single nucleotide polymorphism is determined in a kind of sequencing of Sanger method, the method includes deriving from the base sequence file of the high quality of the same sequence to be measured to pass through building kmer Hash table, using kmer sequence as the key of Hash table, it is value corresponding to the key with the number that kmer sequence occurs in whole sequence, carries out the high quality base sequence splicing assembling using kmer value.It determines that complete analysis process automation may be implemented in the method for single nucleotide polymorphism in Sanger method sequencing of the invention, need to only set relevant parameter, centre is participated in without artificial, directly output destination file.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to the side of single nucleotide polymorphism is determined in the sequencing of Sanger method
Method.
Background technique
Sanger sequencing is DNA sequencing technology " goldstandard ", and crucial promotion has once been played in the Human Genome Project
Effect, and be still used to obtain pin-point accuracy and reliable sequencing data now.
During Sanger sequencing, archaeal dna polymerase replicates list by the way that nucleotide is added into growing chain (extension products)
Chain DNA template.Chain elongation occurs to select to be added in amplified production by the base pair complementarity with template at 3 ' ends of primer
Deoxynucleotide.
Sanger sequencing extends the primer being incorporated on sequence template undetermined using a kind of archaeal dna polymerase.Until incorporation
Until a kind of chain termination nucleotide.Sequencing is individually reacted by a set of four and is constituted each time, and each reaction is containing all
Four kinds of deoxynucleotide triphosphoric acids (dNTP), and it is mixed into a kind of different dideoxyribonucleoside triphosphate (ddNTP) of limitation.Due to
DdNTP, which lacks, extends required 3-OH group, terminates extended oligonucleotide selectively at G, A, T or C.It terminates
Depending on point is by double deoxidation corresponding in reaction.The relative concentration of each dNTPs and ddNTPs is adjustable, and reaction is made to obtain one
The chain termination product of group leader's hundreds to thousands base.
Currently, Sanger sequencing data base quality need according to the corresponding peak figure value of base each in abi file into
Pedestrian's work distinguishes and removes low-quality base by hand, has certain manual operation error, while existing method carries out
When this step process, can only a sequence handled, result is exported after terminating and carries out the operation of next sequence again, seriously
Affect analysis progress.And when carrying out the splicing between sequence, the above problem is equally existed, a sample can only be once carried out
Sequence assembly, analysis result just can be carried out the analysis of next sample after the completion.And it is carried out for generation Sanger sequencing data
When SNP is detected, need to be distinguished according to multiple peak figure values of same position in abi file, only when minor peaks and main peak value
Reach certain ratio range, just can determine that this base positions, there are SNP variations, since peak value can not carry out number in current method
Quantization can only manually be estimated, there are serious manual operation errors according to peak figure height, if sequence is longer, be carried out
Artificial SNP, which differentiates, to be needed to take a significant amount of time, and can not improve working efficiency.And the analysis based on generation Sanger sequencing data
Method can not be improved on the basis of existing method to realize Quality Control, splicing and the full-automatic analysis of SNP detection.
Summary of the invention
In one embodiment, the present invention provides the side that single nucleotide polymorphism is determined in a kind of sequencing of Sanger method
Method the described method comprises the following steps: step 1: according to the length of each sequence to be measured, designing N and carry out PCR amplification, N to primer
For the integer not less than 2, sequence to be measured can be completely covered to primer in N；Step 2: to the amplified production of each sequence to be measured into
The sequencing of row Sanger method, each sequence to be measured generate 2N Sanger sequencing abi file, the abi file of each sequence to be measured into
Row name, in order to be identified according to the name from the same sequence to be measured；Step 3: by Sanger sequencing abi text
Part is converted to text formatting file, and does normalized to base signal value；Step 4: being deleted by sliding window method lower than pre-
If the sequence of base mass value, synchronization removal is lower than base mass value corresponding to the sequence area of default base mass value, obtains
Obtain high quality base sequence and corresponding base mass value；Step 5: will be from the high quality of the same sequence to be measured
Base sequence file is by building kmer Hash table, using kmer sequence as the key of Hash table, with kmer sequence in whole sequence
The number of appearance is value corresponding to the key, carries out the high quality base sequence splicing assembling using kmer value；With step 6:
The high quality base sequence and corresponding base mass value obtained based on step 4 obtains time maximum base of each base position
The ratio of signal value and maximum base signal value assesses every and splices the more of the sequence after assembling when the value is greater than preset value
Then state property site stores and exports the polymorphic site information of every sequence to be measured.
In one embodiment, sliding window range used in the sliding window method is 5-20bp, it is therefore preferable to 5-10bp.
In one embodiment, the default base mass value is 30-60, it is therefore preferable to which mass value range is 50-60.
In one embodiment, in step 2, each abi file of the sequence to be measured is with sequence names to be measured+draw
Name claims mode to be named.
In one embodiment, the high quality sequential file of the same sequence to be measured will be derived from according to sequence name to be measured
Primer in title is ranked up, and is constructed the kmer Hash table of two adjacent sequences to be spliced respectively, is with kmer sequence
The key of Hash table is value corresponding to the key with the number that kmer sequence occurs in whole sequence, respectively from adjacent two sequences
Retrieval whether there is the identical key for representing kmer sequence in the key of the corresponding Hash table of column, and the key is only corresponding unique
Value subtracts 1 to kmer value, continues to search for when identical key is not present in two sequences, is up to finding maximum kmer value
Only, based on existed simultaneously in adjacent two sequences and unique all kmer sequences corresponding to location information, orient two sequences
Maximum overlapping interval between column obtains location information of the section in two sequences.
In one embodiment, the kmer value range is 90-150bp.
In one embodiment, the preset value is not less than 0.25.
In one embodiment, in step 6, mononucleotide polymorphism site recognition result is defeated with Excel file format
Out, coordinate position and corresponding base of the record mononucleotide polymorphism site in splicing sequence.
It, can be in common windows using the method for determining single nucleotide polymorphism in Sanger method sequencing of the invention
The system computerized automatic multiple abi layout sequence files read in data input file folder of upper realization, in the future according to file name
A plurality of sequence derived from same sample carries out sliding window method automatic fitration both ends low quality base, carries out SNP after completing sequence assembly
Detection exports SNP site degeneracy base, splices sequence and corresponding peak figure result into data result file, then successively locates
The data file in input data file folder is managed, until completing all data files.
It is automatic to determine that complete analysis process may be implemented in the method for single nucleotide polymorphism in Sanger method sequencing of the invention
Change, need to only set relevant parameter, centre is participated in without artificial, directly output destination file.The method can be to avoid in sequence
The error that artificial interpretation generates in Quality Control filtering and SNP detection process, obtained result are more accurate.Full-automatic flow process can simultaneously
Largely to save analysis time, if carrying out sequence Quality Control and splicing using commercial methods, a sample can only be inputted every time
Sequence analyzed, then exported again after artificial interpretation SNP site information corresponding as a result, a sample takes around 3-5
The time of minute, and only need 5-6 seconds time that same work can be completed using the method for the present invention, it is greatly improved work
Efficiency.
Detailed description of the invention
It in order to more clearly explain the technical solutions in the embodiments of the present application, below will be to needed in the embodiment
Attached drawing is briefly described, it should be apparent that, the accompanying drawings in the following description is only some embodiments as described in this application, right
For those of ordinary skill in the art, without creative efforts, it can also be obtained according to these attached drawings
Its attached drawing.
Fig. 1 be the original lower machine sequence of sample LSYZ2017020_SeqF3 and sliding window length (win) be respectively 5bp, 10bp,
When 15bp and 20bp carry out the removal of low quality base after sequence 5 ' and 3 ' hold peak figures；
Fig. 2 is the original lower machine sequence of sample LSYZ2017020_SeqF3 and fixed sliding window length (win) is 5bp, base matter
The average value of amount is lower than 5 ' and 3 ' end peak figures of the sequence being removed when preset base mass value (QC) 30,40,50 and 60；
Fig. 3 is high quality sequential file after six of sample LSYZ2017020 filter, according to sequence SeqR3-SeqR4-
SeqRT-R2-SeqPRT-F2-SeqF3-SeqF4 carries out sequence assembly assembling, and Kmer is respectively set to 20,25,30,35,40,
45,50,60,70,80,90,100,150,160,180 and 200 assembling result sequence display diagram；
Fig. 4 is high quality sequential file splicing assembling schematic diagram and actual number after six of sample LSYZ2017020 filter
According to assembling display diagram；
Fig. 5 is the different SNP cutoff values detection SNP site peak figure result display diagram of sample LSYZ2017020；
Fig. 6 is the data splicing and mononucleotide polymorphism site recognition result display diagram of sample LSYZ2017020；
Fig. 7 be the original lower machine sequence of sample LSYZ2017032_SeqF3 and sliding window length (win) be respectively 5bp, 10bp,
When 15bp and 20bp carry out the removal of low quality base after sequence 5 ' and 3 ' hold peak figures；
Fig. 8 is the original lower machine sequence of sample LSYZ2017032_SeqF3 and fixed sliding window length (win) is 5bp, base matter
The average value of amount is lower than 5 ' and 3 ' end peak figures of the sequence being removed when preset base mass value (QC) 30,40,50 and 60；
Fig. 9 is high quality sequential file after six of LSYZ2017032 filter, according to sequence SeqR3-SeqR4-SeqRT-
R2-SeqPRT-F2-SeqF3-SeqF4 carries out sequence assembly assembling, and Kmer is respectively set to 20,25,30,35,40,45,50,
60,70,80,90,100,150,160,180 and 200 assembling result sequence display diagram；
Figure 10 is high quality sequential file after six of LSYZ2017041 filter, according to sequence SeqR3-SeqR4-
SeqRT-R2-SeqPRT-F2-SeqF3-SeqF4 carries out sequence assembly assembling, and Kmer is respectively set to 20,25,30,35,40,
45,50,60,70,80,90,100,150,160,180 and 200 assembling result sequence display diagram；
Figure 11 is high quality sequential file splicing assembling schematic diagram and actual number after six of sample LSYZ2017032 filter
According to assembling display diagram；
Figure 12 is high quality sequential file splicing assembling schematic diagram and actual number after six of sample LSYZ2017041 filter
According to assembling display diagram；
Figure 13 is the different SNP cutoff values detection SNP site peak figure result display diagram of sample LSYZ2017032；
Figure 14 is the different SNP cutoff values detection SNP site peak figure result display diagram of sample LSYZ2017041；With
Figure 15 is data splicing and the mononucleotide polymorphism site of sample LSYZ2017032 and sample LSYZ2017041
Recognition result display diagram.
Specific embodiment
In order to make art technology field personnel more fully understand the technical solution in the application, below in conjunction with embodiment
The invention will be further described, it is clear that and described embodiments are only a part of embodiments of the present application, rather than whole
Embodiment.Based on the embodiment in the application, those of ordinary skill in the art are obtained without making creative work
The all other embodiment obtained, shall fall within the protection scope of the present application.The present invention is made with reference to the accompanying drawings and embodiments
It further describes.
Embodiment one: the method that the method for the present invention surveys single nucleotide polymorphism in simple sequence
One, object to be measured sequence length :~1200bp designs 3 pairs of sequencing primers, specific as shown in table 1.
1 amplimer information table of table
| Primer | Base constitutes (5 ' -3 ') | Position (HXB2) |
| PRT-F2 | CTTTARCTTCCCTCARATCACTCT | 2243-2266 |
| RT-R2 | CTTCTGTATGTCATTGACAGTCC | 3326-3304 |
| SeqF3 | AGTCCTATTGARACTGTRCCAG | 2556-2577 |
| SeqR3 | TTTYTCTTCTGTCAATGGCCA | 2639-2619 |
| SeqF4 | CAGTACTGGATGTGGGRGAYG | 2869-2889 |
| SeqR4 | TACTAGGTATGGTAAATGCAGT | 2952-2931 |
Two, the amplified production for treating sequencing column carries out the sequencing of Sanger method, obtains six Sanger sequencing abi files, text
Part name is formed with sample names+Primer, sequence names LSYZ2017020- (SeqPRT-F2), LSYZ2017020-
(SeqF3), LSYZ2017020- (SeqF4), LSYZ2017020- (SeqRT-R2), LSYZ2017020- (SeqR3) and
Above-mentioned sequential file is placed in same data input file folder by LSYZ2017020- (SeqR4), and computer is according to sequence text
Part title automatic identification belongs to the sequencing file of sequence to be measured, and carries out subsequent analysis.
Three, Sanger sequencing abi file is converted to text formatting file, and normalizing is done to base quality signal value
Change processing.
Four, the sequence lower than default base mass value is deleted by sliding window method, synchronization removal is lower than default base quality
Base mass value corresponding to the sequence area of value obtains high quality base sequence and corresponding base mass value, detailed process
It is as follows:
1. setting sliding window length is respectively 5bp, 10bp, 15bp and 20bp detection sequence base mass average value works as base
When the average value of quality is greater than preset base mass value (default value 50), stop sliding, deletes lower than default base quality
The sequence of value, relevant information corresponding to synchronization removal low base mass-sequential region, obtain high quality base sequence and its
Related data information；Six Sanger sequencing abi file in data input file folder is successively handled using the method:
LSYZ2017020- (SeqPRT-F2), LSYZ2017020- (SeqF3), LSYZ2017020- (SeqF4), LSYZ2017020-
(SeqRT-R2), LSYZ2017020- (SeqR3) and LSYZ2017020- (SeqR4).
By taking sample LSYZ2017020_SeqF3 as an example, it is 5bp, 10bp, 15bp that length, which is respectively set, in primitive sequencer sequence
With 20bp sliding window, detection sequence base mass average value, when the average value of base quality is greater than preset base mass value (default
When value is 50), stop sliding, deletes lower than the sequence for presetting base mass value, synchronization removal low base mass-sequential region institute
Corresponding relevant information, obtains the base sequence and its related data information of high quality, and exports peak figure file.Since sequence is sequenced
Column length is longer, it has not been convenient to show completely, in order to preferably compare the quality evaluation effect of different length sliding window, interception is former respectively
Beginning sequencing sequence and 5bp, 10bp, 15bp and 20bp length sliding window remove 5 ' and 3 ' end peak figures progress of sequence after low quality base
It is parallel to compare, as shown in Figure 1.Following correlated series peak figures are relatively all made of such 5 ' and 3 ' end peak figure mode of interception, remaining sequence
Arrange LSYZ2017020-SeqF4, LSYZ2017020-SeqPRT-F2, LSYZ2017020-SeqR3, LSYZ2017020-SeqR4
It successively carries out the removal of low quality base according to the method described above to LSYZ2017020-SeqRT-R2 and related corresponding peak figure compares.
After original series and four kinds of different length sliding windows progress base quality evaluations and removal low quality base
5 ' and 3 ' end peak figure results be compared analysis, according to the quantity of removal low quality base and the peak of reservation high quality base
Value information suggests when the quality of data filters using sliding window range being 5-10bp.
2. setting sliding window length is 5bp detection sequence base mass average value, preset when the average value of base quality is greater than
Base mass value 30,40,50 and 60 when, stop sliding, delete the sequence lower than default base mass value, the low alkali of synchronization removal
Relevant information corresponding to matrix amount sequence area obtains the base sequence and its related data information of high quality；Using this side
Method successively handles six Sanger sequencing abi file in data input file folder: LSYZ2017020- (SeqPRT-F2),
LSYZ2017020- (SeqF3), LSYZ2017020- (SeqF4), LSYZ2017020- (SeqRT-R2), LSYZ2017020-
(SeqR3) and LSYZ2017020- (SeqR4).
By taking sample LSYZ2017020SeqF3 as an example, setting sliding window length is 5bp detection sequence base mass average value, when
When the average value of base quality is greater than preset base mass value 30,40,50 and 60, stop sliding, deletes lower than default base
The sequence of mass value, relevant information corresponding to synchronization removal low base mass-sequential region, obtains the base sequence of high quality
And its related data information, and export peak figure file.The average value of primitive sequencer sequence and base quality is intercepted respectively lower than pre-
If base mass value 30,40,50 with 60 when be removed the 5 ' of sequence with peak figure progress is parallel at 3 ' ends compares, as shown in Figure 2.
Remaining sequence LSYZ2017020-SeqF4, LSYZ2017020-SeqPRT-F2, LSYZ2017020-SeqR3,
LSYZ2017020-SeqR4 and LSYZ2017020-SeqRT-R2 successively carries out the removal of low quality base and phase according to the method described above
Corresponding peak figure is closed to compare.Base quality evaluation and removal low quality are carried out according to original series and four kinds of different bases mass values
5 ' and 3 ' later end peak figure results of base are compared analysis, the quantity and reservation high quality according to removal low quality base
The peak information of base suggests when the quality of data filters using mass value range being 50-60.
Five, building kmer Hash will be passed through from the base sequence file of the high quality of the same sequence to be measured
Table is value corresponding to the key with the number that kmer sequence occurs in whole sequence, makes using kmer sequence as the key of Hash table
The high quality base sequence splicing assembling is carried out with kmer value.
1. by after six of a sample filterings high quality sequential file according to Primer in sample names into
Row sequence (seq1-seq2-seq3-seq4-seq5-seq6) constructs two sequence (seql-seq2, seq2- to be spliced respectively
Seq3, seq3-seq4 etc.) kmer Hash table, using kmer sequence as the key of Hash table, with kmer sequence in whole sequence go out
Existing number is value corresponding to the key, is retrieved from the key of Hash table corresponding to two sequences with the presence or absence of identical respectively
The key of kmer sequence is represented, and the key only corresponds to unique value, when identical key is not present in two sequences, to kmer value
Subtract 1, continue to search for, until finding maximum kmer value, based on existing simultaneously and uniquely own in two sequences
Location information corresponding to kmer sequence orients maximum overlapping interval between two sequences, obtains the section in two sequences
In location information；
By taking LSYZ2017020 sample as an example, by identifying the high quality sequential file after six filterings of this sample,
It is ranked up SeqR3-SeqR4-SeqPRT-F2-SeqRT-R2-SeqF3-SeqF4 according to Primer in sample names, is such as schemed
Shown in 3；Then sequence assembly assembling is carried out according to the method described above, Kmer is respectively set to 20,25,30,35,40,45,50,60,
70,80,90,100,150,160,180 and 200, assessment sequence assembles result.
Sequence is compared using MEGA software in 16 kinds of Kmer assembling result sequences, as a result as Fig. 3 shows all Kmer
Under the conditions of, sequence assembling result is length 1061bp.Picture left-hand column shows the sequence names of different Kmer assembling results, after
Sidebar show after the series of assembling compare sequence as a result, tetra- kinds of bases of ATCG be individually identified as green, it is red, light blue with
And four kinds of colors such as purple, degeneracy base is without color identifier, if all aligned sequences are consistent in the base of same position,
The upside field mark of picture knows *, is otherwise blank.Alignment and assembbly assembling as a result, it has been found that, 16 kinds of Kmer assembling splicing result length are complete
It is complete consistent, indifference, but it is variant to assemble SNP identification in sequence.
2 LSYZ2017020 sample difference Kmer of table assembles result SNP statistical form
The SNP site and corresponding base that identify in 16 kinds of Kmer assembling splicing results are counted, it is as shown in table 2, left
Sidebar is the position coordinates of SNP in the sequence, and upper sidebar is 16 kinds of Kmer values, and rear side column is that SNP corresponds to base, and Ref indicates ginseng
Series are examined, Alt indicates the mutating alkali yl of assembling sequence.It is found from upper table analysis, Kmer value is greater than after 150bp, exists
Some site SNP undetected situation, in conjunction with the test result of multiple samples, it is proposed that carry out sequence assembly group using this method
It is 90-150bp that kmer value range is used when dress.
It is shown 2. six high quality sequences splice assembling result respectively
Such as Fig. 4, six high quality sequences from same sample are ranked up according to Primer in sample names
SeqR3-SeqR4-SeqPRT-F2-SeqRT-R2-SeqF3-SeqF4 (Fig. 4-A) then carries out sequence according to above-mentioned Kmer method
Column splicing assembling, Fig. 4-B shows SeqR3, SeqR4 implementations consistent with the end comparison of SeqPRT-F2 sequence 5 ', according to splicing side
Case, this region aligned sequences generate a consensus sequence after assembling, and as sequence after splicing assembling, Fig. 4-C show SeqR3
The end of sequence 3 ', the end of SeqR4 sequence 3 ', the end of SeqPRT-F2 sequence 5 ' and the consistent implementations of the end comparison of SeqRT-R2 sequence 5 ', Fig. 4-
D shows the end of SeqR4 sequence 3 ', the end of SeqPRT-F2 sequence 3 ', the end of SeqRT-R2 sequence 3 ', the end of SeqF3 sequence 3 ' and SeqF4 sequence
The end of column 5 ' compares consistent implementations.
Six, the high quality base sequence and corresponding base mass value obtained based on step 4, obtains each base position
The ratio of secondary maximum base signal value and maximum base signal value, when the value is greater than preset value, after assessing every splicing assembling
Sequence polymorphic site, then store and export the polymorphic site information of every sequence to be measured.
1. obtaining each base position based on the high quality sequence and associated data files that obtain after filtering in step 4
The ratio of secondary maximum base signal value and maximum base signal value, when the value be greater than preset value (be respectively set to 0.2,0.25,
0.33,0.5) when, polymorphic site is assessed；
Preset value (cut off) is assessed according to four kinds of different SNP, SNP site in identification assembling sequence and corresponding
Base, statistical result is as shown in table 3, left-hand column for SNP coordinate position in the sequence, upper sidebar be preset value, rear side column
For the corresponding base of detection SNP site, Ref indicates reference sequences base, and Alt indicates the mutating alkali yl of assembling sequence, indicate not
Detect SNP.For same position at different preset value 0.2,0.25,0.33 and 0.5, SNP testing result has difference in analytical table 3
It is different, it chooses the base peak figure (Fig. 5) that coordinate position is 5,401,463,554 and 812 and carries out detailed analysis, left-hand column is pre- in figure
If value, rear side column is that 5 different coordinate positions correspond to the peak figure of base as a result, according to practical peak figure result judgement, and analysis carries out
Suggest using cut off value minimum 0.25 when polymorphic position point analysis.
3 difference SNP cutoff value testing result of table
The splicing of 2.Sanger sequencing data and mononucleotide polymorphism site recognition result
As a result output file names (Fig. 6-A) with import file name, by six sequence assembly results of same samples sources
(Fig. 6-B) is exported with fasta format, wherein mononucleotide polymorphism site is recorded in the form of degeneracy base, in splicing result
Base mass value is converted into figure signal and exports (Fig. 6-C) with pdf formatted file, and mononucleotide polymorphism site is with blue bar column
Mark, while mononucleotide polymorphism site recognition result exports (Fig. 6-D) with Excel file format, record SNP site is being spelled
Connect the coordinate position in sequence and corresponding base.
Embodiment two: the method that the method for the present invention surveys single nucleotide polymorphism in two sample sequences.
One, by taking sample LSYZ2017032 and LSYZ2017041 as an example, each sample sequencing obtains six Sanger sequencings
Abi file, filename are formed with sample names+Primer, and sequence names are respectively LSYZ2017032- (SeqPRT-F2),
LSYZ2017032- (SeqF3), LSYZ2017032- (SeqF4), LSYZ2017032- (SeqRT-R2), LSYZ2017032-
(SeqR3) and LSYZ2017032- (SeqR4)；LSYZ2017041- (SeqPRT-F2), LSYZ2017041- (SeqF3),
LSYZ2017041- (SeqF4), LSYZ2017041- (SeqRT-R2), LSYZ2017041- (SeqR3) and LSYZ2017041-
(SeqR4).Above-mentioned sequential file is placed in same data input file folder, computer is known automatically according to sequence file name
Do not belong to the sequencing file of sequence to be measured, and carries out subsequent analysis.
Two, Sanger sequencing abi file is converted to text formatting file, and normalizing is done to base quality signal value
Change processing.
Three, the sequence lower than default base mass value is deleted by sliding window method, synchronization removal is lower than default base quality
Base mass value corresponding to the sequence area of value obtains high quality base sequence and corresponding base mass value:
1. setting sliding window length is respectively 5bp, 10bp, 15bp and 20bp detection sequence base mass average value works as base
When the average value of quality is greater than preset base mass value (default value 50), stop sliding, deletes lower than default base quality
The sequence of value, relevant information corresponding to synchronization removal low base mass-sequential region, obtain high quality base sequence and its
Related data information；12 Sanger sequencing abi file in data input file folder is successively handled using the method:
LSYZ2017032- (SeqPRT-F2), LSYZ2017032- (SeqF3), LSYZ2017032- (SeqF4), LSYZ2017032-
(SeqRT-R2), LSYZ2017032- (SeqR3) and LSYZ2017032- (SeqR4)；LSYZ2017041- (SeqPRT-F2),
LSYZ2017041- (SeqF3), LSYZ2017041- (SeqF4), LSYZ2017041- (SeqRT-R2), LSYZ2017041-
(SeqR3) and LSYZ2017041- (SeqR4).
By taking sample LSYZ2017032_SeqF3 as an example, it is 5bp, 10bp, 15bp that length, which is respectively set, in primitive sequencer sequence
With 20bp sliding window, detection sequence base mass average value, when the average value of base quality is greater than preset base mass value (default
When value is 50), stop sliding, deletes lower than the sequence for presetting base mass value, synchronization removal low base mass-sequential region institute
Corresponding relevant information, obtains the base sequence and its related data information of high quality, and exports peak figure file.Since sequence is sequenced
Column length is longer, it has not been convenient to show completely, in order to preferably compare the quality evaluation effect of different length sliding window, interception is former respectively
Beginning sequencing sequence and 5bp, 10bp, 15bp and 20bp length sliding window remove 5 ' and 3 ' end peak figures progress of sequence after low quality base
Parallel to compare (Fig. 7), following correlated series peak figures are relatively all made of such 5 ' and 3 ' end peak figure modes of interception, remaining sequence
LSYZ2017032-SeqF4, LSYZ2017032-SeqPRT-F2, LSYZ2017032-SeqR3, LSYZ2017032-SeqR4 and
LSYZ2017032-SeqRT-R successively carries out the removal of low quality base according to the method described above and related corresponding peak figure compares.Sample
Six sequences of LSYZ2017041 are also all made of above method progress low quality base removal and related corresponding peak figure compares.
After original series and four kinds of different length sliding windows progress base quality evaluations and removal low quality base
5 ' and 3 ' end peak figure results be compared analysis, according to the quantity of removal low quality base and the peak of reservation high quality base
Value information suggests when the quality of data filters using sliding window range being 5-10bp.
2. setting sliding window length is 5bp detection sequence base mass average value, preset when the average value of base quality is greater than
Base mass value 30,40,50 and 60 when, stop sliding, delete the sequence lower than default base mass value, the low alkali of synchronization removal
Relevant information corresponding to matrix amount sequence area obtains the base sequence and its related data information of high quality；Using this side
Method successively handle data input file folder in 12 Sanger sequencing abi file, LSYZ2017032- (SeqPRT-F2),
LSYZ2017032- (SeqF3), LSYZ2017032- (SeqF4), LSYZ2017032- (SeqRT-R2), LSYZ2017032-
(SeqR3) and LSYZ2017032- (SeqR4)；LSYZ2017041- (SeqPRT-F2), LSYZ2017041- (SeqF3),
LSYZ2017041- (SeqF4), LSYZ2017041- (SeqRT-R2), LSYZ2017041- (SeqR3) and LSYZ2017041-
(SeqR4)。
By taking sample LSYZ2017032_SeqF3 as an example, setting sliding window length is 5bp detection sequence base mass average value,
When the average value of base quality is greater than preset base mass value 30,40,50 and 60, stop sliding, deletes lower than default alkali
The sequence of matrix magnitude, relevant information corresponding to synchronization removal low base mass-sequential region, obtains the base sequence of high quality
Column and its related data information, and export peak figure file.Primitive sequencer sequence is intercepted respectively and the average value of base quality is lower than
Peak figure progress is parallel the 5 ' of the sequence being removed when preset base mass value 30,40,50 is with 60 and 3 ' ends compares (Fig. 8),
Remaining sequence LSYZ2017032-SeqF4, LSYZ2017032-SeqPRT-F2, LSYZ2017032-SeqR3, LSYZ2017032-
SeqR4 successively carries out the removal of low quality base and related corresponding peak figure ratio to LSYZ2017032-SeqRT-R2 according to the method described above
Compared with.Six sequences of sample LSYZ2017041 are also all made of the above method and carry out the removal of low quality base and related corresponding peak figure
Compare.
According to original series and four kinds of different bases mass values carry out base quality evaluations and removal low quality base with
5 ' and 3 ' end peak figure results afterwards are compared analysis, according to the quantity for removing low quality base and retain high quality base
Peak information suggests when the quality of data filters using mass value range being 50-60.
Four, building kmer Hash will be passed through from the base sequence file of the high quality of the same sequence to be measured
Table is value corresponding to the key with the number that kmer sequence occurs in whole sequence, makes using kmer sequence as the key of Hash table
The high quality base sequence splicing assembling is carried out with kmer value:
1. by after six of a sample filterings high quality sequential file according to Primer in sample names into
Row sequence (seq1-seq2-seq3-seq4-seq5-seq6) constructs two sequence (seq1-seq2, seq2- to be spliced respectively
Seq3, seq3-seq4 etc.) kmer Hash table, using kmer sequence as the key of Hash table, with kmer sequence in whole sequence go out
Existing number is value corresponding to the key, is retrieved from the key of Hash table corresponding to two sequences with the presence or absence of identical respectively
The key of kmer sequence is represented, and the key only corresponds to unique value, when identical key is not present in two sequences, to kmer value
Subtract 1, continue to search for, until finding maximum kmer value, based on existing simultaneously and uniquely own in two sequences
Location information corresponding to kmer sequence orients maximum overlapping interval between two sequences, obtains the section in two sequences
In location information；
By taking LSYZ2017032 and LSYZ2017041 sample as an example, by being identified after six filterings of sample respectively
High quality sequential file is ranked up SeqR3-SeqR4-SeqPRT-F2-SeqRT-R2- according to Primer in sample names
Then SeqF3-SeqF4 carries out sequence assembly assembling according to the method described above, Kmer is respectively set to 20,25,30,35,40,45,
50,60,70,80,90,100,150,160,180 and 200, assessment sequence assembles result.
By each 16 kinds of Kmer of LSYZ2017032 and LSYZ2017041 sample assembling result sequence using MEGA software into
Row compare sequence, as the result is shown under the conditions of (Fig. 9 and 10) all Kmer, sequence assembling result length be respectively 1056bp and
1057bp.Picture left-hand column shows that the sequence names of different Kmer assembling results, rear side column show that the series of assembling compare
As a result, tetra- kinds of bases of ATCG are individually identified as four kinds of colors such as green, red, light blue and purple, degeneracy base after sequence
Without color identifier, if all aligned sequences are consistent in the base of same position, picture upside field mark know *, otherwise for
Blank.Alignment and assembbly assembling as a result, it has been found that, 16 kinds of Kmer of each sample assembling splicing result length is completely the same, indifference,
But SNP identification is variant in assembling sequence.
4 LSYZ2017032 sample difference Kmer of table assembles result SNP statistical form
5 LSYZ2017041 sample difference Kmer of table assembles result SNP statistical form
The SNP site and corresponding base that identify in 16 kinds of Kmer assembling splicing result of two samples are united respectively
Meter, as shown in table 4 and 5, left-hand column is the position coordinates of SNP in the sequence, and upper sidebar is 16 kinds of Kmer values, and rear side column is SNP
Corresponding base, Ref indicate reference sequences base, and Alt indicates the mutating alkali yl of assembling sequence.It is found from upper table analysis, Kmer value
After 150bp, there is a situation where that some site SNP are undetected, in conjunction with the test result of multiple samples, it is proposed that use this
Inventive method carries out using kmer value range when sequence assembly assembling being 90-150bp.
Six high quality sequences from same sample are ranked up SeqR3- according to Primer in sample names
SeqR4-SeqPRT-F2-SeqRT-R2-SeqF3-SeqF4 (Figure 11-A and 12A) then carries out sequence according to above-mentioned Kmer method
Column splicing assembling, Figure 11-B and 12-B show SeqR3, SeqR4 implementations consistent with the end comparison of SeqPRT-F2 sequence 5 ', foundation
Connection scheme, this region aligned sequences generate a consensus sequence after assembling, as splicing assembling after sequence, Figure 11-C and
12-C shows that the end of SeqR3 sequence 3 ', the end of SeqR4 sequence 3 ', the end of SeqPRT-F2 sequence 5 ' and the end of SeqRT-R2 sequence 5 ' compare one
Cause implementations, Figure 11-D and 12-D show the end of SeqR4 sequence 3 ', the end of SeqPRT-F2 sequence 3 ', the end of SeqRT-R2 sequence 3 ',
The end of SeqF3 sequence 3 ' implementations consistent with the end comparison of SeqF4 sequence 5 '.
Five, based on the high quality sequence and associated data files obtained after filtering in step 4, each base position is obtained
The ratio of secondary maximum base signal value and maximum base signal value, when the value be greater than preset value (be respectively set to 0.2,0.25,
0.33,0.5) when, polymorphic site is assessed.
Preset value (cut off) is assessed according to four kinds of different SNP, SNP site in identification assembling sequence and corresponding
Base, LSYZ2017032 and LSYZ2017041 sample statistics results as shown in tables 6 and 7, left-hand column for SNP in the sequence
Coordinate position, upper sidebar are preset value, and rear side column is the corresponding base of detection SNP site, and Ref indicates reference sequences base, Alt
Indicate assembling sequence mutating alkali yl, indicate SNP is not detected.Same position is not in 6 sample LSYZ2017032 of analytical table
When with preset value 0.2,0.25,0.33 and 0.5, SNP testing result is variant, and choosing coordinate position is 28,100,254 and 1045
Base peak figure (Figure 13) carry out detailed analysis, in 7 sample LSYZ2017041 of analytical table same position different preset values 0.2,
0.25,0.33 and 0.5 when, SNP testing result is variant, choose coordinate position be 459,653,656,683,696 and 736 alkali
Base peak figure (Figure 14) carries out detailed analysis, and left-hand column is preset value in figure, and rear side column is that 5 different coordinate positions correspond to base
As a result, according to practical peak figure result judgement, analysis suggest when polymorphic position point analysis minimum using cut off value peak figure
0.25。
6 LSYZ2017032 sample difference SNP cutoff value testing result of table
7 LSYZ2017041 sample difference SNP cutoff value testing result of table
As a result output file names (Figure 15-A) with import file name, by six sequences of LSYZ2017032 samples sources
Splicing result exports (Figure 15-B) with fasta format, and wherein mononucleotide polymorphism site is recorded in the form of degeneracy base, spells
Base mass value is converted into figure signal and exports (Figure 15-D) with pdf formatted file in binding fruit, mononucleotide polymorphism site
With blue bar column mark, while mononucleotide polymorphism site recognition result exports (Figure 16-F) with Excel file format, record
Coordinate position and corresponding base of the SNP site in splicing sequence；By six sequences of LSYZ2017041 samples sources
Splicing result exports (Figure 15-C) with fasta format, and wherein mononucleotide polymorphism site is recorded in the form of degeneracy base, spells
Base mass value is converted into figure signal and exports (Figure 15-E) with pdf formatted file in binding fruit, mononucleotide polymorphism site
With blue bar column mark, while mononucleotide polymorphism site recognition result exports (Figure 15-G) with Excel file format, record
Coordinate position and corresponding base of the SNP site in splicing sequence.
It should be understood that the present invention disclosed is not limited only to specific method, scheme and the substance of description, because these
It is alterable.It will also be understood that purpose of the terminology used here just for the sake of the specific embodiment scheme of description, rather than
It is intended to limit the scope of the invention, the scope of the present invention is limited solely by the attached claims.
Those skilled in the art, which will also be appreciated that or be able to confirm that, uses no more than routine experiment, institute herein
The many equivalents for the specific embodiment of the invention stated.These equivalents are also contained in the attached claims.
Claims (8)
- The method of single nucleotide polymorphism is determined in the sequencing of 1.Sanger method, which is characterized in that the described method comprises the following steps:Step 1: according to the length of each sequence to be measured, designs N and PCR amplification carried out to primer, N is the integer not less than 2, N pairs Sequence to be measured can be completely covered in primer；Step 2: the sequencing of Sanger method being carried out to the amplified production of each sequence to be measured, each sequence to be measured generates 2N Sanger Abi file is sequenced, the abi file of each sequence to be measured is named, in order to identify according to the name from same Sequence to be measured；Step 3: Sanger sequencing abi file being converted to text formatting file, and base signal value is done at normalization Reason；Step 4: the sequence lower than default base mass value being deleted by sliding window method, synchronization removal is lower than default base mass value Sequence area corresponding to base mass value, obtain high quality base sequence and corresponding base mass value；Step 5: building kmer Hash table will be passed through from the base sequence file of the high quality of the same sequence to be measured, Using kmer sequence as the key of Hash table, it is value corresponding to the key with the number that kmer sequence occurs in whole sequence, uses Kmer value carries out the high quality base sequence splicing assembling；WithStep 6: the high quality base sequence and corresponding base mass value obtained based on step 4 obtains each base position The ratio of secondary maximum base signal value and maximum base signal value, when the value is greater than preset value, after assessing every splicing assembling Sequence polymorphic site, then store and export the polymorphic site information of every sequence to be measured.
- 2. the method according to claim 1, wherein in step 4, sliding window model used in the sliding window method It encloses for 5-20bp, it is therefore preferable to 5-10bp.
- 3. the default base mass value is 30-60 the method according to claim 1, wherein in step 4, Preferably mass value range is 50-60.
- 4. the method according to claim 1, wherein in step 2, each abi file of the sequence to be measured It is named in a manner of sequence names+Primer to be measured.
- 5. according to the method described in claim 4, it is characterized in that, by from the high quality sequence text of the same sequence to be measured Part is ranked up according to the Primer in sequence names to be measured, constructs the kmer Hash of two adjacent sequences to be spliced respectively Table is value corresponding to the key with the number that kmer sequence occurs in whole sequence using kmer sequence as the key of Hash table, point Retrieval whether there is the identical key for representing kmer sequence not from the key of Hash table corresponding to adjacent two sequences, and should Only corresponding unique value subtracts 1 to kmer value, continues to search for key when identical key is not present in two sequences, until looking for Until maximum kmer value, based on existed simultaneously in adjacent two sequences and unique all kmer sequences corresponding to position letter Breath, orients maximum overlapping interval between two sequences, obtains location information of the section in two sequences.
- 6. according to the method described in claim 5, it is characterized in that, the kmer value range is 90-150bp.
- 7. the method according to claim 1, wherein the preset value is not less than 0.25 in step 6.
- 8. the method according to claim 1, wherein in step 6, mononucleotide polymorphism site recognition result with The output of Excel file format, coordinate position and corresponding alkali of the record mononucleotide polymorphism site in splicing sequence Base.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910332899.XA CN110016498B (en) | 2019-04-24 | 2019-04-24 | Method for determining single nucleotide polymorphism in Sanger method sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910332899.XA CN110016498B (en) | 2019-04-24 | 2019-04-24 | Method for determining single nucleotide polymorphism in Sanger method sequencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110016498A true CN110016498A (en) | 2019-07-16 |
| CN110016498B CN110016498B (en) | 2020-05-08 |
Family
ID=67192262
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910332899.XA Active CN110016498B (en) | 2019-04-24 | 2019-04-24 | Method for determining single nucleotide polymorphism in Sanger method sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110016498B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113380323A (en) * | 2021-07-19 | 2021-09-10 | 浙江迪谱诊断技术有限公司 | Sanger sequencing peak image interception identification method and system, computer equipment and storage medium |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103593659A (en) * | 2013-11-26 | 2014-02-19 | 华南农业大学 | Method for identifying SNP in individual in Sanger sequencing oriented to PCR products of diploid |
| CN104239750A (en) * | 2014-08-25 | 2014-12-24 | 北京百迈客生物科技有限公司 | High-throughput sequencing data-based genome de novo assembly method |
| CN104951672A (en) * | 2015-06-19 | 2015-09-30 | 中国科学院计算技术研究所 | Splicing method and system of second generation and third generation genomic sequencing data combination |
| WO2016183348A1 (en) * | 2015-05-12 | 2016-11-17 | The Johns Hopkins University | Methods, systems and devices comprising support vector machine for regulatory sequence features |
| CN106566877A (en) * | 2016-10-31 | 2017-04-19 | 天津诺禾致源生物信息科技有限公司 | Gene mutation detection method and apparatus |
| CN107034287A (en) * | 2017-05-22 | 2017-08-11 | 中南大学 | The common SNPs of NAT2 Sanger PCR sequencing PCRs are disposably detected for isoniazid personalized medicine |
| CN107403075A (en) * | 2017-08-02 | 2017-11-28 | 深圳市瀚海基因生物科技有限公司 | Comparison method, apparatus and system |
| CN107944223A (en) * | 2017-11-10 | 2018-04-20 | 深圳裕策生物科技有限公司 | Point mutation detection filter method, device and storage medium based on the sequencing of two generations |
| CN108121897A (en) * | 2016-11-29 | 2018-06-05 | 华为技术有限公司 | A kind of genome mutation detection method and detection device |
| CN108763869A (en) * | 2018-04-25 | 2018-11-06 | 江苏理工学院 | A kind of sequencing data high-efficient treatment method |
-
2019
- 2019-04-24 CN CN201910332899.XA patent/CN110016498B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103593659A (en) * | 2013-11-26 | 2014-02-19 | 华南农业大学 | Method for identifying SNP in individual in Sanger sequencing oriented to PCR products of diploid |
| CN104239750A (en) * | 2014-08-25 | 2014-12-24 | 北京百迈客生物科技有限公司 | High-throughput sequencing data-based genome de novo assembly method |
| WO2016183348A1 (en) * | 2015-05-12 | 2016-11-17 | The Johns Hopkins University | Methods, systems and devices comprising support vector machine for regulatory sequence features |
| CN104951672A (en) * | 2015-06-19 | 2015-09-30 | 中国科学院计算技术研究所 | Splicing method and system of second generation and third generation genomic sequencing data combination |
| CN106566877A (en) * | 2016-10-31 | 2017-04-19 | 天津诺禾致源生物信息科技有限公司 | Gene mutation detection method and apparatus |
| CN108121897A (en) * | 2016-11-29 | 2018-06-05 | 华为技术有限公司 | A kind of genome mutation detection method and detection device |
| CN107034287A (en) * | 2017-05-22 | 2017-08-11 | 中南大学 | The common SNPs of NAT2 Sanger PCR sequencing PCRs are disposably detected for isoniazid personalized medicine |
| CN107403075A (en) * | 2017-08-02 | 2017-11-28 | 深圳市瀚海基因生物科技有限公司 | Comparison method, apparatus and system |
| CN107944223A (en) * | 2017-11-10 | 2018-04-20 | 深圳裕策生物科技有限公司 | Point mutation detection filter method, device and storage medium based on the sequencing of two generations |
| CN108763869A (en) * | 2018-04-25 | 2018-11-06 | 江苏理工学院 | A kind of sequencing data high-efficient treatment method |
Non-Patent Citations (3)
| Title |
|---|
| HILL JT ET AL.: "Poly Peak Parser: Method and Software for Identification of Unknown Indels Using Sanger Sequencing of Polymerase Chain Reaction Products", 《DEVELOPMENTAL DYNAMICS》 * |
| 撕拉瓦S爱泼斯坦: "《未培养微生物》", 31 December 2010, 山东大学出版社 * |
| 梁新乐: "《现代微生物学实验指导》", 31 March 2014, 浙江工商大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113380323A (en) * | 2021-07-19 | 2021-09-10 | 浙江迪谱诊断技术有限公司 | Sanger sequencing peak image interception identification method and system, computer equipment and storage medium |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110016498B (en) | 2020-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111951895B (en) | Pathogen analysis method based on metagenomics analysis device, apparatus, and storage medium | |
| CN108073791B (en) | Method based on two generation sequencing datas detection target gene structure variation | |
| CN110993029B (en) | Method and system for detecting chromosome abnormality | |
| CN104293778B (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN105368830A (en) | Core SNP markers developed based on KASP (competitive allele specific) technology and applied to cotton hybrid identification | |
| CN106755519B (en) | Method for identifying homozygous and heterozygous transgenic corn double antibody 12-5 based on digital PCR and application | |
| CN110016498A (en) | The method of single nucleotide polymorphism is determined in the sequencing of Sanger method | |
| CN102559878B (en) | Composite amplification system and detection kit of mouse short tandem repeat | |
| CN108220473B (en) | Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker | |
| CN111793707B (en) | Gene editing transgenic crop editing site specificity PCR method and application thereof | |
| CN114530200B (en) | Mixed sample identification method based on calculation of SNP entropy | |
| KR101915701B1 (en) | Method for measuring mutation rate | |
| KR102174019B1 (en) | Molecular marker based on chloroplast sequence for discriminating Codonopsis lanceolata and Codonopsis pilosula and uses thereof | |
| CN108330213B (en) | Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection | |
| CN108676906B (en) | SSR locus of corn chloroplast genome and application of SSR locus in variety identification | |
| CN107868843B (en) | Method for screening high-polymorphism molecular marker sites of mung beans | |
| CN110305936A (en) | The specificity amplification primer of sika deer microsatellite locus M009 a kind of and its application | |
| CN113122647A (en) | Quantitative identification method for safflower macrogol in mixed tobacco leaf based on fluorescent quantitative PCR technology | |
| CN110890134A (en) | Method for identifying dendrobium candidum base source by using chloroplast genome large single copy area | |
| CN117757979B (en) | Primer group, kit and identification method for identifying soybean varieties | |
| CN117476100B (en) | DNA copy number content and mass concentration amount value conversion method | |
| CN111363792B (en) | Kit and method for detecting gene polymorphism based on shared primer probe and application | |
| CN111304358B (en) | EST-SSR primer developed based on wax gourd transcriptome sequence and application thereof | |
| CN110438251B (en) | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) | |
| JP6646120B1 (en) | DNA identification method capable of individual identification with degraded DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |